Potato Genome Analysis

Size: px
Start display at page:

Download "Potato Genome Analysis"

Transcription

1 Potato Genome Analysis Xin Liu Deputy director BGI research WCRTC Nanning

2 Reference genome construction???????????????????????????????????????? Sequencing HELL RIEND WELCOME BGI ZHEN LLOFRI DSWEL METOBG HENZH HELLOF SWEL METO GISHEN ELLOFR DSW COM OBGI ENZHEN OFIIEN WELCOM GISH NZHEN Assemble HELLO FRIENDS WELCOME TO BGISHENZHEN

3 Second generation sequencing for assembly Construct libraries with hierarchical insert-sizes; 250bp, 500bp, 800bp, 2kb, 5kb, 10kb, 20kb, 40kb Sequence the libraries; 60X genome coverage; De novo assembly Annotation and evolutionary analysis

4 Genome survey 1. 30X data 2. K-mer analysis 3. Preliminary assembly 4. Heterozygosity simulation analysis 5. GC depth distribution analysis 1.Genome size 2.Heterozygosity rate 3.GC content 4.Repeat sequence proportion

5 The potato genome Would provide important resource for crop improvement

6 Information of potato genome Autotetraploid (2n=4x=48) Highly heterozygous Heterozygous diploid available Double haplotype available Different dataset available Genome size: 850 Mb

7 Sample selection DM R44 (DM) resulted from chromosome doubling of a monoploid (1n=1x=12) derived by anther culture of a heterozygous diploid (2n=2x=24) S. tuberosum group Phureja clone (PI ).

8 Heterozygosity affecting genome assembly Heterozygosity would result in breakdown of the assembly. Rei Kajitani, Kouta Toshimoto, Hideki Noguchi, et al.

9 Assess the genome 33,761,617,031 bases Peak at 40 Genome size estimated to be: 844 Mb S. tuberosum group Phureja DM R44

10 The heterozygous diploid S. tuberosum group Tuberosum RH

11 Assessing the heterozygosity

12 Assemble the DM genome: data

13 The potato genome assembly 727 Mb, 6.1% Ns/gaps, 86% of the genome N kb, 443 super scaffolds a: Chromosome karyotype b: Gene density c: Repeats coverage d: Transcription state e: GC content f: Subtelomeric repeats distribution

14 Comparing to Sanger sequenced BACs 97.1% of 181,558 available Sanger-sequenced S. tuberosum ESTs

15 Comparing to Sanger sequenced BACs

16 Comparing to BAC/fosmid ends

17 Anchoring to the chromosomes Anchored 623Mb (86%) to chromosomes With 90.3% of the genes on chromosomes

18 Repeat annotation and assessment

19 Repeat content

20 Gene annotation Genomic sequence Protein sequences Rough alignment ab initio prediction Alignment cdna/est sequences Syteny info. Precise alignment Homologybased genes Post-filtering ab initio genes cdna/est genes TE proteins 12.1% derived solely from ab initio gene predictions RNA-seq reads Genome mapping Gene sets combination Combined gene set Gene sets modification 31.5 Gb of RNA-Seq data from 32 DM and 16 RH samples/tissues 90.2% of 824,621,408 DM reads and 88.6% of 140,375,647 RH reads mapped Final gene set 39,031 protein-coding genes 9,875 genes (25.3%) had alternative splicing

21 Gene annotation result

22 Genome evolution gene families Oryza sativa Brachypodium distachyon Sorghum bicolor Zea mays Arabidopsis thaliana Carcia papaya Populus trichocarpa Vitis vinifera Glycine max Monocots Eudicots Chalamydomanas reinhardtii Physcomitrella patens Algae, moss 4,479 potato genes clustered in 3,181 families 34,051 potato genes clustered with at least one genome 2,642 genes are asterid-specific 3,372 gens are potato lineage-specific

23 Genome evolution - synteny 1,811 syntenic blocks involving 10,046 genes

24 Genome evolution whole genome duplication ~89 MYA ~67 MYA γ event (~185MYA)

25 Genome evolution evidence for WGD

26 Comparing RH and DM 1,644 RH BAC clones 178Mb of non-redundant sequences (~10%) 99Mb of RH sequence (55%) to the DM genome The aligned regions with 97.5% identity SNP every 40 bp and one indel (12.8 bp in average) every 394 bp between RH and DM 6.6Mb of sequence could be aligned with 96.5% identity with in two haplotypes and SNP per 29 bp and 1 indel per 253 bp (average length 10.4 bp)

27 Comparing at the whole genome level 1,118 million NGS reads (84X) from RH million reads aligned to Mb (90.6%) of DM genome 3.67 million SNPs Premature stop, frame shift, presence/absence variants

28 Inbreeding depression 3,018 premature stop codons (606 homozygous and 2,412 heterozygous, 1,760 of which are specific) 80 frameshift mutations (49 homozygous and 31 heterozygous) 275 PAV genes (246 RH specific and 29 were DM specific)

29 Inbreeding depression One instance of copy number variation Five genes with premature stop codons Seven RH-specific genes

30 Tuber biology 15,235 genes expressed in the transition from stolons to tubers 15,235 1, ,217 transcripts with >5-fold expression in stolons versus five RH tuber tissues 333 transcripts upregulated during the transition from stolons to tubers. Particularly, proteinase inhibitors, i.e. KTI (Kunitz protease inhibitor)

31 KTI family 28 Kunitz protease inhibitor genes (KTIs)

32 KTI family

33 Starch synthesis

34 Flowering time regulation for tuber induction

35 Disease resistance Many NBS-LRR genes are pseudogenes owing to indels, frame shift mutations, or premature stop codons, including R1, R3a et al., which might be driven by the rapid evolution of effector genes in the potato late blight pathogen, Phytophthora infestans 39.4%

36 Acknowledgement

Stage 1: Karyotype Stage 2: Gene content & order Step 3

Stage 1: Karyotype Stage 2: Gene content & order Step 3 Supplementary Figure Method used for ancestral genome reconstruction. MRCA (Most Recent Common Ancestor), AMK (Ancestral Monocot Karyotype), AEK (Ancestral Eudicot Karyotype), AGK (Ancestral Grass Karyotype)

More information

Paleo-evolutionary plasticity of plant disease resistance genes

Paleo-evolutionary plasticity of plant disease resistance genes Zhang et al. BMC Genomics 2014, 15:187 RESEARCH ARTICLE Paleo-evolutionary plasticity of plant disease resistance genes Rongzhi Zhang 1,2, Florent Murat 1, Caroline Pont 1, Thierry Langin 1 and Jerome

More information

Supplemental Figure 1. Comparisons of GC3 distribution computed with raw EST data, bi-beta fits and complete genome sequences for 6 species.

Supplemental Figure 1. Comparisons of GC3 distribution computed with raw EST data, bi-beta fits and complete genome sequences for 6 species. Supplemental Figure 1. Comparisons of GC3 distribution computed with raw EST data, bi-beta fits and complete genome sequences for 6 species. Filled distributions: GC3 computed with raw EST data. Dashed

More information

Bioinformatics tools to analyze complex genomes. Yves Van de Peer Ghent University/VIB

Bioinformatics tools to analyze complex genomes. Yves Van de Peer Ghent University/VIB Bioinformatics tools to analyze complex genomes Yves Van de Peer Ghent University/VIB Detecting colinearity and large-scale gene duplications A 1 2 3 4 5 6 7 8 9 10 11 Speciation/Duplicatio n S1 S2 1

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Table S1. Genomes available in build 47 Supplementary Table S2. Counts of putative contiguous gene split models in 39 plant reference genomes in build 47 Supplementary

More information

Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula

Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula Maheshi Dassanayake 1,9, Dong-Ha Oh 1,9, Jeffrey S. Haas 1,2, Alvaro Hernandez 3, Hyewon Hong 1,4, Shahjahan

More information

Eukaryotic vs. Prokaryotic genes

Eukaryotic vs. Prokaryotic genes BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,

More information

Evaluation of Genome Sequencing Quality in Selected Plant Species Using Expressed Sequence Tags

Evaluation of Genome Sequencing Quality in Selected Plant Species Using Expressed Sequence Tags Evaluation of Genome Sequencing Quality in Selected Plant Species Using Expressed Sequence Tags Lingfei Shangguan 1, Jian Han 1, Emrul Kayesh 1, Xin Sun 1, Changqing Zhang 2, Tariq Pervaiz 1, Xicheng Wen

More information

Supplementary Figure 3

Supplementary Figure 3 Supplementary Figure 3 7.0 Col Kas-1 Line FTH1A 8.4 F3PII3 8.9 F26H11 ATQ1 T9I22 PLS8 F26B6-B 9.6 F27L4 9.81 F27D4 9.92 9.96 10.12 10.14 10.2 11.1 0.5 Mb T1D16 Col % RGR 83.3 101 227 93.5 75.9 132 90 375

More information

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison 10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:

More information

Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus

Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus Xiaohan Yang Sara Jawdy Timothy Tschaplinski Gerald Tuskan Environmental Sciences Division Oak Ridge National Laboratory

More information

Marialaura Destefanis 1,3, Istvan Nagy 1,4, Brian Rigney 1, Glenn J Bryan 2, Karen McLean 2, Ingo Hein 2, Denis Griffin 1 and Dan Milbourne 1*

Marialaura Destefanis 1,3, Istvan Nagy 1,4, Brian Rigney 1, Glenn J Bryan 2, Karen McLean 2, Ingo Hein 2, Denis Griffin 1 and Dan Milbourne 1* Destefanis et al. BMC Plant Biology (2015) 15:255 DOI 10.1186/s12870-015-0645-8 RESEARCH ARTICLE Open Access A disease resistance locus on potato and tomato chromosome 4 exhibits a conserved multipartite

More information

,(CL806925),(CL ),(CL829057),(CL ),(CL862603) BAC45136 putative nucleotide-binding

,(CL806925),(CL ),(CL829057),(CL ),(CL862603) BAC45136 putative nucleotide-binding Additional Data File 13. List of 83 disease resistance-related genes that matched the unmapped BESs of On, Or, and Og. BESs that had internal stop codons within the aligned regions are presented in parentheses.

More information

Impact of recurrent gene duplication on adaptation of plant genomes

Impact of recurrent gene duplication on adaptation of plant genomes Fischer et al. BMC Plant Biology 2014, 14:151 RESEARCH ARTICLE Open Access Impact of recurrent gene duplication on adaptation of plant genomes Iris Fischer 1,2*, Jacques Dainat 3,6, Vincent Ranwez 3, Sylvain

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Annotation of Plant Genomes using RNA-seq. Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA)

Annotation of Plant Genomes using RNA-seq. Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA) Annotation of Plant Genomes using RNA-seq Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA) inuscu1-35bp 5 _ 0 _ 5 _ What is Annotation inuscu2-75bp luscu1-75bp 0 _ 5 _ Reconstruction

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Genome-wide discovery of G-quadruplex forming sequences and their functional

Genome-wide discovery of G-quadruplex forming sequences and their functional *Correspondence and requests for materials should be addressed to R.G. (rohini@nipgr.ac.in) Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants Rohini Garg*,

More information

Phylogenetic Comparison of F-Box (FBX) Gene Superfamily within the Plant Kingdom Reveals Divergent Evolutionary Histories Indicative of Genomic Drift

Phylogenetic Comparison of F-Box (FBX) Gene Superfamily within the Plant Kingdom Reveals Divergent Evolutionary Histories Indicative of Genomic Drift Phylogenetic Comparison of F-Box (FBX) Gene Superfamily within the Plant Kingdom Reveals Divergent Evolutionary Histories Indicative of Genomic Drift Zhihua Hua 1, Cheng Zou 2, Shin-Han Shiu 2, Richard

More information

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four

More information

UNIT 5. Protein Synthesis 11/22/16

UNIT 5. Protein Synthesis 11/22/16 UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA

More information

Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye!

Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye! Today Gene regulation Synteny Good bye! Gene regulation What governs gene transcription? Genes active under different circumstances. Gene regulation What governs gene transcription? Genes active under

More information

Lineage specific conserved noncoding sequences in plants

Lineage specific conserved noncoding sequences in plants Lineage specific conserved noncoding sequences in plants Nilmini Hettiarachchi Department of Genetics, SOKENDAI National Institute of Genetics, Mishima, Japan 20 th June 2014 Conserved Noncoding Sequences

More information

New insights into the evolution and functional divergence of the SWEET family in Saccharum based on comparative genomics

New insights into the evolution and functional divergence of the SWEET family in Saccharum based on comparative genomics Hu et al. BMC Plant Biology (2018) 18:270 https://doi.org/10.1186/s12870-018-1495-y RESEARCH ARTICLE Open Access New insights into the evolution and functional divergence of the SWEET family in Saccharum

More information

Evolution by duplication: paleopolyploidy events in plants reconstructed by deciphering the evolutionary history of VOZ transcription factors

Evolution by duplication: paleopolyploidy events in plants reconstructed by deciphering the evolutionary history of VOZ transcription factors Gao et al. BMC Plant Biology (2018) 18:256 https://doi.org/10.1186/s12870-018-1437-8 RESEARCH ARTICLE Evolution by duplication: paleopolyploidy events in plants reconstructed by deciphering the evolutionary

More information

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid. 1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Host_microbe_PPI - R package to analyse intra-species and interspecies protein-protein interactions in the model plant Arabidopsis thaliana

Host_microbe_PPI - R package to analyse intra-species and interspecies protein-protein interactions in the model plant Arabidopsis thaliana Host_microbe_PPI - R package to analyse intra-species and interspecies protein-protein interactions in the model plant Arabidopsis thaliana Thomas Nussbaumer 1,2 1 Institute of Network Biology (INET),

More information

Going Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014

Going Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014 Going Beyond SNPs with Next Genera5on Sequencing Technology 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Next Genera5on Sequencing Technology (NGS) NGS technology Discover more

More information

Supplementary Figure 1. Number of CC- and TIR- type NBS- LRR genes and presence of mir482/2118 on sequenced plant genomes.

Supplementary Figure 1. Number of CC- and TIR- type NBS- LRR genes and presence of mir482/2118 on sequenced plant genomes. Number of CC- NBS and CC- NBS- LRR R- genes Number of TIR- NBS and TIR- NBS- LRR R- genes 0 50 100 150 200 250 0 50 100 150 200 250 300 350 400 450 mir482 and mir2118 Cajanus cajan Glycine max Hevea brasiliensis

More information

Genomes Comparision via de Bruijn graphs

Genomes Comparision via de Bruijn graphs Genomes Comparision via de Bruijn graphs Student: Ilya Minkin Advisor: Son Pham St. Petersburg Academic University June 4, 2012 1 / 19 Synteny Blocks: Algorithmic challenge Suppose that we are given two

More information

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING

More information

Systematic comparison of lncrnas with protein coding mrnas in population expression and their response to environmental change

Systematic comparison of lncrnas with protein coding mrnas in population expression and their response to environmental change Xu et al. BMC Plant Biology (2017) 17:42 DOI 10.1186/s12870-017-0984-8 RESEARCH ARTICLE Open Access Systematic comparison of lncrnas with protein coding mrnas in population expression and their response

More information

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii Hengling Wei 1,2, Wei Li 1, Xiwei Sun 1, Shuijin Zhu 1 *, Jun Zhu 1 * 1 Key

More information

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,

More information

Cao, J, K Schneeberger, S Ossowski, et al Whole genome sequencing of multiple Arabidopsis thaliana populations. Nat Genet 43:

Cao, J, K Schneeberger, S Ossowski, et al Whole genome sequencing of multiple Arabidopsis thaliana populations. Nat Genet 43: Figure S1. Syntenic map of SAE1B duplication. We have used the nucleotide sequences of Arabidopsis thaliana Col-0 gene tandem duplicates AT5G50580 and AT5G506800 as queries in independent BLASTN searches

More information

Genome-wide analysis of the MYB transcription factor superfamily in soybean

Genome-wide analysis of the MYB transcription factor superfamily in soybean Du et al. BMC Plant Biology 2012, 12:106 RESEARCH ARTICLE Open Access Genome-wide analysis of the MYB transcription factor superfamily in soybean Hai Du 1,2,3, Si-Si Yang 1,2, Zhe Liang 4, Bo-Run Feng

More information

USDA-DOE Plant Feedstock Genomics for Bioenergy

USDA-DOE Plant Feedstock Genomics for Bioenergy USDA-DOE Plant Feedstock Genomics for Bioenergy BERAC Thursday, June 7, 2012 Cathy Ronning, DOE-BER Ed Kaleikau, USDA-NIFA Plant Feedstock Genomics for Bioenergy Joint competitive grants program initiated

More information

Browsing Genomic Information with Ensembl Plants

Browsing Genomic Information with Ensembl Plants Browsing Genomic Information with Ensembl Plants Etienne de Villiers, PhD (Adapted from slides by Bert Overduin EMBL-EBI) Outline of workshop Brief introduction to Ensembl Plants History Content Tutorial

More information

Small RNA in rice genome

Small RNA in rice genome Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and

More information

Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla

Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla Xiu-Qing Li 1 *, Donglei Du 2 1 Molecular Genetics Laboratory, Potato Research

More information

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Supplemental Table 1. Primers used for cloning and PCR amplification in this study Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC

More information

Introduction to de novo RNA-seq assembly

Introduction to de novo RNA-seq assembly Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies

More information

Science Unit Learning Summary

Science Unit Learning Summary Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In

More information

Genome sequence of Plasmopara viticola and insight into the pathogenic mechanism

Genome sequence of Plasmopara viticola and insight into the pathogenic mechanism Genome sequence of Plasmopara viticola and insight into the pathogenic mechanism Ling Yin 1,3,, Yunhe An 1,2,, Junjie Qu 3,, Xinlong Li 1, Yali Zhang 1, Ian Dry 5, Huijun Wu 2*, Jiang Lu 1,4** 1 College

More information

Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants Liu et al. BMC Evolutionary Biology (2017) 17:47 DOI 10.1186/s12862-017-0891-5 RESEARCH ARTICLE Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

More information

Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots

Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots Sunita Kumari 1, Doreen Ware 1,2 * 1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New

More information

Genome-wide analysis of nucleotide-binding site disease resistance genes in Medicago truncatula

Genome-wide analysis of nucleotide-binding site disease resistance genes in Medicago truncatula Chin. Sci. Bull. (2014) 59(11):1129 1138 DOI 10.1007/s11434-014-0155-3 Article csb.scichina.com www.springer.com/scp Bioinformatics Genome-wide analysis of nucleotide-binding site disease resistance genes

More information

Principles of Genetics

Principles of Genetics Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics

More information

RNA- seq read mapping

RNA- seq read mapping RNA- seq read mapping Pär Engström SciLifeLab RNA- seq workshop October 216 IniDal steps in RNA- seq data processing 1. Quality checks on reads 2. Trim 3' adapters (opdonal (for species with a reference

More information

Fei Lu. Post doctoral Associate Cornell University

Fei Lu. Post doctoral Associate Cornell University Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.

More information

The Saguaro Genome. Toward the Ecological Genomics of a Sonoran Desert Icon. Dr. Dario Copetti June 30, 2015 STEMAZing workshop TCSS

The Saguaro Genome. Toward the Ecological Genomics of a Sonoran Desert Icon. Dr. Dario Copetti June 30, 2015 STEMAZing workshop TCSS The Saguaro Genome Toward the Ecological Genomics of a Sonoran Desert Icon Dr. Dario Copetti June 30, 2015 STEMAZing workshop TCSS Why study a genome? - the genome contains the genetic information of an

More information

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males.

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. Multiple Choice Use the following information for questions 1-3. A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and

More information

Plant Genome Sequencing

Plant Genome Sequencing Plant Genome Sequencing Traditional Sanger Sequencing Genome Sequencing Approach 1. Create sequencing libraries of different insert sizes 2kb o Bulk of sequencing is performed on these libraries 10kb o

More information

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11 The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding

More information

PLAZA: A Comparative Genomics Resource to Study Gene and Genome Evolution in Plants W

PLAZA: A Comparative Genomics Resource to Study Gene and Genome Evolution in Plants W The Plant Cell, Vol. 21: 3718 3731, December 2009, www.plantcell.org ã 2009 American Society of Plant Biologists Special Series on Large-Scale Biology PLAZA: A Comparative Genomics Resource to Study Gene

More information

Genômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal

Genômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal Genômica comparativa João Carlos Setubal IQ-USP outubro 2012 11/5/2012 J. C. Setubal 1 Comparative genomics There are currently (out/2012) 2,230 completed sequenced microbial genomes publicly available

More information

Name: Period: EOC Review Part F Outline

Name: Period: EOC Review Part F Outline Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences

More information

Structure, phylogeny, allelic haplotypes and expression of sucrose transporter gene families in Saccharum

Structure, phylogeny, allelic haplotypes and expression of sucrose transporter gene families in Saccharum Zhang et al. BMC Genomics (2016) 17:88 DOI 10.1186/s12864-016-2419-6 RESEARCH ARTICLE Open Access Structure, phylogeny, allelic haplotypes and expression of sucrose transporter gene families in Saccharum

More information

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example

More information

South Green Bioinformatics activities at CIRAD

South Green Bioinformatics activities at CIRAD South Green Bioinformatics activities at CIRAD Data Integration Team of the research unit DAP Manuel Ruiz, CIP, Lima, 23rd january The Joint Research Unit DAP (Développement et Amélioration des Plantes

More information

training workshop 2015

training workshop 2015 TransPLANT user training workshop 2015 Slides: http://tinyurl.com/transplant2015 Workshop on variation data EMBL-EBI Hinxton-UK 2nd July 2015 Ensembl Genomes Team Notes: This workshop is based on Ensembl

More information

1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.

1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.

More information

Exploring structural variation and gene family architecture with De Novo assemblies of 15 Medicago genomes

Exploring structural variation and gene family architecture with De Novo assemblies of 15 Medicago genomes Zhou et al. BMC Genomics (2017) 18:261 DOI 10.1186/s12864-017-3654-1 RESEARCH ARTICLE Open Access Exploring structural variation and gene family architecture with De Novo assemblies of 15 Medicago genomes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature111 cytosol Model: PILS function in cellular auxin homeostasis ER nucleus IAA degradation? sequestration? conjugation? storage? signalling? PILS IAA ER cytosol Supplemental Figure 1 Model

More information

What can sequences tell us?

What can sequences tell us? Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature13082 Supplementary Table 1. Examination of nectar production in wild-type and atsweet9 flowers. No. of flowers with detectable nectar out of the total observed

More information

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, Gene Expression Regulation Mutations Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

biology Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

biology Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana Biology 2013, 2, 1465-1487; doi:10.3390/biology2041465 Article OPEN ACCESS biology ISSN 2079-7737 www.mdpi.com/journal/biology Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs

More information

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation

More information

Non-host resistance to wheat stem rust in Brachypodium species

Non-host resistance to wheat stem rust in Brachypodium species Non-host resistance to wheat stem rust in Brachypodium species Dr. Melania Figueroa Assistant Professor Department of Plant Pathology and Stakman-Borlaug Center for Sustainable Plant Health University

More information

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and counterclockwise for the inner row, with green representing coding

More information

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever. CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains

More information

Algorithmics and Bioinformatics

Algorithmics and Bioinformatics Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector.

The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector. The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector. Omar S. Akbari*, Igor Antoshechkin*, Henry Amrhein, Brian Williams, Race Diloreto, Jeremy

More information

The Journal of Animal & Plant Sciences, 28(5): 2018, Page: Sadia et al., ISSN:

The Journal of Animal & Plant Sciences, 28(5): 2018, Page: Sadia et al., ISSN: The Journal of Animal & Plant Sciences, 28(5): 2018, Page: 1532-1536 Sadia et al., ISSN: 1018-7081 Short Communication BIOINFORMATICS ANALYSIS OF CODON USAGE BIAS AND RNA SECONDARY STRUCTURES FOR SALT

More information

Untitled Document. A. antibiotics B. cell structure C. DNA structure D. sterile procedures

Untitled Document. A. antibiotics B. cell structure C. DNA structure D. sterile procedures Name: Date: 1. The discovery of which of the following has most directly led to advances in the identification of suspects in criminal investigations and in the identification of genetic diseases? A. antibiotics

More information

Lecture Notes: BIOL2007 Molecular Evolution

Lecture Notes: BIOL2007 Molecular Evolution Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits

More information

BME 5742 Biosystems Modeling and Control

BME 5742 Biosystems Modeling and Control BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various

More information

Supplementary Tables and Figures

Supplementary Tables and Figures Supplementary Tables Supplementary Tables and Figures Supplementary Table 1: Tumor types and samples analyzed. Supplementary Table 2: Genes analyzed here. Supplementary Table 3: Statistically significant

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Lecture 3: A basic statistical concept

Lecture 3: A basic statistical concept Lecture 3: A basic statistical concept P value In statistical hypothesis testing, the p value is the probability of obtaining a result at least as extreme as the one that was actually observed, assuming

More information

Chromosomal rearrangements in mammalian genomes : characterising the breakpoints. Claire Lemaitre

Chromosomal rearrangements in mammalian genomes : characterising the breakpoints. Claire Lemaitre PhD defense Chromosomal rearrangements in mammalian genomes : characterising the breakpoints Claire Lemaitre Laboratoire de Biométrie et Biologie Évolutive Université Claude Bernard Lyon 1 6 novembre 2008

More information

Whole Genome Alignment. Adam Phillippy University of Maryland, Fall 2012

Whole Genome Alignment. Adam Phillippy University of Maryland, Fall 2012 Whole Genome Alignment Adam Phillippy University of Maryland, Fall 2012 Motivation cancergenome.nih.gov Breast cancer karyotypes www.path.cam.ac.uk Goal of whole-genome alignment } For two genomes, A and

More information

Computational Structural Bioinformatics

Computational Structural Bioinformatics Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129 koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite

More information

Adaptation in the Human Genome. HapMap. The HapMap is a Resource for Population Genetic Studies. Single Nucleotide Polymorphism (SNP)

Adaptation in the Human Genome. HapMap. The HapMap is a Resource for Population Genetic Studies. Single Nucleotide Polymorphism (SNP) Adaptation in the Human Genome A genome-wide scan for signatures of adaptive evolution using SNP data Single Nucleotide Polymorphism (SNP) A nucleotide difference at a given location in the genome Joanna

More information

CGS 5991 (2 Credits) Bioinformatics Tools

CGS 5991 (2 Credits) Bioinformatics Tools CAP 5991 (3 Credits) Introduction to Bioinformatics CGS 5991 (2 Credits) Bioinformatics Tools Giri Narasimhan 8/26/03 CAP/CGS 5991: Lecture 1 1 Course Schedules CAP 5991 (3 credit) will meet every Tue

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes

Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes 9 The Nucleus Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes Explain general structures of Nuclear Envelope, Nuclear Lamina, Nuclear Pore Complex Explain movement of proteins

More information

GENOME DUPLICATION AND GENE ANNOTATION: AN EXAMPLE FOR A REFERENCE PLANT SPECIES.

GENOME DUPLICATION AND GENE ANNOTATION: AN EXAMPLE FOR A REFERENCE PLANT SPECIES. GENOME DUPLICATION AND GENE ANNOTATION: AN EXAMPLE FOR A REFERENCE PLANT SPECIES. Alessandra Vigilante, Mara Sangiovanni, Chiara Colantuono, Luigi Frusciante and Maria Luisa Chiusano Dept. of Soil, Plant,

More information

Full file at CHAPTER 2 Genetics

Full file at   CHAPTER 2 Genetics CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces

More information

SUPPLEMENTARY MATERIAL SUPPLEMENTARY TABLES

SUPPLEMENTARY MATERIAL SUPPLEMENTARY TABLES SUPPLEMENTARY MATERIAL SUPPLEMENTARY TABLES Supplementary Table 1. Genomes available in Gramene build 38 Supplementary Table 2. Ontology associations in Gramene build 38 Supplementary Table 3. Synteny

More information

Comparative genomics. Lucy Skrabanek ICB, WMC 6 May 2008

Comparative genomics. Lucy Skrabanek ICB, WMC 6 May 2008 Comparative genomics Lucy Skrabanek ICB, WMC 6 May 2008 What does it encompass? Genome conservation transfer knowledge gained from model organisms to non-model organisms Genome evolution understand how

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature23897 Supplementary Notes 1 Evolution of gene families 1.1 Evolution of gene family sizes We determined the expansion and contraction of orthologous gene families using CAFÉ 2.2 1. One

More information

Genotyping By Sequencing (GBS) Method Overview

Genotyping By Sequencing (GBS) Method Overview enotyping By Sequencing (BS) Method Overview Sharon E Mitchell Institute for enomic Diversity Cornell University http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina sequencing

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information