cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work
|
|
|
- Alexandra Cross
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22) KW363 spovid::kan amye::spovid-cfp cat coteωppm19 (cote-yfp spc) (58) PE793 yaah pkw10 (yaah-gfp spc) (58) PE1496 coto ppm4 (coto-yfp spc) (58) PE1547 spoiva spoiva-yfp spc (58) PE2091 spovid::kan amye::spovid cfp cat (58) PE2094 spovid::kan amye::spovid cfp cat cote cote-yfp spc (58) PE2269 This work PE2273 PE2274 PE2275 PE2276 PE2277 PE2283 PE2608 PE2611 PE2612 PE2621 PE2616 PE2619 spovid::kan amye::spovid L125A -cfp cat spovid::kan amye::spovid I127A -cfp cat spovid::kan amye::spovid D130A -cfp cat spovid::kan amye::spovid I133A -cfp cat spoiva spoiva-yfp spc This work spovid::kan amye::spovid cfp cat coto coto-yfp spc This work spovid::kan amye::spovid cfp cat cotz cotz-gfp spc This work spovid::kan amye::spovid cfp cat yaah yaah-gfp spc This work spovid::kan amye::spovid cfp cat spoiva spoiva-yfp spc This work coto coto-yfp spc This work cotz cotz-gfp spc This work 1
2 PE2620 yaah yaah-gfp spc This work E. coli PE2622 spovid-his in pet21b (DH5 ) This work PE2623 spovid-his in pet21b (BL21) This work PE2624 cote-stop in pet21b (BL21) This work PE2625 spovid L125A -his in pet21b (BL21) This work PE2626 spovid I127A -his in pet21b (BL21) This work PE2627 spovid D130A -his in pet21b (BL21) This work PE2628 spovid L131A -his in pet21b (BL21) This work PE2629 spovid his in pet21b (BL21) This work PE2630 spovid I133A -his in pet21b (BL21) This work Yeast Y8800 Y8930 MATa leu2-3,112 trp1-901 his3δ200 ura3-52 gal4δ gal80δ cyh2 R GAL2::ADE2, GAL1::HIS3-@LYS2, GAL7::lacZ@met2 (2) MAT leu2-3,112 trp1-901 his3δ200 ura3-52 gal4δ gal80δ cyh2 R GAL2::ADE2, GAL1::HIS3-@LYS2, GAL7::lacZ@met2 (2) YPE324 Y pcote(1-158)-ad This work YPE343 Y pspovid(1-144)-bd This work YPE511 Y pspovid(1-144 L131A)-BD This work YPE513 Y pspovid(1-144 I133A)-BD This work YPE518 Y pdest-ad This work YPE519 Y pdest-bd This work YPE600 Y8800/Y pfos-ad + pjun-bd (55) Table S2. Primers Primer Nucleotide Sequence MHC001 MHC002 MHC003 MHC004 MHC007 MHC008 MHC009 CAATTGACGGATTCGCGCATTGCTACAATTCAAGCTGATTTAGCG CGCTAAATCAGCTTGAATTGTAGCAATGCGCGAATCCGTCAATTG CGGATTCGCGCATTTTAACAGCTCAAGCTGATTTAGCGATCG CGATCGCTAAATCAGCTTGAGCTGTTAAAATGCGCGAATCCG CGCATTTTAACAATTCAAGCTGCTTTAGCGATCGAAGGGCTTTTG CAAAAGCCCTTCGATCGCTAAAGCAGCTTGAATTGTTAAAATGCG GCATTTTAACAATTCAAGCTGATGCTGCGATCGAAGGGCTTTTGG 2
3 MHC010 MHC011 MHC012 MAD37 MAD38 CCAAAAGCCCTTCGATCGCAGCATCAGCTTGAATTGTTAAAATGC CAATTCAAGCTGATTTAGCGGCTGAAGGGCTTTTGGACGATACG CGTATCGTCCAAAAGCCCTTCAGCCGCTAAATCAGCTTGAATTC GCGCCATATGCCGCAAAATCATGCATTGCAATTTTC GCGCCTCGAGCGCATGGCTATTTTTATATTGAGGAATATAG AGAATCTGTCCTGC MAD39 MAD96 KW206 KW207 CotEF1 CotER1 SpoVIDF1 SpoVIDR1 GCGCCATATGTCTGAATACAGGGAAATTATTACGAAGGC GCGCCTCGAGTTATTATTCTTCAGGATCTCCCACTAAAAACTCCG TTGACGGATTCGCGCATTTTGGACGATACGCAAGACAAAG CTTTGTCTTGCGTATCGTCCAAAATGCGCGAATCCGTCAA GGGGACAACTTTGTACAAAAAAGTTGGCTCTGAATACAGGGAAATT ATTACGAAG GGGGACAACTTTGTACAAGAAAGTTAATCTTCCTCGTCATCCTCTTC GGGGACAACTTTGTACAAAAAAGTTGGCCCGCAAAATCATCGATTG GGGGACAACTTTGTACAAGAAAGTTACTCTTTGTCTTGCGTATCGTCC Table S3. List of Plasmids Number Primers or source Cloning vector pkw50 (58) amy-spovid L125A -cfp MHC001 and MHC002 pkw50 amy-spovid I127A -cfp MHC003 and MHC004 pkw50 amy-spovid D130A -cfp MHC007 and MHC008 pkw50 amy-spovid L131A -cfp MHC009 and MHC010 pkw50 amy-spovid I133A -cfp MHC011 and MHC012 pkw50 pet21b-spovid-his MAD37 and MAD38 pet21b pet21b-cote-stop MAD39 and MAD96 pet21b pet21b-spovid his KW206 and KW207 pet21b-spovid-his 3
4 pet21b-spovid L125A -his MHC001 and MHC002 pet21b-spovid-his pet21b-spovid I127A -his MHC003 and MHC004 pet21b-spovid-his pet21b-spovid D130A -his MHC007 and MHC008 pet21b-spovid-his pet21b-spovid L131A -his MHC009 and MHC010 pet21b-spovid-his pet21b-spovid I133A -his MHC011 and MHC012 pet21b-spovid-his pdest-ad (56) pdest-bd (56) pdonr223 Invitrogen pcote AD CotE F1 and CotE R1 pdest-ad pspovid BD pspovid (L131A) -BD pspovid (I133A) -BD SpoVID F1 and SpoVID R1 pdest-bd SpoVID F1 and SpoVID R1 pdest-bd SpoVID F1 and SpoVID R1 pdest-bd 4
5 5
6 Figure S1: Specific residues in the N-terminal region of SpoVID are essential for encasement. Cells were sporulated at 37 C and imaged 3 (top panel) and 6 hours (lower panel) after resuspension in SM medium. Samples were stained with membrane stain (FM4-64) and analyzed by fluorescence microscopy. The spovid point mutations are listed to the left of the images. SpoVID-CFP fluorescence is shown in the first 6
7 column. The second column shows the fluorescence of the membranes. CotE-YFP fluorescence in the same cells is reported in the third column. The fourth column is an overlay of the CotE-YFP fluorescence (yellow) on the membrane fluorescence (red). The fifth column shows the presence of phase bright forespores by phase contrast microscopy (brightfield). A. KW363 (spovid::kan amye::spovid-cfp cat cote cote-yfp spc) B. PE2094 (spovid::kan amye::spovid cfp cat cote cote-yfp spc). C. PE2273 (spovid::kan amye::spovid L125A -cfp cat cote cote-yfp spc). D. PE2274 (spovid::kan amye::spovid I127A -cfp cat cote cote-yfp spc). E. PE2275 (spovid::kan amye::spovid D130A -cfp cat cote cote-yfp spc). F. PE2276 ( cote cote-yfp spc). G. PE2277 (spovid::kan amye::spovid I133A -cfp cat cote cote-yfp spc). 7
8 Figure S2. Subcellular localization of representative coat protein-fluorescence protein fusions in spovid mutant strains Cells were resuspended at 37 C by resuspension in SM medium, stained with membrane stain (FM4-64) and analyzed by fluoresecence microscopy at hour 3 (A- C) or hour 6 (D) of sporulation. One representative field of cells is shown for each condition. First column: GFP or YFP fluorescence. Second column: fluorescence of membranes. Third column: overlay of coat protein fusion (green or yellow) and membranes (red). A. SpoIVA-YFP. First row: SpoIVA-YFP in an otherwise wild type 8
9 strain (PE1547). Second row: SpoIVA-YFP in a spovid cfp expressing strain (PE2621). Third row: SpoIVA-YFP in a spovid L -cfp expressing strain (PE2283). B. YaaH-GFP. First row: YaaH-GFP in an otherwise wild type strain (PE793). Second row: YaaH-GFP in a spovid cfp expressing strain (PE2612). Third row: YaaH- GFP in a spovid L -cfp expressing strain (PE2620). C. CotO-YFP. First row: CotO- YFP in an otherwise wild type strain (PE1496). Second row: CotO-YFP in a spovid cfp expressing strain (PE2608). Third row: CotO-YFP in a spovid L - cfp expressing strain (PE2616). D. CotZ-GFP. First row: CotZ-GFP in an otherwise wild type strain (HS176). Second row: CotZ-GFP in a spovid cfp expressing strain (PE2611). Third row: CotZ-GFP in a spovid L -cfp expressing strain (PE2619). 9
Supplemental Figure 1.
A wt spoiiiaδ spoiiiahδ bofaδ B C D E spoiiiaδ, bofaδ Supplemental Figure 1. GFP-SpoIVFA is more mislocalized in the absence of both BofA and SpoIIIAH. Sporulation was induced by resuspension in wild-type
Effects of the Chromosome Partitioning Protein Spo0J (ParB) on oric Positioning and Replication Initiation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Feb. 2003, p. 1326 1337 Vol. 185, No. 4 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.4.1326 1337.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Effects
2. Yeast two-hybrid system
2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates
Rho1 binding site PtdIns(4,5)P2 binding site Both sites
localization Mutation site DMSO LatB WT F77A I115A I131A K134A Rho1 binding site PtdIns(4,5)P2 binding site Both sites E186A E199A N201A R84A-E186A-E199A L131A-K136A-E186A L131A-E186A-E199A K136A-E186A-E199A
Received 12 June 1995/Accepted 10 August 1995
JOURNAL OF BACTERIOLOGY, Oct. 1995, p. 5906 5911 Vol. 177, No. 20 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology Use of Green Fluorescent Protein for Visualization of Cell-Specific
Supplemental Data. Gao et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector
Table of plasmids and yeast strains and their relation to the laboratory database
209 Appendix Table of plasmids and yeast strains and their relation to the laboratory database All plasmids (maintained in bacteria) and yeast strains described in this thesis are listed in the following
Determinants for the Subcellular Localization and Function of a Nonessential SEDS Protein
zjs / DCHEAD ARTICLE zjss / DCTPIC GENETICS AND MLECULAR BILGY FRM CVER SHEET: Editor: Moran Article No.: T Section: Genetics JURNAL F BACTERILGY, Jan. 2008, p. 000 Vol. 190, No. 1 0021-9193/08/$08.00
Actin-based Motility during Endocytosis in Budding Yeast V
Molecular Biology of the Cell Vol. 17, 1354 1363, March 2006 Actin-based Motility during Endocytosis in Budding Yeast V Kyoungtae Kim,* Brian J. Galletta,* Kevin O. Schmidt, Fanny S. Chang, Kendall J.
Supporting Information
Supporting Information Fleissner et al. 10.1073/pnas.0907039106 Fig. S1. (A) MAK-2-GFP localized to CATs tips is not bound by membrane. his-3::pccg1 mak-2-gfp; mak-2 strain labeled with membrane dye FM4
Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation
Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation Nils Widderich 1,, Christopher D.A. Rodrigues 2,, Fabian M. Commichau
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
Cover Page. The handle holds various files of this Leiden University dissertation
Cover Page The handle http://hdl.handle.net/1887/41480 holds various files of this Leiden University dissertation Author: Tleis, Mohamed Title: Image analysis for gene expression based phenotype characterization
Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria
Supplementary Information for Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria Isabella Santi 1 *, Neeraj Dhar 1, Djenet Bousbaine 1, Yuichi Wakamoto, John D.
Supplemental Information. Expanded Coverage of the 26S Proteasome. Conformational Landscape Reveals. Mechanisms of Peptidase Gating
Cell Reports, Volume 24 Supplemental Information Expanded Coverage of the 26S Proteasome Conformational Landscape Reveals Mechanisms of Peptidase Gating Markus R. Eisele, Randi G. Reed, Till Rudack, Andreas
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
Philina S. Lee* and Alan D. Grossman* Department of Biology, Building , Massachusetts Institute of Technology, Cambridge, MA 02139, USA.
Blackwell Publishing LtdOxford, UKMMIMolecular Microbiology9-382X; Journal compilation 26 Blackwell Publishing Ltd? 266483869Original ArticleChromosome partitioning in B. subtilisp. S. Lee and A. D. Grossman
A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces cerevisiae.
Genetics: Published Articles Ahead of Print, published on July 30, 2012 as 10.1534/genetics.112.143818 A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/5/eaar2740/dc1 Supplementary Materials for The fission yeast Stn1-Ten1 complex limits telomerase activity via its SUMO-interacting motif and promotes telomeres
Structural insights into bacterial flagellar hooks similarities and specificities
Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation:
Supplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
Vesicle Docking to the Spindle Pole Body Is Necessary to Recruit the Exocyst During Membrane Formation in Saccharomyces cerevisiae
Molecular Biology of the Cell Vol. 21, 3693 3707, November 1, 2010 Vesicle Docking to the Spindle Pole Body Is Necessary to Recruit the Exocyst During Membrane Formation in Saccharomyces cerevisiae Erin
Supplementary information Supplementary figures
Supplementary information Supplementary figures Supplementary Figure 1. Quantitation by FCS of GFP-tagged proteasomes in supernatant of cell extract (a) In vitro assay for evaluation of the hydrodynamic
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Temporal competition between differentiation programs determines cell fate choice Anna Kuchina 1,2, Lorena Espinar 3, Tolga Çağatay 1,2, Alejandro O. Balbin 1,2, Fang Zhang 1,2,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Purification of yeast CKM. (a) Silver-stained SDS-PAGE analysis of CKM purified through a TAP-tag engineered into the Cdk8 C-terminus. (b) Kinase activity
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION AN EXCITABLE GENE REGULATORY CIRCUIT INDUCES TRANSIENT CELLULAR DIFFERENTIATION Gürol M. Süel, 1 Jordi Garcia-Ojalvo, 2 Louisa L. Liberman, 1 and Michael B. Elowitz 1 1 Division
BMC Microbiology. Open Access. Abstract
BMC Microbiology BioMed Central Research article DprA/Smf protein localizes at the DNA uptake machinery in competent Bacillus subtilis cells Serkalem Tadesse 1,2 and Peter L Graumann* 1 Open Access Address:
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6
A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight
Expression of yeek during Bacillus subtilis sporulation and localization ACCEPTED. of YeeK to the inner spore coat using fluorescence microscopy
JB Accepts, published online ahead of print on 5 December 2008 J. Bacteriol. doi:10.1128/jb.01269-08 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
Waithe et al Supplementary Figures
Waithe et al Supplementary Figures Supplementary Figure 1 Expression and properties of WT and W391A mutant YFP- Ca V 2.2. A Immunoblot using Ca V 2.2 Ab for untransfected cells (UT, lane 1), YFP-Ca V 2.2
Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring
Current Biology Supplemental Information Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Caroline Laplante, Julien Berro, Erdem Karatekin,
Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al.
Supplemental materials for Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al. 1. Table S1. Strains used in this study 2. Table S2. Plasmids used in this study
Supporting Information
Supporting Information Mullins et al. 10.1073/pnas.0906781106 SI Text Detection of Calcium Binding by 45 Ca 2 Overlay. The 45 CaCl 2 (1 mci, 37 MBq) was obtained from NEN. The general method of 45 Ca 2
Supplementary Information to
Supplementary Information to Wiesner et al.: A change in conformational dynamics underlies the activation of Eph receptor tyrosine kinases Supplementary Material and Methods Cloning and Mutagenesis Site-directed
Analysis and modelling of protein interaction networks
Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment Karin Stibius Jensen Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/5/e1500358/dc1 Supplementary Materials for Transplantability of a circadian clock to a noncircadian organism Anna H. Chen, David Lubkowicz, Vivian Yeong,
Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
The geneticist s questions
The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does
Supporting Information
Supporting Information Espinar et al. 1.173/pnas.12169111 SI Materials and Methods Growth Conditions for Microscopy. For the experiments presented in the main text, Bacillus subtilis cells were grown at
Cadmium Poisoning Ingestion of cadmium can cause: Cancer Renal failure Bone weakening and fracture Damage to nervous and immune systems Death Danger Level Present in over 60% of hazardous waste sites as
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
A Bacillus subtilis Secreted Protein with a Role in Endospore Coat Assembly and Function
JOURNAL OF BACTERIOLOGY, June 1999, p. 3632 3643 Vol. 181, No. 12 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. A Bacillus subtilis Secreted Protein with
Supporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises six Orai subunits, each with identical amino acid sequences
TheATPaseSpoIIIETransportsDNA across Fused Septal Membranes during Sporulation in Bacillus subtilis
TheATPaseSpoIIIETransportsDNA across Fused Septal Membranes during Sporulation in Bacillus subtilis Briana M. Burton, 1 Kathleen A. Marquis, 2 Nora L. Sullivan, 2 Tom A. Rapoport, 1,3, * and David Z. Rudner
Clp and Lon Proteases Occupy Distinct Subcellular Positions in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Oct. 2008, p. 6758 6768 Vol. 190, No. 20 0021-9193/08/$08.00 0 doi:10.1128/jb.00590-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Clp and Lon Proteases
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
The PXL1 Gene of Saccharomyces cerevisiae Encodes a Paxillin-like Protein Functioning in Polarized Cell Growth
Molecular Biology of the Cell Vol. 15, 1904 1917, April 2004 The PXL1 Gene of Saccharomyces cerevisiae Encodes a Paxillin-like Protein Functioning in Polarized Cell Growth Nancy A. Mackin, Tarek J. Sousou,
The Threshold Level of the Sensor Histidine Kinase KinA Governs Entry into Sporulation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Aug. 2010, p. 3870 3882 Vol. 192, No. 15 0021-9193/10/$12.00 doi:10.1128/jb.00466-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. The Threshold Level
PETER J. LEWIS, LING JUAN WU, AND JEFFERY ERRINGTON* Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom
JOURNAL OF BACTERIOLOGY, July 1998, p. 3276 3284 Vol. 180, No. 13 0021-9193/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Establishment of Prespore-Specific Gene Expression
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.
Cytological Analysis of the Mother Cell Death Process during Sporulation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Mar. 2007, p. 2561 2565 Vol. 189, No. 6 0021-9193/07/$08.00 0 doi:10.1128/jb.01738-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Cytological Analysis
Spores of some Bacillus and Clostridium species are causative
crossmark Water and Small-Molecule Permeation of Dormant Bacillus subtilis Spores Scott M. Knudsen, a Nathan Cermak, b Francisco Feijó Delgado, a Barbara Setlow, c Peter Setlow, c Scott R. Manalis a,b,d
Supporting Information
Supporting Information López et al. 10.1073/pnas.0810940106 1. Ivey DM, et al. (1993) Cloning and characterization of a putative Ca2 /H antiporter gene from Escherichia coli upon functional complementation
Saccharomyces cerevisiae Cdc42p Localizes to Cellular Membranes and Clusters at Sites of Polarized Growth
EUKARYOTIC CELL, June 2002, p. 458 468 Vol. 1, No. 3 1535-9778/02/$04.00 0 DOI: 10.1128/EC.1.3.458 468.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Saccharomyces cerevisiae
Mcp4, a Meiotic Coiled-Coil Protein, Plays a Role in F-Actin Positioning during Schizosaccharomyces pombe Meiosis
EUKARYOTIC CELL, June 2007, p. 971 983 Vol. 6, No. 6 1535-9778/07/$08.00 0 doi:10.1128/ec.00016-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Mcp4, a Meiotic Coiled-Coil Protein,
Characterization and subcellular localization of a bacterial flotillin homologue
Microbiology (2009), 155, 1786 1799 DOI 10.1099/mic.0.025312-0 Characterization and subcellular localization of a bacterial flotillin homologue Catriona Donovan and Marc Bramkamp Correspondence Marc Bramkamp
Dynamic localization of penicillin-binding proteins during spore development in Bacillus subtilis
Microbiology (2005), 151, 999 1012 DOI 10.1099/mic.0.27692-0 Dynamic localization of penicillin-binding proteins during spore development in Bacillus subtilis Dirk-Jan Scheffers3 Correspondence Dirk-Jan
7.06 Cell Biology EXAM #3 KEY
7.06 Cell Biology EXAM #3 KEY May 2, 2006 This is an OPEN BOOK exam, and you are allowed access to books, a calculator, and notes BUT NOT computers or any other types of electronic devices. Please write
7.06 Cell Biology EXAM #3 April 21, 2005
7.06 Cell Biology EXAM #3 April 21, 2005 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
Nuclear congression is driven by cytoplasmic microtubule plus end interactions in S. cerevisiae
JCB: ARTICLE Nuclear congression is driven by cytoplasmic microtubule plus end interactions in S. cerevisiae Jeffrey N. Molk, E.D. Salmon, and Kerry Bloom Department of Biology, University of North Carolina,
** LCA LCN PCA
% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number
A membrane-embedded amino acid couples the SpoIIQ channel protein to anti-sigma
JB Accepted Manuscript Posted Online 29 February 2016 J. Bacteriol. doi:10.1128/jb.00958-15 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 A membrane-embedded amino acid couples
Sporulation Phenotype of a Bacillus subtilis Mutant Expressing an Unprocessable but Active E Transcription Factor
JOURNAL OF BACTERIOLOGY, Apr. 2004, p. 1999 2005 Vol. 186, No. 7 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.7.1999 2005.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Sporulation
Identification of a New Gene Essential for Germination of Bacillus subtilis Spores with Ca 2 -Dipicolinate
JOURNAL OF BACTERIOLOGY, Apr. 2003, p. 2315 2329 Vol. 185, No. 7 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.7.2315 2329.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Identification
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
Substrate Requirements for Regulated Intramembrane Proteolysis of Bacillus subtilis Pro- K
JOURNAL OF BACTERIOLOGY, Feb. 2005, p. 961 971 Vol. 187, No. 3 0021-9193/05/$08.00 0 doi:10.1128/jb.187.3.961 971.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Substrate
Germination of Individual Bacillus subtilis Spores with Alterations in the GerD and SpoVA Proteins, Which Are Important in Spore Germination
JOURNAL OF BACTERIOLOGY, May 2011, p. 2301 2311 Vol. 193, No. 9 0021-9193/11/$12.00 doi:10.1128/jb.00122-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Germination of Individual
Role of GerD in Germination of Bacillus subtilis Spores
JOURNAL OF BACTERIOLOGY, Feb. 2007, p. 1090 1098 Vol. 189, No. 3 0021-9193/07/$08.00 0 doi:10.1128/jb.01606-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Role of GerD in Germination
The General Phosphotransferase System Proteins Localize to Sites of Strong Negative Curvature in Bacterial Cells
RESEARCH ARTICLE The General Phosphotransferase System Proteins Localize to Sites of Strong Negative Curvature in Bacterial Cells Sutharsan Govindarajan, Yair Elisha, Keren Nevo-Dinur, Orna Amster-Choder
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
CotC-CotU Heterodimerization during Assembly of the Bacillus subtilis Spore Coat
JOURNAL OF BACTERIOLOGY, Feb. 2008, p. 1267 1275 Vol. 190, No. 4 0021-9193/08/$08.00 0 doi:10.1128/jb.01425-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. CotC-CotU Heterodimerization
Supplementary information
Supplementary information Statistical organelle dissection of Arabidopsis guard cells using image database LIPS Takumi Higaki *, Natsumaro Kutsuna, Yoichiroh Hosokawa, Kae Akita, Kazuo Ebine, Takashi Ueda,
Bacillus subtilis Spore Coat
MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, Mar. 1999, p. 1 20 Vol. 63, No. 1 1092-2172/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Bacillus subtilis Spore Coat
Live Observation of Forespore Membrane Formation in Fission Yeast
Molecular Biology of the Cell Vol. 19, 3544 3553, August 2008 Live Observation of Forespore Membrane Formation in Fission Yeast Taro Nakamura,* Haruhiko Asakawa, Yukiko Nakase,* Jun Kashiwazaki,* Yasushi
SUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,
Separation of Chromosome Termini during the Sporulation of Bacillus subtilis Depends on ACCEPTED
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Separation of Chromosome Termini during the Sporulation of Bacillus subtilis Depends on SpoIIIE Marina Bogush, Panagiotis Xenopoulos, and Patrick J. Piggot*
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
Spo5/Mug12, a Putative Meiosis-Specific RNA-Binding Protein, Is Essential for Meiotic Progression and Forms Mei2 Dot-Like Nuclear Foci
EUKARYOTIC CELL, Aug. 2006, p. 1301 1313 Vol. 5, No. 8 1535-9778/06/$08.00 0 doi:10.1128/ec.00099-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Spo5/Mug12, a Putative Meiosis-Specific
Prof. Fahd M. Nasr. Lebanese university Faculty of sciences I Department of Natural Sciences.
Prof. Fahd M. Nasr Lebanese university Faculty of sciences I Department of Natural Sciences fnasr@ul.edu.lb B3206 Microbial Genetics Eukaryotic M. G. The yeast Saccharomyces cerevisiae as a genetic model
1. YEAST STRAINS AND PLASMIDS SINGLE CELL MICROSCOPY CALCULATION OF TOTAL FLUORESCENCE...6
Supplementary Materials to Colman-Lerner et al. 1 1. YEAST STRAINS AND PLASMIDS...3 1.1 Strains...3 1.2 Plasmids...4 2 SINGLE CELL MICROSCOPY...5 3 CALCULATION OF TOTAL FLUORESCENCE...6 4 DEFINING PATHWAY
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06072 SUPPLEMENTARY INFORMATION Molecular noise and size control: origins of variability in the budding yeast cell cycle. Stefano Di Talia 1,2, Jan M. Skotheim 2, James M. Bean 1,*,
List of supplementary data
List of supplementary data Figure S1 Amino acid alignment for GiNT Figure S2Amino acid alignment and phylogenetic analysis for GiGS1 and GiGS2 Figure S3 Amino acid alignment for GiGluS Figure S4 Amino
(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures
Nature Methods Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures Yannick Doyon, Thuy D Vo, Matthew C Mendel, Shon G Greenberg, Jianbin Wang, Danny F Xia, Jeffrey
Supplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
Ptc1, a Type 2C Ser/Thr Phosphatase, Inactivates the HOG Pathway by Dephosphorylating the Mitogen-Activated Protein Kinase Hog1
MOLECULAR AND CELLULAR BIOLOGY, Jan. 2001, p. 51 60 Vol. 21, No. 1 0270-7306/01/$04.00 0 DOI: 10.1128/MCB.21.1.51 60.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Ptc1, a
Bipolar localization of a chromosome partition protein in Bacillus subtilis
Proc. Natl. Acad. Sci. USA Vol. 94, pp. 4721 4726, April 1997 Microbiology Bipolar localization of a chromosome partition protein in Bacillus subtilis DANIEL CHI-HONG LIN, PETRA ANNE LEVIN, AND ALAN D.
Separation of Chromosome Termini during. on SpoIIIE. Marina Bogush, Panagiotis Xenopoulos and Patrick J. Piggot
REFERENCES CONTENT ALERTS Separation of Chromosome Termini during Sporulation of Bacillus subtilis Depends on SpoIIIE Marina Bogush, Panagiotis Xenopoulos and Patrick J. Piggot J. Bacteriol. 2007, 189(9):3564.
Nature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Photographs of the 3D-MTC device and the confocal fluorescence microscopy. I: The system consists of a Leica SP8-Confocal microscope (with an option of STED), a confocal PC, a 3D-MTC
Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A
Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A Masaya Fujita and Richard Losick 1 Department of Molecular
Ypt31/32 GTPases and their novel F-Box effector protein Rcy1 regulate protein recycling
1 Ypt31/32 GTPases and their novel F-Box effector protein Rcy1 regulate protein recycling Shu Hui Chen 1, Shan Chen 1, Andrei A Tokarev, Fengli Liu, Gregory Jedd and Nava Segev 2 Department of Biological
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.
Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing
Characterization of a Bacillus anthracis spore coat-surface protein that in uences coat-surface morphology
RESEARCH LETTER Characterization of a Bacillus anthracis spore coat-surface protein that in uences coat-surface morphology Michael Mallozzi 1, Joel Bozue 2, Rebecca Giorno 1, Krishna-Sulayman Moody 2,