|
|
- Horatio Owen
- 5 years ago
- Views:
Transcription
1
2
3
4
5
6
7
8
9
10
11 Supplemental Data. Tameling et al. (2010). Plant Cell /tpc Supplemental Table 1. Primers used in plasmid construction Primer Code Sequence eo1 5 -GCCATGGCTCATGCAAGTGTGGCTTCTC-3 eo2 5 -CGGTACCAACCATATTGTTCTTAACCTTC-3 wo88 5 -CTAGAGGTCGACTCTCGAGTGCACGGATCCT-3 wo89 5 -TCGAAGGATCCGTGCACTCGAGAGTCGACCT-3 wo93 5 -AACTCGAGTCTAGATCGTCATCTTCTCTCACTGG-3 wo GTCGACATGGATTCTGCAGGATTCTCTCTGA-3 wo GGATCCTATTACACCTTCTGCAGATTCCTTTG-3 wo AGTCGACGGATCCATGGTGAGCAAGGGCGAGG-3 wo TCCCGGGTTACTCGAGCTTGTACAGCTCGTCCATGC-3 wo GATTTGCGGAACAATATGTTTG-3 wo CAAACATATTGTTCCGCAAATC-3 wo GATTTGCGGGCTAATATGTTTGG-3 wo CCAAACATATTAGCCCGCAAATC-3 wo CGAGGGGCCTAAAAAGAAGCGTAAGGTTGAGGACCCTGGATAATCTAGAC-3 wo CCGGGTCTAGATTATCCAGGGTCCTCAACCTTACGCTTCTTTTTAGGCCCC-3 wo TCGAGGGGCCTAAAAACAAGCGTAAGGTTGAGGACCCTGGATAATCTAGAC-3 wo CCGGGTCTAGATTATCCAGGGTCCTCAACCTTACGCTTGTTTTTAGGCCCC-3 wo ACTCGAGGGAGGTGGAATGTTACGTCCTGTAGAAAC-3 wo TCCCGGGTCATTGTTTGCCTCCCTGC-3 wo AGAATTCATGGCTTATGCTGCTGTTAC-3 wo TGGATCCTACATGAGGCGCATGTGATGAG-3 wo AGGATCCGGGGGAGGCAGCATGGCTTATGCTGCTGTTACTT-3 wo TGTCGACTACATGAGGCGCATGTGATGAG-3 wo AGAATTCATGGCTGAGAATATAATGGTTGGCCG-3 wo TGGATCCTCACATGAGGCGCATGTGATGA-3 wo AATTCGTCGACATCGATGGATCCTGAC-3 wo TCGAGTCAGGATCCATCGATGTCGACG-3 wo TCTCGAGTTACTAGTCAATAGCTTCTTGTATAGCTGC-3 wo ACTCGAGCATTGGAGGATGGTCACGG-3 wo AACTAGTCCTTGAGCCTTGTCTCCAACTCG-3
12 Supplemental Methods Plasmid Construction A fragment of the 3 -coding sequence of RanGAP2 was amplified with the oligonucleotides wo227 and wo93, introducing 5 XhoI and SpeI sites and 3 XhoI and XbaI sites, subcloned in the PCR4 Blunt TOPO vector (Invitrogen) resulting in the plasmid SOL195. The RanGAP2 fragment was excised with XhoI and XbaI and ligated in the XhoI/XbaI-digested TRV2 vector (Liu et al., 2002), resulting in ptrv:rg2-b (SOL199). Subsequently, a fragment of the 3 - coding sequence of RanGAP1 was amplified with the oligonucleotides wo228 and wo229, introducing a 5 XhoI site and a 3 SpeI site, subcloned in the PCR4 Blunt TOPO vector (Invitrogen), excised with XhoI and SpeI and ligated in XhoI/SpeI-digested SOL199, resulting in TRV:Rg1+2 (SOL202). For the domain swap construct prx1:r1g23r45 (under control of the Rx1 regulatory sequences), encoding the CC and LRR domains of Rx and the NB-ARC domain of GPA2, the internal Nsi and ApaLI sites were used for exchanging corresponding fragments (Slootweg, 2009). For the domain swap construct pgapii:g13r45 (under control of the GPA2 regulatory sequences) encoding the CC- and NB-ARC domain of GPA2 and the LRR domain of Rx, the internal ApaLI site was used for exchanging corresponding fragments (Slootweg, 2009). The binary plasmids pbin61-rx-nb-arc-myc, pbin61-rx-cc-ha and the pbin61-gfp-cp32tk (Moffett et al., 2002), and the binary plasmid pb1-rx(e400k) (Bendahmane et al., 2002), were described previously. Virus-Induced Gene Silencing and PVX-Inoculation VIGS was performed as described in Liu et al. (2002) and TRV:GUS, TRV:Rg2 and TRV:SGT were described in Tameling et al. (2007). Four weeks after TRV inoculation wild type N. benthamiana plants were challenge-inoculated by agroinfiltration in one leaf with an Agrobacterium suspension (OD 600 of 0.001) carrying the binary PVX-GFP plasmid pgr208 (Peart et al., 2002). Viral spread was monitored under UV light to detect GFP fluorescence.
13 Supplemental References Bendahmane, A., Farnham, G., Moffett, P., and Baulcombe, D.C. (2002). Constitutive gain-offunction mutants in a nucleotide binding site- leucine rich repeat protein encoded at the Rx locus of potato. Plant J. 32, Hillig, R.C., Renault, L., Vetter, I.R., Drell, T.t., Wittinghofer, A., and Becker, J. (1999). The crystal structure of rna1p: a new fold for a GTPase-activating protein. Mol. Cell 3, Kelley, L.A., and Sternberg, M.J. (2009). Protein structure prediction on the Web: a case study using the Phyre server. Nature Protoc. 4, Liu, Y., Schiff, M., Marathe, R., and Dinesh-Kumar, S.P. (2002). Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J. 30, Moffett, P., Farnham, G., Peart, J., and Baulcombe, D.C. (2002). Interaction between domains of a plant NBS-LRR protein in disease resistance-related cell death. EMBO J. 21, Peart, J.R., Cook, G., Feys, B.J., Parker, J.E., and Baulcombe, D.C. (2002). An EDS1 orthologue is required for N-mediated resistance against tobacco mosaic virus. Plant J. 29, Slootweg, E. (2009). Structure, function and subcellular localization of the potato Resistance protein Rx1, PhD thesis. Tameling, W.I.L., and Baulcombe, D.C. (2007). Physical association of the NB-LRR resistance protein Rx with a Ran GTPase activating protein is required for extreme resistance to potato virus X. Plant Cell 19,
Supplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
More informationTransitivity-dependent and transitivity-independent cell-to-cell movement of RNA
Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly
More informationNucleocytoplasmic Distribution Is Required for Activation of Resistance by the Potato NB-LRR Receptor Rx1 and Is Balanced by Its Functional Domains W
The Plant Cell, Vol. 22: 4195 4215, December 2010, www.plantcell.org ã 2010 American Society of Plant Biologists Nucleocytoplasmic Distribution Is Required for Activation of Resistance by the Potato NB-LRR
More information,(CL806925),(CL ),(CL829057),(CL ),(CL862603) BAC45136 putative nucleotide-binding
Additional Data File 13. List of 83 disease resistance-related genes that matched the unmapped BESs of On, Or, and Og. BESs that had internal stop codons within the aligned regions are presented in parentheses.
More informationLooking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationArabidopsis HSP90 protein modulates RPP4-mediated temperature-dependent cell death and defense responses
Research Arabidopsis HSP90 protein modulates RPP4-mediated temperature-dependent cell death and defense responses Fei Bao 1, Xiaozhen Huang 1, Chipan Zhu 2, Xiaoyan Zhang 1, Xin Li 2 and Shuhua Yang 1
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationStrain or plasmid Relevant characteristics Reference
Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688
More informationSupplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationYeast two-hybrid screening for Rx binding proteins and random mutagenesis study of the RanGAP2-WPP domain
Master Thesis Report Phytopathology Department Master Programme Plant Biotechnology Yeast two-hybrid screening for Rx binding proteins and random mutagenesis study of the RanGAP2-WPP domain J.Eduardo Rojas
More informationRNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
More informationUsing virus-induced gene silencing to identify novel regulators of plasmodesmal function
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2014 Using virus-induced gene
More informationMini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for
Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI
More information7. Advances in host-pathogen molecular interactions: rust effectors as targets for recognition
7. Advances in host-pathogen molecular interactions: rust effectors as targets for recognition Peter Dodds 1, Greg Lawrence 1, Rohit Mago 1, Michael Ayliffe 1, Narayana Upadhyaya 1, Les Szabo 2, Robert
More informationCorrected Proof. Thirumala-Devi Kanneganti, Edgar Huitema, and Sophien Kamoun. Corrected
Proof Pathogen Gene Expression In planta 35 4 In planta Expression of Oomycete and Fungal Genes Thirumala-Devi Kanneganti, Edgar Huitema, and Sophien Kamoun Summary Large-scale genome sequencing projects
More informationAnalysis of a hybrid TATA box binding protein originating from mesophilic and thermophilic donor organisms
Spectroscopy 24 (2010) 233 237 233 DOI 10.3233/SPE-2010-0434 IOS Press Analysis of a hybrid TATA box binding protein originating from mesophilic and thermophilic donor organisms Annette Kopitz a,b, Jörg
More informationGene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
More informationVirus mediated Strategies for Transient Gene Expression and Silencing in Cotton
Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton Brian Ayre, Dept. of Biological Sciences, University of North Texas, Denton, Texas Overview Virus mediated gene delivery
More informationTowards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008
Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus Greening Summit Florida Citrus Growers Institute 2008 Jude Grosser University of Florida, Citrus Research and Education Center,
More informationStructural Studies of the Flexible Filamentous Plant Viruses
Structural Studies of the Flexible Filamentous Plant Viruses Caitlin Azzo Dr. Gerald Stubbs BSCI 296 [4] Honors Thesis April 23, 2014 The Plant Viruses of Interest In the Potyviridae family: Wheat streak
More informationResistance proteins: scouts of the plant innate immune system
Eur J Plant Pathol (2008) 121:243 255 DOI 10.1007/s10658-007-9187-8 REVIEW Resistance proteins: scouts of the plant innate immune system Wladimir I. L. Tameling & Frank L. W. Takken Accepted: 9 July 2007
More informationUpstream Elements Regulating mir-241 and mir-48 Abstract Introduction
Upstream Elements Regulating mir-241 and mir-48 Hanna Vollbrecht, Tamar Resnick, and Ann Rougvie University of Minnesota: Twin Cities Undergraduate Research Scholarship 2012-2013 Abstract Caenorhabditis
More informationLeucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family
Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family GENES & DEVELOPMENT (2000) 14: 108 117 INTRODUCTION Flower Diagram INTRODUCTION Abscission In plant, the process by which a plant
More informationPlant Physiology Preview. Published on February 8, 2018, as DOI: /pp
Plant Physiology Preview. Published on February 8, 2018, as DOI:10.1104/pp.17.01828 1 2 3 4 5 6 7 8 9 10 11 12 Short Title: A Network for Systemic RNA Silencing in plants Corresponding Author: Yiguo Hong
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationChalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence
Plant Molecular Biology 55: 521 530, 2004. Ó 2004 Kluwer Academic Publishers. Printed in the Netherlands. 521 Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence
More informationQuantitative Nature of Arabidopsis Responses during Compatible and Incompatible Interactions with the Bacterial Pathogen Pseudomonas syringae
The Plant Cell, Vol. 15, 317 330, February 2003, www.plantcell.org 2003 American Society of Plant Biologists Quantitative Nature of Arabidopsis Responses during Compatible and Incompatible Interactions
More informationSupporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
More informationTranslation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
More informationComplex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways
252 Opinion TENDS in Plant Science Vol.8 No.6 June 2003 Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways Ken Shirasu 1 and Paul Schulze-Lefert
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More informationSupplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA
I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationRecent advances in plant NLR structure, function, localization, and signaling
Recent advances in plant NLR structure, function, localization, and signaling Dong Qi and Roger W. Innes* Department of Biology, Indiana University, Bloomington, IN, USA REVIEW ARTICLE published: 21 October
More informationTomato MAPKKKe is a positive regulator of cell-death signaling networks associated with plant immunity
The Plant Journal (2010) 64, 379 391 doi: 10.1111/j.1365-313X.2010.04333.x Tomato MAPKKKe is a positive regulator of cell-death signaling networks associated with plant immunity Shiri Melech-Bonfil and
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationThe EGF Signaling Pathway! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 3. EGF promotes cell growth
Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 3 Question of the Day: Who is the son of Sevenless? Introduction! Signal transduction involves the changing of a cell s metabolism or gene
More informationAn expression plasmid encoding the GFP and SEAP reporter genes. For research use only
pvitro2-blasti-gfp/seap An expression plasmid encoding the GFP and SEAP reporter genes Catalog # pvitro2-bgfpsp For research use only Version # 15I09-MM PRODUCT INFORMATION Contents: - 20 µg of pvitro2-blasti-gfp/seap
More informationFlowering Time Control in Plants -How plants know the time to flower?
Advanced Molecular and Cell Biology II, 2015/12/04 Flowering Time Control in Plants -How plants know the time to flower? Masaki NIWA Grad. Sch. Biostudies, Kyoto Univ. Why can plants bloom every year in
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationHost-Pathogen interaction-ii. Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur
Host-Pathogen interaction-ii Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur-176062 It was originally believed that gene-for-gene resistance was conferred by a direct interaction
More informationM. oryzae Yashiromochi (Pita) Pi No.4 (Pita2) Fukunishiki (Piz) M. oryzae Ina168
Supplemental Data Yoshida et al., (2009) Association genetics reveals three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae. M. oryzae 70-15????????????? Sasanishiki (Pia)
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationPopulation transcriptomics uncovers the regulation of gene. expression variation in adaptation to changing environment
Supplementary information Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment Qin Xu 1, Caiyun Zhu 2,4, Yangyang Fan 1,4, Zhihong Song
More informationExpression of Viral Resistance in Transformed Petunia Plants Regenerated in Vitro
Expression of Viral Resistance in Transformed Petunia Plants Regenerated in Vitro Meira Ziv and Mirit Gandelman The RH Smith Institute of Plant Science The Hebrew University of Jerusalem, Rehovot, PO Box
More informationcote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work
SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)
More informationChem Lecture 10 Signal Transduction
Chem 452 - Lecture 10 Signal Transduction 111202 Here we look at the movement of a signal from the outside of a cell to its inside, where it elicits changes within the cell. These changes are usually mediated
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationThe order and the amount of the samples: marker 10μL, 1-12M 10μL, T7 promoter 10μL, 1-12O 10μL.
Cloning of T7 promoter + rbs + GFP + terminator 2009/6/24 10:50 Miniprep the plasmids containing T7 promoter, standard parts 1-12M and 1-12O. 1-12M: medium rbs + GFP coding gene + terminator 1-12O: strong
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationJingyi Fei, Pallav Kosuri, Daniel D. MacDougall, and Ruben L. Gonzalez, Jr.
Molecular Cell, Volume 30 Supplemental Data Coupling of Ribosomal L1 Stalk and trna Dynamics during Translation Elongation Jingyi Fei, Pallav Kosuri, Daniel D. MacDougall, and Ruben L. Gonzalez, Jr. Supplemental
More informationSalicylic Acid and Jasmonic Acid Are Essential for Systemic Resistance Against Tobacco mosaic virus in Nicotiana benthamiana
MPMI Vol. 27, No. 6, 2014, pp. 567 577. http://dx.doi.org/10.1094/mpmi-11-13-0349-r e-xtra* Salicylic Acid and Jasmonic Acid Are Essential for Systemic Resistance Against Tobacco mosaic virus in Nicotiana
More informationEffects of the Chromosome Partitioning Protein Spo0J (ParB) on oric Positioning and Replication Initiation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Feb. 2003, p. 1326 1337 Vol. 185, No. 4 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.4.1326 1337.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Effects
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationBacterial spot of pepper and tomato
Website to brush up on bacterial diseases Bacterial spot of pepper and tomato http://www.apsnet.org/edcenter/intropp/lessons/prokaryotes/pages/bacterialspot.aspx Potato blackleg and soft rot http://www.apsnet.org/edcenter/intropp/lessons/prokaryotes/pages/blacklegpotato.aspx
More informationRon et al SUPPLEMENTAL DATA
Ron et al SUPPLEMENTAL DATA Hairy root transformation using Agrobacterium rhizogenes as a tool for exploring cell type-specific gene expression and function using tomato as a model Mily Ron, Kaisa Kajala,
More informationIdentification of Novel Pepper Genes Involved in Bax- or INF1-Mediated Cell Death Responses by High-Throughput Virus-Induced Gene Silencing
Int. J. Mol. Sci. 2013, 14, 22782-22795; doi:10.3390/ijms141122782 Communication OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Identification of Novel
More informationChapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi
Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids Prepared by Woojoo Choi Dead or alive? 1) In this chapter we will explore the twilight zone of biology and the gene creature who live there.
More informationVCE BIOLOGY, CHEMISTRY, PHYSICS, MATHS METHODS (CAS) & SPECIALIST MATHS
VCE BIOLOGY, CHEMISTRY, PHYSICS, MATHS METHODS (CAS) & SPECIALIST MATHS VCE INTENSIVE PROGRAMS SEMESTER 2 2011 Sample questions 1. Biology Unit 4 Intensive Program....................... 2 2. Chemistry
More informationStructure and Function of Disease Resistance Proteins in Plants
American Journal of Microbiology and Immunology Vol. 2, No. 1, 2017, pp. 1-6 http://www.aiscience.org/journal/ajmi Structure and Function of Disease Resistance Proteins in Plants Adane Gebeyehu Demissie
More informationSUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
More informationSupp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate
Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal
More informationBacterial strains, plasmids, and growth conditions. Bacterial strains and
I Text I Materials and Methods acterial strains, plasmids, and growth conditions. acterial strains and plasmids used in this study are listed in I Table. almonella enterica serovar Typhimurium strains
More information44691, USA. Summary. Introduction
The Plant Journal (2007) 49, 1030 1040 doi: 10.1111/j.1365-313X.2006.03022.x A high-throughput screen of cell-death-inducing factors in Nicotiana benthamiana identifies a novel MAPKK that mediates INF1-induced
More informationSmall RNAs in plant defense responses during viral and bacterial interactions: similarities and differences
REVIEW ARTICLE published: 05 September 2013 doi: 10.3389/fpls.2013.00343 responses during viral and bacterial interactions: similarities and differences Pablo Peláez and Federico Sanchez* Departamento
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12890 Supplementary Table 1 Summary of protein components in the 39S subunit model. MW, molecular weight; aa amino acids; RP, ribosomal protein. Protein* MRP size MW (kda) Sequence accession
More informationESR1 Allele Frequency. PIK3CA Allele Frequency
Supplementary Figure 1 Distribution of mutant allele frequencies ESR1 Allele Frequency Median allele frequency 0.45% Inset graph 10 20 30 40 50 PIK3CA Allele Frequency Median allele frequency 3.6% Inset
More informationChapter 8. Summarizing Discussion
Chapter 8 Summarizing Discussion Chapter 8 This thesis focuses on the ecology and pathogenicity of biovar 3 Dickeya sp. provisionally called D. solani, a blackleg and soft rot pathogen, recently introduced
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More informationOptimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli
Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4
More informationEdward M. Golenberg Wayne State University Detroit, MI
Edward M. Golenberg Wayne State University Detroit, MI Targeting Phragmites Success As Invasive Species Phragmites displays multiple life history parameters High seed output and small seed size Rapid growth
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationSignaling from the plasma-membrane localized plant immune receptor RPM1 requires self-association of the full-length protein
Signaling from the plasma-membrane localized plant immune receptor RPM1 requires self-association of the full-length protein Farid El Kasmi a,1, Eui-Hwan Chung a,b,1, Ryan G. Anderson a, Jinyue Li c, Li
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09606 Chen Li-Qing et al. A novel class of sugar transporters. Supplementary Figure 1. Confocal imaging of FRET sensor localization in HEK293T cells. The subcellular localization of the
More informationPlasmid Partition System of the P1par Family from the pwr100 Virulence Plasmid of Shigella flexneri
JOURNAL OF BACTERIOLOGY, May 2005, p. 3369 3373 Vol. 187, No. 10 0021-9193/05/$08.00 0 doi:10.1128/jb.187.10.3369 3373.2005 Plasmid Partition System of the P1par Family from the pwr100 Virulence Plasmid
More informationVirp1 Is a Host Protein with a Major Role in Potato Spindle Tuber Viroid Infection in Nicotiana Plants
JOURNAL OF VIROLOGY, Dec. 2007, p. 12872 12880 Vol. 81, No. 23 0022-538X/07/$08.00 0 doi:10.1128/jvi.00974-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Virp1 Is a Host Protein
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationUsing Virus-Induced Gene Silencing and Gene Expression as Tools to Understand Geminivirus Infection in Cotton Plants
1 1 1 1 1 1 1 1 0 1 0 1 TITLE: Using Virus-Induced Gene Silencing and Gene Expression as Tools to Understand Geminivirus Infection in Cotton Plants DISCIPLINE: Genomics and Biotechnology AUTHORS: J.R.
More informationLocalization of Wild Type and Mutant Class I Myosin Proteins in Aspergillus nidulans Using GFP-Fusion Proteins
Cell Motility and the Cytoskeleton 45:163 172 (2000) Localization of Wild Type and Mutant Class I Myosin Proteins in Aspergillus nidulans Using GFP-Fusion Proteins Roxanne A. Yamashita, Nir Osherov, and
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More informationNature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
More informationEcology of Infectious Disease
Ecology of Infectious Disease What is the basis of community robustness (resistance to invasion)? How does robustness influence disease development? The Microbial Context: Microbial Interactions Affect
More informationCharacterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus lanatus)
Song et al. BMC Plant Biology (2015) 15:298 DOI 10.1186/s12870-015-0681-4 RESEARCH ARTICLE Characterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationTi plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines
Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large
More informationPlant Nucleotide Binding Site Leucine-Rich Repeat (NBS-LRR) Genes: Active Guardians in Host Defense Responses
Int. J. Mol. Sci. 2013, 14, 7302-7326; doi:10.3390/ijms14047302 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Plant Nucleotide Binding Site Leucine-Rich
More informationEST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
More informationContents. Foreword. ORCHID BIOTECHNOLOGY II World Scientific Publishing Co. Pte. Ltd.
Foreword Preface v vii 1. Molecular Phylogeny and Biogeography of Phalaenopsis Species 1 1.1 Introduction... 1 1.2 Biogeographical Pattern of Genus Phalaenopsis.. 6 1.3 Molecular Phylogeny and Biogeography
More informationA novel member of the dynamin family of GTP-binding proteins is expressed specifically in the testis
Journal of Cell Science 105, 1-5 (1993) Printed in Great Britain The Company of Biologists Limited 1993 1 A novel member of the dynamin family of GTP-binding proteins is expressed specifically in the testis
More informationDepartment of Plant Cellular and Molecular Biology, Ohio State University, Columbus, Ohio 43210
The Plant Cell, Vol. 20: 1639 1651, June 2008, www.plantcell.org ª 2008 American Society of Plant Biologists Two Distinct Interacting Classes of Nuclear Envelope Associated Coiled-Coil Proteins Are Required
More informationA sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum of toxic heavy metal ions
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 SUPPORTING INFORMATION A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum
More informationFUNCTIONAL ANALYSIS OF Phalaenopsis aphrodite Flowering locus T1 FLOWERING GENE ON TOBACCO PLANT (Nicotiana tabacum L.) ABSTRACT
FUNCTIONAL ANALYSIS OF Phalaenopsis aphrodite Flowering locus T1 FLOWERING GENE ON TOBACCO PLANT (Nicotiana tabacum L.) ABSTRACT Flowering gene Phalaenopsis aphrodite Flowering locus T1 (PaFT1) is an FT
More informationPlant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
More informationSupplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
More informationAnalysis of regulatory function of circadian clock. on photoreceptor gene expression
Thesis of Ph.D. dissertation Analysis of regulatory function of circadian clock on photoreceptor gene expression Tóth Réka Supervisor: Dr. Ferenc Nagy Biological Research Center of the Hungarian Academy
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More information