Supplementary Figure 3
|
|
|
- Scott Holmes
- 5 years ago
- Views:
Transcription
1
2
3 Supplementary Figure Col Kas-1 Line FTH1A 8.4 F3PII3 8.9 F26H11 ATQ1 T9I22 PLS8 F26B6-B 9.6 F27L F27D Mb T1D16 Col % RGR L Supplementary Figure 3. Fine mapping of ATQ1. Genotype and As(V) tolerance phenotype, determined as %RGR, in selected lines from a NIL128 x Col gl-1 (Col) F 2 population. The recombination breakpoints at the FTH1A and T1D16 interval are depicted; Kas-1 (red), Col gl-1 (Col; green). ATQ1 is located between markers F26H11 and T9I22.
4
5 Supplementary Figure 5 Supplementary Figure 5. Phylogenetic relationships among rhodanase proteins. Neighbor-Joining tree including 49 sequences from 31 plant species selected by the highest homology to the rhodanase encoded by AtARQ1 gene (At2g21045). They correspond to three Arabidopsis thaliana proteins (AtARQ1, At5g66170 and At5g66040), a pair of proteins from each of 16 plant species (indicated with numbers 1 or 2 close to species names) and a single protein from each of 14 other plants. In addition, 9 ACR2 like proteins are included from protista, algae and plants. The bootstrap consensus tree inferred from replicates is taken to represent the evolutionary history of the taxa analyzed. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. The analysis involved 58 amino acid sequences. All ambiguous positions were removed for each sequence pair. There were a total of 200 positions in the final dataset. Evolutionary analysis was conducted in MEGA6 51. Sequence accession numbers are: Arabidopsis thaliana AtARQ1 (At2g21045): AAP37665; Arabidopsis thaliana AT5G66040: AAN38701; Arabidopsis thaliana AT5G66170: AAM10268; Arabidopsis lyrata 1: ; Arabidopsis lyrata 2: ; Thellungiella halophila 1: Thhalv m; Thellungiella halophila 1: Thhalv m; Capsella rubella 1: Carubv m; Capsella rubella 2: Carubv m; Brassica rapa 1: Bra002059; Brassica rapa 2: Bra012056; Carica papaya 1: supercontig ; Carica papaya 2: supercontig 6.271; Cucumis sativus 1: CucsArabidopsis234370; Cucumis sativus 2: CucsArabidopsis044010; Prunus persica 1: ppa024101; Prunus persica 2: ppa011976; Malus domestica: MDP ; Mimulus guttatus: mgv1a018856; Vitis vinifera 1: GSVIVG ; Vitis vinifera 2: GSVIVG ; Manihot esculenta: cassava ; Citrus sinensis 1: orange1.1g041947m; Citrus sinensis 2: orange1.1g032621m; Citrus clementina: Ciclev m; Setaria italica: Si031418m; Aquilegia coerulea: Aquca_006_ ; Eucalyptus grandis 1: Eucgr.E ; Eucalyptus grandis 2: Eucgr.L ; Solanum tuberosum: PGSC0003DMG ; Solanum lycopersicum: Solyc02g ; Medicago truncatula 1: Medtr2g ; Medicago truncatula 2: Medtr8g ; Glycine max 1: Glyma12g ; Glycine max 2: Glyma01g ; Phaseouls vulgaris: Phvul.011G020400; Gossypium raimondii 1: Gorai.013G ; Gossypium raimondii 2: Gorai.007G ; Populus trichocarpa 1: Potri.014G ; Populus trichocarpa 2: Potri.005G ; Fragaria vesca: mrna v1.0-hybrid; Theobroma cacao: Thecc1EG032968t1; Brachypodium distachyon: Bradi3g ; Oriza sativa 1: Os04g ; Oriza sativa 2: Os02g ; Panicum virgatum: Pavirv m; Sorghum bicolor 1: Sb06g003340; Sorghum bicolor 2: Sb04g000410; Zea mays: AC FG003; Saccharomyces cerevisae ACR2: NP ; Leishmania major ACR2: AAS73185; Gossypium arboreum ACR2: AW666950; Oriza sativa ACR2: BE039986; Chlamydomonas reinhardtii ACR2: AW661050; Arabidopsis thaliana ACR2 AT5G03455: AAO39886; Pteris vittata ACR2: ADP20951; Holcus lanatus ACR2: AY704470; Zea mays ACR2: AY
6
7 Supplementary Figure 7 a Col-0 ATGTATACATATTCTCTCCTCAACCTTTCTCATTGCAGAAGACAAACCAGAAAGAAAAGAAAAACAGATCACACCGAAGGCTTTCTCATGGAGGAAACAA Kas-1 ATG-ATACATATCCTCTCTTCAACCTTTCTCATTGCAAAAGACATACCAGAA-----AGAAAAACAGATCAAACCGAAGGCTTTCTCATGGAGGAAACAA Col-0 AACCAAAGACCGTTGAAGATGTTGAGACCGTTGATGTTTATACAGCTAAAGGCTTTCTTAGTACTGGTCACCGATATCTCGACGTAAGGACAAATGAAGA Kas-1 AACCAAAGACCGTTGAAGATGTTGAGACCGTTGATATTTATACAGCTAAAGGCTTTCTTAGTACTGGTCACCGATATCTCGACGTAAGGACAAGTGAAGA Col-0 ATTTGCCAAGAGTCATGTTGAGGAGGCTTTGAACATTCCTTATATGTTCAAAACAGATGAAGGTAGGGTTATAAATCCTGATTTCCTTTCTCAAGTGGCA Kas-1 ATTTGCCAAGAGTCATGTTGAGGAGGCTTTGAACATTCCTTATATGTTCCAAACAGATGAAGGTAGGGTTATAAATCCTGATTTCCTTTCTCAAGTGGCA Col-0 TCGGTTTGCAAGAAAGATGAACATTTGATCGTGGCTTGTAACGCTGGAGGAAGAGGAAGTCGTGCTTGCGTTGATCTTCTTAACGAGGGGTACGACCATG Kas-1 TCGGTTTGCAAGAAAGATGAACATTTGATCGTGGCTTGTAACGCTGGAGGAAGAGGAAGTCGTGCTTGCGTTGATCTTCTCAACGAGGGGTACGACCATG * Col-0 TGGCTAACATGGGGGGAGGCTACTCGGCTTGGGTTGACGCTGGATTCGCCGGGGACAAACCCCCGGAAGACCTCAAGATTGCTTGCAAGTTCAGGCCAAA Kas-1 TGGCTAACATGGGGGGAGGCTACTCGGCTTGGGTTGACGCTGGATTCGCCGGGGACAAACCCCCGGGAGACCTCAAGATTGCTTGCAAGTTCAGGCCAAA Col-0 GGAAAACTAA Kas-1 GGAAAACTAA b Bur-0 Chi-0 Col-0 Lm-2 Kz-2 Bay-0 Pi-0 Yeg-1 Sav-0 Ct-1 Fuk-0 Es-0 A.lyrata Kas-1 Fei-0 Edi-0 Ll-0 Ri-0 Shak-0 Tsu-1 kondara c 0.01 Supplementary Figure 7. Col-0 and Kas-1 define two haplogroups for the AtARQ1 gene in Arabidopsis thaliana. (a) Nucleotide diversity between Col-0 and Kas-1 AtARQ1 coding sequence. Compensatory indels and single nucleotide polymorphisms in Col-0 (green) and Kas-1 (red). *synonymous mutation. (b) Phylogram constructed using Clustal-W of AtARQ1 coding sequences from 20 Arabidopsis accessions and Arabidopsis lyrata. (c) Geographic distribution of Arabidopsis accessions used, classified by Col-0 or Kas-1 haplogroup.
8
Cao, J, K Schneeberger, S Ossowski, et al Whole genome sequencing of multiple Arabidopsis thaliana populations. Nat Genet 43:
Figure S1. Syntenic map of SAE1B duplication. We have used the nucleotide sequences of Arabidopsis thaliana Col-0 gene tandem duplicates AT5G50580 and AT5G506800 as queries in independent BLASTN searches
Supplementary Figure 1. Number of CC- and TIR- type NBS- LRR genes and presence of mir482/2118 on sequenced plant genomes.
Number of CC- NBS and CC- NBS- LRR R- genes Number of TIR- NBS and TIR- NBS- LRR R- genes 0 50 100 150 200 250 0 50 100 150 200 250 300 350 400 450 mir482 and mir2118 Cajanus cajan Glycine max Hevea brasiliensis
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature13082 Supplementary Table 1. Examination of nectar production in wild-type and atsweet9 flowers. No. of flowers with detectable nectar out of the total observed
Bioinformatics tools to analyze complex genomes. Yves Van de Peer Ghent University/VIB
Bioinformatics tools to analyze complex genomes Yves Van de Peer Ghent University/VIB Detecting colinearity and large-scale gene duplications A 1 2 3 4 5 6 7 8 9 10 11 Speciation/Duplicatio n S1 S2 1
Evaluation of Genome Sequencing Quality in Selected Plant Species Using Expressed Sequence Tags
Evaluation of Genome Sequencing Quality in Selected Plant Species Using Expressed Sequence Tags Lingfei Shangguan 1, Jian Han 1, Emrul Kayesh 1, Xin Sun 1, Changqing Zhang 2, Tariq Pervaiz 1, Xicheng Wen
SUPPLEMENTARY INFORMATION
doi:1.138/nature11394 Supplementary Note Our study is based on two different tracriptome indices. Both combine tracriptional information with an important evolutionary parameter. For the tracriptome age
Supplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
Genome-wide discovery of G-quadruplex forming sequences and their functional
*Correspondence and requests for materials should be addressed to R.G. (rohini@nipgr.ac.in) Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants Rohini Garg*,
Eud! Mag! Chl! Cer! Mon! outgroup! g 88. Eud! Cer! <50. Chl! Mag! Mon! outgroup! Eud! Mon! Cer! Mag! Chl! outgroup!
a
Supplementary Material
Supplementary Material Supplementary Table S1. Genomes available in build 47 Supplementary Table S2. Counts of putative contiguous gene split models in 39 plant reference genomes in build 47 Supplementary
Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel activation loop variants
Mohanta et al. BMC Genomics (2015) 16:58 DOI 10.1186/s12864-015-1244-7 RESEARCH ARTICLE Open Access Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel
SUPPLEMENTARY INFORMATION
doi:1.138/nature111 cytosol Model: PILS function in cellular auxin homeostasis ER nucleus IAA degradation? sequestration? conjugation? storage? signalling? PILS IAA ER cytosol Supplemental Figure 1 Model
AtTIL-P91V. AtTIL-P92V. AtTIL-P95V. AtTIL-P98V YFP-HPR
Online Resource 1. Primers used to generate constructs AtTIL-P91V, AtTIL-P92V, AtTIL-P95V and AtTIL-P98V and YFP(HPR) using overlapping PCR. pentr/d- TOPO-AtTIL was used as template to generate the constructs
Integrating Phylogenetic and Network Approaches to Study Gene Family Evolution: The Case of the AGAMOUS Family of Floral Genes
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications from the Center for Plant Science Innovation Plant Science Innovation, Center for 2018 Integrating
Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
Miloš Duchoslav and Lukáš Fischer *
Duchoslav and Fischer BMC Plant Biology (2015) 15:133 DOI 10.1186/s12870-015-0523-4 RESEARCH ARTICLE Open Access Parallel subfunctionalisation of PsbO protein isoforms in angiosperms revealed by phylogenetic
Supplemental Data. Yang et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile
Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula
Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula Maheshi Dassanayake 1,9, Dong-Ha Oh 1,9, Jeffrey S. Haas 1,2, Alvaro Hernandez 3, Hyewon Hong 1,4, Shahjahan
** LCA LCN PCA
% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number
Potato Genome Analysis
Potato Genome Analysis Xin Liu Deputy director BGI research 2016.1.21 WCRTC 2016 @ Nanning Reference genome construction???????????????????????????????????????? Sequencing HELL RIEND WELCOME BGI ZHEN LLOFRI
The evolution of WRKY transcription factors
Rinerson et al. BMC Plant Biology (2015) 15:66 DOI 10.1186/s12870-015-0456-y RESEARCH ARTICLE Open Access The evolution of WRKY transcription factors Charles I Rinerson 1, Roel C Rabara 1, Prateek Tripathi
Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
Evolution of tonoplast P-ATPase transporters involved in vacuolar acidification
Research Evolution of tonoplast P-ATPase transporters involved in vacuolar acidification Yanbang Li 1,2 *, Sofia Provenzano 1,3 *, Mattijs Bliek 1,2 *, Cornelis Spelt 1,2, Ingo Appelhagen 4, Laura Machado
Plant Genome Sequencing
Plant Genome Sequencing Traditional Sanger Sequencing Genome Sequencing Approach 1. Create sequencing libraries of different insert sizes 2kb o Bulk of sequencing is performed on these libraries 10kb o
Agave Genomics in Support
Agave Genomics in Support of CAM Engineering cambiodesign.org Xiaohan Yang Biosciences Division Oak Ridge National Laboratory C4-CAM Conference August 09, 2013 Acknowledgements Oak Ridge National Laboratory
Browsing Genomic Information with Ensembl Plants
Browsing Genomic Information with Ensembl Plants Etienne de Villiers, PhD (Adapted from slides by Bert Overduin EMBL-EBI) Outline of workshop Brief introduction to Ensembl Plants History Content Tutorial
Phylogenetic Comparison of F-Box (FBX) Gene Superfamily within the Plant Kingdom Reveals Divergent Evolutionary Histories Indicative of Genomic Drift
Phylogenetic Comparison of F-Box (FBX) Gene Superfamily within the Plant Kingdom Reveals Divergent Evolutionary Histories Indicative of Genomic Drift Zhihua Hua 1, Cheng Zou 2, Shin-Han Shiu 2, Richard
Supplementary Information
Supplementary Information Rice APC/C TE controls tillering through mediating the degradation of MONOCULM 1 Qibing Lin 1*, Dan Wang 1*, Hui Dong 2*, Suhai Gu 1, Zhijun Cheng 1, Jie Gong 2, Ruizhen Qin 1,
Cryopreservation of syn seeds
COST Action FA1104 Sustainable production of high-quality cherries for the European market Long Term Preservation of Woody Species by Cryo Techniques, March 2015, Firenze Cryopreservation of syn seeds
Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
gi (NCBI databse: ES frame +2 (NCBI: databse
Figure legend for supplemental tables (S1-S6). The predicted and annotated amino acid sequences for the different LEA proteins found in the available databases (378) were analyzed using MEME software (Bailey
Jill M Duarte 1, P Kerr Wall 1,5, Patrick P Edger 2, Lena L Landherr 1, Hong Ma 1,4, J Chris Pires 2, Jim Leebens-Mack 3, Claude W depamphilis 1*
RESEARCH ARTICLE Open Access Identification of shared single copy nuclear genes in Arabidopsis, Populus, Vitis and Oryza and their phylogenetic utility across various taxonomic levels Jill M Duarte 1,
SUPPLEMENTARY MATERIAL SUPPLEMENTARY TABLES
SUPPLEMENTARY MATERIAL SUPPLEMENTARY TABLES Supplementary Table 1. Genomes available in Gramene build 38 Supplementary Table 2. Ontology associations in Gramene build 38 Supplementary Table 3. Synteny
South Green Bioinformatics activities at CIRAD
South Green Bioinformatics activities at CIRAD Data Integration Team of the research unit DAP Manuel Ruiz, CIP, Lima, 23rd january The Joint Research Unit DAP (Développement et Amélioration des Plantes
Supplemental Figure 1. Comparisons of GC3 distribution computed with raw EST data, bi-beta fits and complete genome sequences for 6 species.
Supplemental Figure 1. Comparisons of GC3 distribution computed with raw EST data, bi-beta fits and complete genome sequences for 6 species. Filled distributions: GC3 computed with raw EST data. Dashed
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
D. Incorrect! That is what a phylogenetic tree intends to depict.
Genetics - Problem Drill 24: Evolutionary Genetics No. 1 of 10 1. A phylogenetic tree gives all of the following information except for. (A) DNA sequence homology among species. (B) Protein sequence similarity
08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
Impact of recurrent gene duplication on adaptation of plant genomes
Fischer et al. BMC Plant Biology 2014, 14:151 RESEARCH ARTICLE Open Access Impact of recurrent gene duplication on adaptation of plant genomes Iris Fischer 1,2*, Jacques Dainat 3,6, Vincent Ranwez 3, Sylvain
Genome-Wide Identification of NBS-Encoding Resistance Genes in Sunflower (Helianthus annuus L.)
Article Genome-Wide Identification of NBS-Encoding Resistance Genes in Sunflower (Helianthus annuus L.) Surendra Neupane, Ethan J. Andersen, Achal Neupane and Madhav P. Nepal * Department of Biology and
USDA-DOE Plant Feedstock Genomics for Bioenergy
USDA-DOE Plant Feedstock Genomics for Bioenergy BERAC Thursday, June 7, 2012 Cathy Ronning, DOE-BER Ed Kaleikau, USDA-NIFA Plant Feedstock Genomics for Bioenergy Joint competitive grants program initiated
Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii
Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii Hengling Wei 1,2, Wei Li 1, Xiwei Sun 1, Shuijin Zhu 1 *, Jun Zhu 1 * 1 Key
Stage 1: Karyotype Stage 2: Gene content & order Step 3
Supplementary Figure Method used for ancestral genome reconstruction. MRCA (Most Recent Common Ancestor), AMK (Ancestral Monocot Karyotype), AEK (Ancestral Eudicot Karyotype), AGK (Ancestral Grass Karyotype)
Supplementary Information
Supplementary Information LINE-1-like retrotransposons contribute to RNA-based gene duplication in dicots Zhenglin Zhu 1, Shengjun Tan 2, Yaqiong Zhang 2, Yong E. Zhang 2,3 1. School of Life Sciences,
Molecular Population Genetics of Arabidopsis thaliana Ferulate-5-Hydroxylase and Flavanone-3-Hydroxylase Genes
PLSC 731 Plant Molecular Genetics Molecular Population Genetics of Arabidopsis thaliana Ferulate-5-Hydroxylase and Flavanone-3-Hydroxylase Genes Due: April 13, 2006, 11am DNA sequence data provides for
Research Article Identification of Immune Related LRR-Containing Genes in Maize (Zea mays L.) by Genome-Wide Sequence Analysis
International Journal of Genomics Volume 2015, Article ID 231358, 11 pages http://dx.doi.org/10.1155/2015/231358 Research Article Identification of Immune Related -Containing Genes in Maize (Zea mays L.)
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants
Liu et al. BMC Evolutionary Biology (2017) 17:47 DOI 10.1186/s12862-017-0891-5 RESEARCH ARTICLE Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants
Paleo-evolutionary plasticity of plant disease resistance genes
Zhang et al. BMC Genomics 2014, 15:187 RESEARCH ARTICLE Paleo-evolutionary plasticity of plant disease resistance genes Rongzhi Zhang 1,2, Florent Murat 1, Caroline Pont 1, Thierry Langin 1 and Jerome
Journal of Integrative Agriculture 2017, 16(5): Available online at ScienceDirect
Journal of Integrative Agriculture 2017, 16(5): 60345-7 Available online at www.sciencedirect.com ScienceDirect RESEARCH ARTICLE Characterization and expression analysis of a novel RING-HC gene, ZmRHCP1,
THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types
Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between
Genome-wide analysis of TCP family in tobacco
Genome-wide analysis of TCP family in tobacco L. Chen 1,2, Y.Q. Chen 3, A.M. Ding 1, H. Chen 1,2, F. Xia 1,2, W.F. Wang 1,2 and Y.H. Sun 1 1 Key Laboratory for Tobacco Gene Resources, Tobacco Research
Dr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
Intraspecific gene genealogies: trees grafting into networks
Intraspecific gene genealogies: trees grafting into networks by David Posada & Keith A. Crandall Kessy Abarenkov Tartu, 2004 Article describes: Population genetics principles Intraspecific genetic variation
Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla
Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla Xiu-Qing Li 1 *, Donglei Du 2 1 Molecular Genetics Laboratory, Potato Research
Host_microbe_PPI - R package to analyse intra-species and interspecies protein-protein interactions in the model plant Arabidopsis thaliana
Host_microbe_PPI - R package to analyse intra-species and interspecies protein-protein interactions in the model plant Arabidopsis thaliana Thomas Nussbaumer 1,2 1 Institute of Network Biology (INET),
Genomics and Bioinformatics Resources for Crop Improvement
Genomics and Bioinformatics Resources for Crop Improvement Keiichi Mochida and Kazuo Shinozaki RIKEN Plant Science Center, Yokohama, 230-0045 Japan Corresponding author: E-mail, sinozaki@rtc.riken.jp ;
Genome-wide analysis of nucleotide-binding site disease resistance genes in Medicago truncatula
Chin. Sci. Bull. (2014) 59(11):1129 1138 DOI 10.1007/s11434-014-0155-3 Article csb.scichina.com www.springer.com/scp Bioinformatics Genome-wide analysis of nucleotide-binding site disease resistance genes
Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus
Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus Xiaohan Yang Sara Jawdy Timothy Tschaplinski Gerald Tuskan Environmental Sciences Division Oak Ridge National Laboratory
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky
MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally
Supporting Information
Supporting Information Rossig et al. 10.1073/pnas.1319648110 SI Materials and Methods Athp20 and Athp30 Mutant Characterization and Analysis of the Athp30/30-2 RNAi Lines. Athp20;1 and Athp20;2 (SALK_020671
Additional file 10. Classification of Pac sequences based on maximum-likelihood (ML) phylogenetic analyses. Analyses were performed on the same
Additional file 10. Classification of Pac sequences based on maximum-likelihood (ML) phylogenetic analyses. Analyses were performed on the same dataset alignments used for crucial Neighbor-joining trees
Comparative Protein Modeling of Superoxide Dismutase Isoforms in Maize.
Comparative Protein Modeling of Superoxide Dismutase Isoforms in Maize. Kaliyugam Shiriga 1, 2, Rinku Sharma 1, Krishan Kumar 2, Firoz Hossain 1 and NepoleanThirunavukkarasu 1* Division of Genetics, Indian
Muñoz-Clares et al. BMC Plant Biology 2014, 14:149
Muñoz-Clares et al. BMC Plant Biology 2014, 14:149 RESEARCH ARTICLE Open Access Exploring the evolutionary route of the acquisition of betaine aldehyde dehydrogenase activity by plant ALDH10 enzymes: implications
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
Research Article mir156- and mir171-binding Sites in the Protein-Coding Sequences of Several Plant Genes
BioMed Research International Volume, Article ID, pages http://dx.doi.org/.// Research Article mir- and mir-binding Sites in the Protein-oding Sequences of Several Plant Genes Assyl Bari, Saltanat Orazova,
Concerted divergence after gene duplication in Polycomb Repressor. complexes
Plant Physiology Preview. Published on April 28, 2017, as DOI:10.1104/pp.16.01983 1 Short title: Concerted divergence of duplicated genes 2 3 4 Concerted divergence after gene duplication in Polycomb Repressor
A greedy, graph-based algorithm for the alignment of multiple homologous gene lists
A greedy, graph-based algorithm for the alignment of multiple homologous gene lists Jan Fostier, Sebastian Proost, Bart Dhoedt, Yvan Saeys, Piet Demeester, Yves Van de Peer, and Klaas Vandepoele Bioinformatics
Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots
Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots Sunita Kumari 1, Doreen Ware 1,2 * 1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New
Supporting Information
Supporting Information Fawcett et al. 10.1073/pnas.0900906106 SI Text Estimating the Age of Gene Duplication Events: The Use of K S Values. One of the most common methods used to study and visualize gene
Evolution by duplication: paleopolyploidy events in plants reconstructed by deciphering the evolutionary history of VOZ transcription factors
Gao et al. BMC Plant Biology (2018) 18:256 https://doi.org/10.1186/s12870-018-1437-8 RESEARCH ARTICLE Evolution by duplication: paleopolyploidy events in plants reconstructed by deciphering the evolutionary
Bioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
Research Article Genome-Wide Identification, Evolutionary, and Expression Analyses of Histone H3 Variants in Plants
BioMed Research International Volume 2015, Article ID 341598, 7 pages http://dx.doi.org/10.1155/2015/341598 Research Article Genome-Wide Identification, Evolutionary, and Expression Analyses of Histone
Slovene Plant Gene Bank (SPGB) and Genetic Resources Programme
Slovene Plant Gene Bank (SPGB) and Genetic Resources Programme Second Meeting of the ECPGR Working Group on Leafy Vegetables 8 9 October, Ljubljana, Slovenia Vladimir MEGLIČ, Jelka ŠUŠTAR VOZLIČ Slovene
Anatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses
Anatomy of a tree outgroup: an early branching relative of the interest groups sister taxa: taxa derived from the same recent ancestor polytomy: >2 taxa emerge from a node Anatomy of a tree clade is group
Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
Other Supplemenary Materials for this manuscript includes the following:
Supplemental Materials: Suppmentary Text S1.1-S1.6 Figures S1.1 to S1.3 Tables S1.1 to S1.7 Supplementary Text S2.1-S2.4 Figures S2.1 to S2.5 Tables S2.1 to S2.3 Supplementary Text S3.1-S3.2 Figures S3.1
Identification and characterization of the bzip transcription factor involved in zinc homeostasis in cereals
Identification and characterization of the bzip transcription factor involved in zinc homeostasis in cereals A.R. Henriques, D. da R. Farias and A. Costa de Oliveira Centro de Genômica e Fitomelhoramento,
Evolution of the Rdr1 TNL-cluster in roses and other Rosaceous species
Terefe-Ayana et al. BMC Genomics 2012, 13:409 RESEARCH ARTICLE Open Access Evolution of the Rdr1 TNL-cluster in roses and other Rosaceous species Diro Terefe-Ayana, Helgard Kaufmann, Marcus Linde and Thomas
training workshop 2015
TransPLANT user training workshop 2015 Slides: http://tinyurl.com/transplant2015 Workshop on variation data EMBL-EBI Hinxton-UK 2nd July 2015 Ensembl Genomes Team Notes: This workshop is based on Ensembl
Levels of genetic variation for a single gene, multiple genes or an entire genome
From previous lectures: binomial and multinomial probabilities Hardy-Weinberg equilibrium and testing HW proportions (statistical tests) estimation of genotype & allele frequencies within population maximum
The Solute Accumulation: The Mechanism for Drought Tolerance in RD23 Rice (Oryza sativa L) Lines
R ESEARCH ARTICLE ScienceAsia 27 (2001) : 93-97 The Solute Accumulation: The Mechanism for Drought Tolerance in RD23 Rice (Oryza sativa L) Lines Montakan Vajrabhaya, Warunya Kumpun and Supachitra Chadchawan*
The Journal of Animal & Plant Sciences, 28(5): 2018, Page: Sadia et al., ISSN:
The Journal of Animal & Plant Sciences, 28(5): 2018, Page: 1532-1536 Sadia et al., ISSN: 1018-7081 Short Communication BIOINFORMATICS ANALYSIS OF CODON USAGE BIAS AND RNA SECONDARY STRUCTURES FOR SALT
Phylogenetic analyses. Kirsi Kostamo
Phylogenetic analyses Kirsi Kostamo The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among different groups (individuals, populations, species,
Enduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc.
Enduring Understanding: Change in the genetic makeup of a population over time is evolution. Objective: You will be able to identify the key concepts of evolution theory Do Now: Read the enduring understanding
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11510 Supplementary Table 1. Indel Index Removal Gene Number of Starting Sequences Number of Final Sequences Percentage of Sequences Removed based on the Indel
A computational analysis of Salt Overly Sensitive 1 homologs in halophytes and glycophytes
A computational analysis of Salt Overly Sensitive 1 homologs in halophytes and glycophytes Cherin E. Kim 1 and Ray A. Bressan 2 1 West Lafayette Jr./Sr. High School, West Lafayette, IN, USA 2 Department
Name: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
Neofunctionalization within the Omp85 protein superfamily during
Neofunctionalization within the Omp protein superfamily during chloroplast evolution Mats Töpel, Qihua Ling and Paul Jarvis, * Department of Plant and Environmental Sciences; Göteborg University; Göteborg,
Whole genome duplication events in plant evolution reconstructed and predicted using myosin motor proteins
Mühlhausen and Kollmar BMC Evolutionary Biology 2013, 13:202 RESEARCH ARTICLE Open Access Whole genome duplication events in plant evolution reconstructed and predicted using myosin motor proteins Stefanie
Cladistics and Bioinformatics Questions 2013
AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species
biology Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana
Biology 2013, 2, 1465-1487; doi:10.3390/biology2041465 Article OPEN ACCESS biology ISSN 2079-7737 www.mdpi.com/journal/biology Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs
MULTIPLE SEQUENCE ALIGNMENT FOR CONSTRUCTION OF PHYLOGENETIC TREE
MULTIPLE SEQUENCE ALIGNMENT FOR CONSTRUCTION OF PHYLOGENETIC TREE Manmeet Kaur 1, Navneet Kaur Bawa 2 1 M-tech research scholar (CSE Dept) ACET, Manawala,Asr 2 Associate Professor (CSE Dept) ACET, Manawala,Asr
Supporting Information Figs S1 S7
Poptr 2s 4CL7 EucgrF33 Supporting Information Figs S S7 Os4g5 Poptr 5s4 4CL6 4CL i GSVIVG6 Arath AT5G633 AT4CL-like8 i GSVIVG Poptr 2s 4CL5 Poptr s 4CL4 i GSVIVG EucgrB38 Poptr 7s2 4CL2 i GSVIVG EucgrB
Consensus Methods. * You are only responsible for the first two
Consensus Trees * consensus trees reconcile clades from different trees * consensus is a conservative estimate of phylogeny that emphasizes points of agreement * philosophy: agreement among data sets is
I. Short Answer Questions DO ALL QUESTIONS
EVOLUTION 313 FINAL EXAM Part 1 Saturday, 7 May 2005 page 1 I. Short Answer Questions DO ALL QUESTIONS SAQ #1. Please state and BRIEFLY explain the major objectives of this course in evolution. Recall
Assessment of phylogenetic signal in the germination ability of broomrape (Phelipanche ramosa) on Brassicaceae hosts
Assessment of phylogenetic signal in the germination ability of broomrape (Phelipanche ramosa) on Brassicaceae hosts S. Gibot-Leclerc, R. Perronne, F. Dessaint, C. Reibel, V. Le Corre 1 AgroSupDijon, UMR1347
Warm Up. Explain how a mutation can be detrimental in one environmental context and beneficial in another.
Warm Up Explain how a mutation can be detrimental in one environmental context and beneficial in another. Last Picture 4B Evidence for Evolution 1A.4a: Scientific evidence of biological evolution uses