Size: px
Start display at page:

Download ""

Transcription

1

2

3

4

5

6

7

8

9

10

11 Supplemental Data. Tameling et al. (2010). Plant Cell /tpc Supplemental Table 1. Primers used in plasmid construction Primer Code Sequence eo1 5 -GCCATGGCTCATGCAAGTGTGGCTTCTC-3 eo2 5 -CGGTACCAACCATATTGTTCTTAACCTTC-3 wo88 5 -CTAGAGGTCGACTCTCGAGTGCACGGATCCT-3 wo89 5 -TCGAAGGATCCGTGCACTCGAGAGTCGACCT-3 wo93 5 -AACTCGAGTCTAGATCGTCATCTTCTCTCACTGG-3 wo GTCGACATGGATTCTGCAGGATTCTCTCTGA-3 wo GGATCCTATTACACCTTCTGCAGATTCCTTTG-3 wo AGTCGACGGATCCATGGTGAGCAAGGGCGAGG-3 wo TCCCGGGTTACTCGAGCTTGTACAGCTCGTCCATGC-3 wo GATTTGCGGAACAATATGTTTG-3 wo CAAACATATTGTTCCGCAAATC-3 wo GATTTGCGGGCTAATATGTTTGG-3 wo CCAAACATATTAGCCCGCAAATC-3 wo CGAGGGGCCTAAAAAGAAGCGTAAGGTTGAGGACCCTGGATAATCTAGAC-3 wo CCGGGTCTAGATTATCCAGGGTCCTCAACCTTACGCTTCTTTTTAGGCCCC-3 wo TCGAGGGGCCTAAAAACAAGCGTAAGGTTGAGGACCCTGGATAATCTAGAC-3 wo CCGGGTCTAGATTATCCAGGGTCCTCAACCTTACGCTTGTTTTTAGGCCCC-3 wo ACTCGAGGGAGGTGGAATGTTACGTCCTGTAGAAAC-3 wo TCCCGGGTCATTGTTTGCCTCCCTGC-3 wo AGAATTCATGGCTTATGCTGCTGTTAC-3 wo TGGATCCTACATGAGGCGCATGTGATGAG-3 wo AGGATCCGGGGGAGGCAGCATGGCTTATGCTGCTGTTACTT-3 wo TGTCGACTACATGAGGCGCATGTGATGAG-3 wo AGAATTCATGGCTGAGAATATAATGGTTGGCCG-3 wo TGGATCCTCACATGAGGCGCATGTGATGA-3 wo AATTCGTCGACATCGATGGATCCTGAC-3 wo TCGAGTCAGGATCCATCGATGTCGACG-3 wo TCTCGAGTTACTAGTCAATAGCTTCTTGTATAGCTGC-3 wo ACTCGAGCATTGGAGGATGGTCACGG-3 wo AACTAGTCCTTGAGCCTTGTCTCCAACTCG-3

12 Supplemental Methods Plasmid Construction A fragment of the 3 -coding sequence of RanGAP2 was amplified with the oligonucleotides wo227 and wo93, introducing 5 XhoI and SpeI sites and 3 XhoI and XbaI sites, subcloned in the PCR4 Blunt TOPO vector (Invitrogen) resulting in the plasmid SOL195. The RanGAP2 fragment was excised with XhoI and XbaI and ligated in the XhoI/XbaI-digested TRV2 vector (Liu et al., 2002), resulting in ptrv:rg2-b (SOL199). Subsequently, a fragment of the 3 - coding sequence of RanGAP1 was amplified with the oligonucleotides wo228 and wo229, introducing a 5 XhoI site and a 3 SpeI site, subcloned in the PCR4 Blunt TOPO vector (Invitrogen), excised with XhoI and SpeI and ligated in XhoI/SpeI-digested SOL199, resulting in TRV:Rg1+2 (SOL202). For the domain swap construct prx1:r1g23r45 (under control of the Rx1 regulatory sequences), encoding the CC and LRR domains of Rx and the NB-ARC domain of GPA2, the internal Nsi and ApaLI sites were used for exchanging corresponding fragments (Slootweg, 2009). For the domain swap construct pgapii:g13r45 (under control of the GPA2 regulatory sequences) encoding the CC- and NB-ARC domain of GPA2 and the LRR domain of Rx, the internal ApaLI site was used for exchanging corresponding fragments (Slootweg, 2009). The binary plasmids pbin61-rx-nb-arc-myc, pbin61-rx-cc-ha and the pbin61-gfp-cp32tk (Moffett et al., 2002), and the binary plasmid pb1-rx(e400k) (Bendahmane et al., 2002), were described previously. Virus-Induced Gene Silencing and PVX-Inoculation VIGS was performed as described in Liu et al. (2002) and TRV:GUS, TRV:Rg2 and TRV:SGT were described in Tameling et al. (2007). Four weeks after TRV inoculation wild type N. benthamiana plants were challenge-inoculated by agroinfiltration in one leaf with an Agrobacterium suspension (OD 600 of 0.001) carrying the binary PVX-GFP plasmid pgr208 (Peart et al., 2002). Viral spread was monitored under UV light to detect GFP fluorescence.

13 Supplemental References Bendahmane, A., Farnham, G., Moffett, P., and Baulcombe, D.C. (2002). Constitutive gain-offunction mutants in a nucleotide binding site- leucine rich repeat protein encoded at the Rx locus of potato. Plant J. 32, Hillig, R.C., Renault, L., Vetter, I.R., Drell, T.t., Wittinghofer, A., and Becker, J. (1999). The crystal structure of rna1p: a new fold for a GTPase-activating protein. Mol. Cell 3, Kelley, L.A., and Sternberg, M.J. (2009). Protein structure prediction on the Web: a case study using the Phyre server. Nature Protoc. 4, Liu, Y., Schiff, M., Marathe, R., and Dinesh-Kumar, S.P. (2002). Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J. 30, Moffett, P., Farnham, G., Peart, J., and Baulcombe, D.C. (2002). Interaction between domains of a plant NBS-LRR protein in disease resistance-related cell death. EMBO J. 21, Peart, J.R., Cook, G., Feys, B.J., Parker, J.E., and Baulcombe, D.C. (2002). An EDS1 orthologue is required for N-mediated resistance against tobacco mosaic virus. Plant J. 29, Slootweg, E. (2009). Structure, function and subcellular localization of the potato Resistance protein Rx1, PhD thesis. Tameling, W.I.L., and Baulcombe, D.C. (2007). Physical association of the NB-LRR resistance protein Rx with a Ran GTPase activating protein is required for extreme resistance to potato virus X. Plant Cell 19,

Supplemental material

Supplemental material Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16

More information

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly

More information

Nucleocytoplasmic Distribution Is Required for Activation of Resistance by the Potato NB-LRR Receptor Rx1 and Is Balanced by Its Functional Domains W

Nucleocytoplasmic Distribution Is Required for Activation of Resistance by the Potato NB-LRR Receptor Rx1 and Is Balanced by Its Functional Domains W The Plant Cell, Vol. 22: 4195 4215, December 2010, www.plantcell.org ã 2010 American Society of Plant Biologists Nucleocytoplasmic Distribution Is Required for Activation of Resistance by the Potato NB-LRR

More information

,(CL806925),(CL ),(CL829057),(CL ),(CL862603) BAC45136 putative nucleotide-binding

,(CL806925),(CL ),(CL829057),(CL ),(CL862603) BAC45136 putative nucleotide-binding Additional Data File 13. List of 83 disease resistance-related genes that matched the unmapped BESs of On, Or, and Og. BESs that had internal stop codons within the aligned regions are presented in parentheses.

More information

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells

Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and

More information

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation

More information

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang

More information

Arabidopsis HSP90 protein modulates RPP4-mediated temperature-dependent cell death and defense responses

Arabidopsis HSP90 protein modulates RPP4-mediated temperature-dependent cell death and defense responses Research Arabidopsis HSP90 protein modulates RPP4-mediated temperature-dependent cell death and defense responses Fei Bao 1, Xiaozhen Huang 1, Chipan Zhu 2, Xiaoyan Zhang 1, Xin Li 2 and Shuhua Yang 1

More information

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector

More information

Strain or plasmid Relevant characteristics Reference

Strain or plasmid Relevant characteristics Reference Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688

More information

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

Yeast two-hybrid screening for Rx binding proteins and random mutagenesis study of the RanGAP2-WPP domain

Yeast two-hybrid screening for Rx binding proteins and random mutagenesis study of the RanGAP2-WPP domain Master Thesis Report Phytopathology Department Master Programme Plant Biotechnology Yeast two-hybrid screening for Rx binding proteins and random mutagenesis study of the RanGAP2-WPP domain J.Eduardo Rojas

More information

RNA Synthesis and Processing

RNA Synthesis and Processing RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that

More information

Using virus-induced gene silencing to identify novel regulators of plasmodesmal function

Using virus-induced gene silencing to identify novel regulators of plasmodesmal function University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2014 Using virus-induced gene

More information

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI

More information

7. Advances in host-pathogen molecular interactions: rust effectors as targets for recognition

7. Advances in host-pathogen molecular interactions: rust effectors as targets for recognition 7. Advances in host-pathogen molecular interactions: rust effectors as targets for recognition Peter Dodds 1, Greg Lawrence 1, Rohit Mago 1, Michael Ayliffe 1, Narayana Upadhyaya 1, Les Szabo 2, Robert

More information

Corrected Proof. Thirumala-Devi Kanneganti, Edgar Huitema, and Sophien Kamoun. Corrected

Corrected Proof. Thirumala-Devi Kanneganti, Edgar Huitema, and Sophien Kamoun. Corrected Proof Pathogen Gene Expression In planta 35 4 In planta Expression of Oomycete and Fungal Genes Thirumala-Devi Kanneganti, Edgar Huitema, and Sophien Kamoun Summary Large-scale genome sequencing projects

More information

Analysis of a hybrid TATA box binding protein originating from mesophilic and thermophilic donor organisms

Analysis of a hybrid TATA box binding protein originating from mesophilic and thermophilic donor organisms Spectroscopy 24 (2010) 233 237 233 DOI 10.3233/SPE-2010-0434 IOS Press Analysis of a hybrid TATA box binding protein originating from mesophilic and thermophilic donor organisms Annette Kopitz a,b, Jörg

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton

Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton Brian Ayre, Dept. of Biological Sciences, University of North Texas, Denton, Texas Overview Virus mediated gene delivery

More information

Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008

Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008 Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus Greening Summit Florida Citrus Growers Institute 2008 Jude Grosser University of Florida, Citrus Research and Education Center,

More information

Structural Studies of the Flexible Filamentous Plant Viruses

Structural Studies of the Flexible Filamentous Plant Viruses Structural Studies of the Flexible Filamentous Plant Viruses Caitlin Azzo Dr. Gerald Stubbs BSCI 296 [4] Honors Thesis April 23, 2014 The Plant Viruses of Interest In the Potyviridae family: Wheat streak

More information

Resistance proteins: scouts of the plant innate immune system

Resistance proteins: scouts of the plant innate immune system Eur J Plant Pathol (2008) 121:243 255 DOI 10.1007/s10658-007-9187-8 REVIEW Resistance proteins: scouts of the plant innate immune system Wladimir I. L. Tameling & Frank L. W. Takken Accepted: 9 July 2007

More information

Upstream Elements Regulating mir-241 and mir-48 Abstract Introduction

Upstream Elements Regulating mir-241 and mir-48 Abstract Introduction Upstream Elements Regulating mir-241 and mir-48 Hanna Vollbrecht, Tamar Resnick, and Ann Rougvie University of Minnesota: Twin Cities Undergraduate Research Scholarship 2012-2013 Abstract Caenorhabditis

More information

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family GENES & DEVELOPMENT (2000) 14: 108 117 INTRODUCTION Flower Diagram INTRODUCTION Abscission In plant, the process by which a plant

More information

Plant Physiology Preview. Published on February 8, 2018, as DOI: /pp

Plant Physiology Preview. Published on February 8, 2018, as DOI: /pp Plant Physiology Preview. Published on February 8, 2018, as DOI:10.1104/pp.17.01828 1 2 3 4 5 6 7 8 9 10 11 12 Short Title: A Network for Systemic RNA Silencing in plants Corresponding Author: Yiguo Hong

More information

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

More information

Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence

Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence Plant Molecular Biology 55: 521 530, 2004. Ó 2004 Kluwer Academic Publishers. Printed in the Netherlands. 521 Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence

More information

Quantitative Nature of Arabidopsis Responses during Compatible and Incompatible Interactions with the Bacterial Pathogen Pseudomonas syringae

Quantitative Nature of Arabidopsis Responses during Compatible and Incompatible Interactions with the Bacterial Pathogen Pseudomonas syringae The Plant Cell, Vol. 15, 317 330, February 2003, www.plantcell.org 2003 American Society of Plant Biologists Quantitative Nature of Arabidopsis Responses during Compatible and Incompatible Interactions

More information

Supporting online material

Supporting online material Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins

More information

Translation - Prokaryotes

Translation - Prokaryotes 1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG

More information

Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways

Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways 252 Opinion TENDS in Plant Science Vol.8 No.6 June 2003 Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways Ken Shirasu 1 and Paul Schulze-Lefert

More information

Last time: Obtaining information from a cloned gene

Last time: Obtaining information from a cloned gene Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?

More information

Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA

Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

Recent advances in plant NLR structure, function, localization, and signaling

Recent advances in plant NLR structure, function, localization, and signaling Recent advances in plant NLR structure, function, localization, and signaling Dong Qi and Roger W. Innes* Department of Biology, Indiana University, Bloomington, IN, USA REVIEW ARTICLE published: 21 October

More information

Tomato MAPKKKe is a positive regulator of cell-death signaling networks associated with plant immunity

Tomato MAPKKKe is a positive regulator of cell-death signaling networks associated with plant immunity The Plant Journal (2010) 64, 379 391 doi: 10.1111/j.1365-313X.2010.04333.x Tomato MAPKKKe is a positive regulator of cell-death signaling networks associated with plant immunity Shiri Melech-Bonfil and

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

The EGF Signaling Pathway! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 3. EGF promotes cell growth

The EGF Signaling Pathway! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 3. EGF promotes cell growth Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 3 Question of the Day: Who is the son of Sevenless? Introduction! Signal transduction involves the changing of a cell s metabolism or gene

More information

An expression plasmid encoding the GFP and SEAP reporter genes. For research use only

An expression plasmid encoding the GFP and SEAP reporter genes. For research use only pvitro2-blasti-gfp/seap An expression plasmid encoding the GFP and SEAP reporter genes Catalog # pvitro2-bgfpsp For research use only Version # 15I09-MM PRODUCT INFORMATION Contents: - 20 µg of pvitro2-blasti-gfp/seap

More information

Flowering Time Control in Plants -How plants know the time to flower?

Flowering Time Control in Plants -How plants know the time to flower? Advanced Molecular and Cell Biology II, 2015/12/04 Flowering Time Control in Plants -How plants know the time to flower? Masaki NIWA Grad. Sch. Biostudies, Kyoto Univ. Why can plants bloom every year in

More information

23-. Shoot and root development depend on ratio of IAA/CK

23-. Shoot and root development depend on ratio of IAA/CK Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

More information

Host-Pathogen interaction-ii. Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur

Host-Pathogen interaction-ii. Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur Host-Pathogen interaction-ii Pl Path 604 PN Sharma Department of Plant Pathology CSK HPKV, Palampur-176062 It was originally believed that gene-for-gene resistance was conferred by a direct interaction

More information

M. oryzae Yashiromochi (Pita) Pi No.4 (Pita2) Fukunishiki (Piz) M. oryzae Ina168

M. oryzae Yashiromochi (Pita) Pi No.4 (Pita2) Fukunishiki (Piz) M. oryzae Ina168 Supplemental Data Yoshida et al., (2009) Association genetics reveals three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae. M. oryzae 70-15????????????? Sasanishiki (Pia)

More information

Fitness constraints on horizontal gene transfer

Fitness constraints on horizontal gene transfer Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:

More information

Population transcriptomics uncovers the regulation of gene. expression variation in adaptation to changing environment

Population transcriptomics uncovers the regulation of gene. expression variation in adaptation to changing environment Supplementary information Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment Qin Xu 1, Caiyun Zhu 2,4, Yangyang Fan 1,4, Zhihong Song

More information

Expression of Viral Resistance in Transformed Petunia Plants Regenerated in Vitro

Expression of Viral Resistance in Transformed Petunia Plants Regenerated in Vitro Expression of Viral Resistance in Transformed Petunia Plants Regenerated in Vitro Meira Ziv and Mirit Gandelman The RH Smith Institute of Plant Science The Hebrew University of Jerusalem, Rehovot, PO Box

More information

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)

More information

Chem Lecture 10 Signal Transduction

Chem Lecture 10 Signal Transduction Chem 452 - Lecture 10 Signal Transduction 111202 Here we look at the movement of a signal from the outside of a cell to its inside, where it elicits changes within the cell. These changes are usually mediated

More information

Development 143: doi: /dev : Supplementary information

Development 143: doi: /dev : Supplementary information Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from

More information

The order and the amount of the samples: marker 10μL, 1-12M 10μL, T7 promoter 10μL, 1-12O 10μL.

The order and the amount of the samples: marker 10μL, 1-12M 10μL, T7 promoter 10μL, 1-12O 10μL. Cloning of T7 promoter + rbs + GFP + terminator 2009/6/24 10:50 Miniprep the plasmids containing T7 promoter, standard parts 1-12M and 1-12O. 1-12M: medium rbs + GFP coding gene + terminator 1-12O: strong

More information

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

CHAPTER : Prokaryotic Genetics

CHAPTER : Prokaryotic Genetics CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering

More information

Jingyi Fei, Pallav Kosuri, Daniel D. MacDougall, and Ruben L. Gonzalez, Jr.

Jingyi Fei, Pallav Kosuri, Daniel D. MacDougall, and Ruben L. Gonzalez, Jr. Molecular Cell, Volume 30 Supplemental Data Coupling of Ribosomal L1 Stalk and trna Dynamics during Translation Elongation Jingyi Fei, Pallav Kosuri, Daniel D. MacDougall, and Ruben L. Gonzalez, Jr. Supplemental

More information

Salicylic Acid and Jasmonic Acid Are Essential for Systemic Resistance Against Tobacco mosaic virus in Nicotiana benthamiana

Salicylic Acid and Jasmonic Acid Are Essential for Systemic Resistance Against Tobacco mosaic virus in Nicotiana benthamiana MPMI Vol. 27, No. 6, 2014, pp. 567 577. http://dx.doi.org/10.1094/mpmi-11-13-0349-r e-xtra* Salicylic Acid and Jasmonic Acid Are Essential for Systemic Resistance Against Tobacco mosaic virus in Nicotiana

More information

Effects of the Chromosome Partitioning Protein Spo0J (ParB) on oric Positioning and Replication Initiation in Bacillus subtilis

Effects of the Chromosome Partitioning Protein Spo0J (ParB) on oric Positioning and Replication Initiation in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Feb. 2003, p. 1326 1337 Vol. 185, No. 4 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.4.1326 1337.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Effects

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho

More information

Bacterial spot of pepper and tomato

Bacterial spot of pepper and tomato Website to brush up on bacterial diseases Bacterial spot of pepper and tomato http://www.apsnet.org/edcenter/intropp/lessons/prokaryotes/pages/bacterialspot.aspx Potato blackleg and soft rot http://www.apsnet.org/edcenter/intropp/lessons/prokaryotes/pages/blacklegpotato.aspx

More information

Ron et al SUPPLEMENTAL DATA

Ron et al SUPPLEMENTAL DATA Ron et al SUPPLEMENTAL DATA Hairy root transformation using Agrobacterium rhizogenes as a tool for exploring cell type-specific gene expression and function using tomato as a model Mily Ron, Kaisa Kajala,

More information

Identification of Novel Pepper Genes Involved in Bax- or INF1-Mediated Cell Death Responses by High-Throughput Virus-Induced Gene Silencing

Identification of Novel Pepper Genes Involved in Bax- or INF1-Mediated Cell Death Responses by High-Throughput Virus-Induced Gene Silencing Int. J. Mol. Sci. 2013, 14, 22782-22795; doi:10.3390/ijms141122782 Communication OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Identification of Novel

More information

Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi

Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids Prepared by Woojoo Choi Dead or alive? 1) In this chapter we will explore the twilight zone of biology and the gene creature who live there.

More information

VCE BIOLOGY, CHEMISTRY, PHYSICS, MATHS METHODS (CAS) & SPECIALIST MATHS

VCE BIOLOGY, CHEMISTRY, PHYSICS, MATHS METHODS (CAS) & SPECIALIST MATHS VCE BIOLOGY, CHEMISTRY, PHYSICS, MATHS METHODS (CAS) & SPECIALIST MATHS VCE INTENSIVE PROGRAMS SEMESTER 2 2011 Sample questions 1. Biology Unit 4 Intensive Program....................... 2 2. Chemistry

More information

Structure and Function of Disease Resistance Proteins in Plants

Structure and Function of Disease Resistance Proteins in Plants American Journal of Microbiology and Immunology Vol. 2, No. 1, 2017, pp. 1-6 http://www.aiscience.org/journal/ajmi Structure and Function of Disease Resistance Proteins in Plants Adane Gebeyehu Demissie

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in

More information

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal

More information

Bacterial strains, plasmids, and growth conditions. Bacterial strains and

Bacterial strains, plasmids, and growth conditions. Bacterial strains and I Text I Materials and Methods acterial strains, plasmids, and growth conditions. acterial strains and plasmids used in this study are listed in I Table. almonella enterica serovar Typhimurium strains

More information

44691, USA. Summary. Introduction

44691, USA. Summary. Introduction The Plant Journal (2007) 49, 1030 1040 doi: 10.1111/j.1365-313X.2006.03022.x A high-throughput screen of cell-death-inducing factors in Nicotiana benthamiana identifies a novel MAPKK that mediates INF1-induced

More information

Small RNAs in plant defense responses during viral and bacterial interactions: similarities and differences

Small RNAs in plant defense responses during viral and bacterial interactions: similarities and differences REVIEW ARTICLE published: 05 September 2013 doi: 10.3389/fpls.2013.00343 responses during viral and bacterial interactions: similarities and differences Pablo Peláez and Federico Sanchez* Departamento

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12890 Supplementary Table 1 Summary of protein components in the 39S subunit model. MW, molecular weight; aa amino acids; RP, ribosomal protein. Protein* MRP size MW (kda) Sequence accession

More information

ESR1 Allele Frequency. PIK3CA Allele Frequency

ESR1 Allele Frequency. PIK3CA Allele Frequency Supplementary Figure 1 Distribution of mutant allele frequencies ESR1 Allele Frequency Median allele frequency 0.45% Inset graph 10 20 30 40 50 PIK3CA Allele Frequency Median allele frequency 3.6% Inset

More information

Chapter 8. Summarizing Discussion

Chapter 8. Summarizing Discussion Chapter 8 Summarizing Discussion Chapter 8 This thesis focuses on the ecology and pathogenicity of biovar 3 Dickeya sp. provisionally called D. solani, a blackleg and soft rot pathogen, recently introduced

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4

More information

Edward M. Golenberg Wayne State University Detroit, MI

Edward M. Golenberg Wayne State University Detroit, MI Edward M. Golenberg Wayne State University Detroit, MI Targeting Phragmites Success As Invasive Species Phragmites displays multiple life history parameters High seed output and small seed size Rapid growth

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Signaling from the plasma-membrane localized plant immune receptor RPM1 requires self-association of the full-length protein

Signaling from the plasma-membrane localized plant immune receptor RPM1 requires self-association of the full-length protein Signaling from the plasma-membrane localized plant immune receptor RPM1 requires self-association of the full-length protein Farid El Kasmi a,1, Eui-Hwan Chung a,b,1, Ryan G. Anderson a, Jinyue Li c, Li

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09606 Chen Li-Qing et al. A novel class of sugar transporters. Supplementary Figure 1. Confocal imaging of FRET sensor localization in HEK293T cells. The subcellular localization of the

More information

Plasmid Partition System of the P1par Family from the pwr100 Virulence Plasmid of Shigella flexneri

Plasmid Partition System of the P1par Family from the pwr100 Virulence Plasmid of Shigella flexneri JOURNAL OF BACTERIOLOGY, May 2005, p. 3369 3373 Vol. 187, No. 10 0021-9193/05/$08.00 0 doi:10.1128/jb.187.10.3369 3373.2005 Plasmid Partition System of the P1par Family from the pwr100 Virulence Plasmid

More information

Virp1 Is a Host Protein with a Major Role in Potato Spindle Tuber Viroid Infection in Nicotiana Plants

Virp1 Is a Host Protein with a Major Role in Potato Spindle Tuber Viroid Infection in Nicotiana Plants JOURNAL OF VIROLOGY, Dec. 2007, p. 12872 12880 Vol. 81, No. 23 0022-538X/07/$08.00 0 doi:10.1128/jvi.00974-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Virp1 Is a Host Protein

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

Using Virus-Induced Gene Silencing and Gene Expression as Tools to Understand Geminivirus Infection in Cotton Plants

Using Virus-Induced Gene Silencing and Gene Expression as Tools to Understand Geminivirus Infection in Cotton Plants 1 1 1 1 1 1 1 1 0 1 0 1 TITLE: Using Virus-Induced Gene Silencing and Gene Expression as Tools to Understand Geminivirus Infection in Cotton Plants DISCIPLINE: Genomics and Biotechnology AUTHORS: J.R.

More information

Localization of Wild Type and Mutant Class I Myosin Proteins in Aspergillus nidulans Using GFP-Fusion Proteins

Localization of Wild Type and Mutant Class I Myosin Proteins in Aspergillus nidulans Using GFP-Fusion Proteins Cell Motility and the Cytoskeleton 45:163 172 (2000) Localization of Wild Type and Mutant Class I Myosin Proteins in Aspergillus nidulans Using GFP-Fusion Proteins Roxanne A. Yamashita, Nir Osherov, and

More information

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

More information

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background. Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

More information

Ecology of Infectious Disease

Ecology of Infectious Disease Ecology of Infectious Disease What is the basis of community robustness (resistance to invasion)? How does robustness influence disease development? The Microbial Context: Microbial Interactions Affect

More information

Characterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus lanatus)

Characterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus lanatus) Song et al. BMC Plant Biology (2015) 15:298 DOI 10.1186/s12870-015-0681-4 RESEARCH ARTICLE Characterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large

More information

Plant Nucleotide Binding Site Leucine-Rich Repeat (NBS-LRR) Genes: Active Guardians in Host Defense Responses

Plant Nucleotide Binding Site Leucine-Rich Repeat (NBS-LRR) Genes: Active Guardians in Host Defense Responses Int. J. Mol. Sci. 2013, 14, 7302-7326; doi:10.3390/ijms14047302 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Plant Nucleotide Binding Site Leucine-Rich

More information

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7. hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:

More information

Contents. Foreword. ORCHID BIOTECHNOLOGY II World Scientific Publishing Co. Pte. Ltd.

Contents. Foreword. ORCHID BIOTECHNOLOGY II World Scientific Publishing Co. Pte. Ltd. Foreword Preface v vii 1. Molecular Phylogeny and Biogeography of Phalaenopsis Species 1 1.1 Introduction... 1 1.2 Biogeographical Pattern of Genus Phalaenopsis.. 6 1.3 Molecular Phylogeny and Biogeography

More information

A novel member of the dynamin family of GTP-binding proteins is expressed specifically in the testis

A novel member of the dynamin family of GTP-binding proteins is expressed specifically in the testis Journal of Cell Science 105, 1-5 (1993) Printed in Great Britain The Company of Biologists Limited 1993 1 A novel member of the dynamin family of GTP-binding proteins is expressed specifically in the testis

More information

Department of Plant Cellular and Molecular Biology, Ohio State University, Columbus, Ohio 43210

Department of Plant Cellular and Molecular Biology, Ohio State University, Columbus, Ohio 43210 The Plant Cell, Vol. 20: 1639 1651, June 2008, www.plantcell.org ª 2008 American Society of Plant Biologists Two Distinct Interacting Classes of Nuclear Envelope Associated Coiled-Coil Proteins Are Required

More information

A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum of toxic heavy metal ions

A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum of toxic heavy metal ions Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 SUPPORTING INFORMATION A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum

More information

FUNCTIONAL ANALYSIS OF Phalaenopsis aphrodite Flowering locus T1 FLOWERING GENE ON TOBACCO PLANT (Nicotiana tabacum L.) ABSTRACT

FUNCTIONAL ANALYSIS OF Phalaenopsis aphrodite Flowering locus T1 FLOWERING GENE ON TOBACCO PLANT (Nicotiana tabacum L.) ABSTRACT FUNCTIONAL ANALYSIS OF Phalaenopsis aphrodite Flowering locus T1 FLOWERING GENE ON TOBACCO PLANT (Nicotiana tabacum L.) ABSTRACT Flowering gene Phalaenopsis aphrodite Flowering locus T1 (PaFT1) is an FT

More information

Plant transformation

Plant transformation Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:

More information

Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Supplemental Data. Hou et al. (2016). Plant Cell /tpc Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence

More information

Analysis of regulatory function of circadian clock. on photoreceptor gene expression

Analysis of regulatory function of circadian clock. on photoreceptor gene expression Thesis of Ph.D. dissertation Analysis of regulatory function of circadian clock on photoreceptor gene expression Tóth Réka Supervisor: Dr. Ferenc Nagy Biological Research Center of the Hungarian Academy

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information