Supplementary Materials for
|
|
|
- Conrad Kennedy
- 5 years ago
- Views:
Transcription
1 advances.sciencemag.org/cgi/content/full/4/5/eaar2740/dc1 Supplementary Materials for The fission yeast Stn1-Ten1 complex limits telomerase activity via its SUMO-interacting motif and promotes telomeres replication Samah Matmati, Mélina Vaurs, José M. Escandell, Laetitia Maestroni, Toru M. Nakamura, Miguel G. Ferreira, Vincent Géli, Stéphane Coulon This PDF file includes: Published 16 May 2018, Sci. Adv. 4, eaar2740 (2018) DOI: /sciadv.aar2740 table S1. Fission yeast strains used in this study. table S2. Plasmids used in this study. fig. S1. Comparison of Stn1-226 with other Stn1 mutants. fig. S2. Deletion of rif1 + and exo1 + restores viability of stn1-226 allele.
2 table S1. Fission yeast strains used in this study. Figure Strain no. Genotype Source 1D SC651 h + cdc25-22 ts S. Forsburg WT h - P. Russell SC h - stn1-226 This study 1E WT h - P. Russell YTC6733 (SC408) h - stn1::13myc-kanmx6 his3-d1 T. Nakamura SM1174 h - stn1-226::13myc-natmx6 This study 1F WT h - P. Russell TN7200 h - ten1::5flag-tev-avitag-kanmx6 his3-d1 Miyagawa et al., 2015 YTC6733 (SC408) h - stn1::13myc-kanmx6 his3-d1 T. Nakamura SM1174 h - stn1-226::13myc-natmx6 This study TN7503 (SC1131) h? ten1::5flag-tev-avitag-kanmx6 stn1::13myc-kanmx6 T. Nakamura SM1175 h? ten1::5flag-tev-avitag-kanmx6 stn1-226::13myc-natmx6 This study 2A SM1174 h - stn1-226::13myc-natmx6 This study SM1176 h? ten1::5flag-tev-avitag-kanmx6 stn1-226 This study SM1177 h? est1::v5-kanmx6 stn1-226 This study 2B-C TN12145 (SC1128) h - tpz1-k242r::hphmx6 his3-d1 ade-m210 Miyagawa et al., 2015 SM1178 h? tpz1-k242r::hphmx6 stn1-226 This study 3A-B WT h - P. Russell 3C-E SC838 h + rhp51δ::ura4 + P. Russell SM1179 h? rhp51δ::ura4 + stn1-226 This study 4 WT h - P. Russell 5 WT h - P. Russell 5A YO 001 (SC387) h + rpa1-d223y M. Ueno SM1267 h + rpa1-d223y stn1-226 This study 5B-C CF96 (SC388) h + taz1 ::ura4 + J. Cooper SM1268 h - taz1 ::ura4 + stn1-226 This study 5D TN3485 (SC381) h - rif1 ::ura4 + T. Nakamura SM1269 h? rif1 ::ura4 + stn1-226 This study BAF394 (SC1310) h + rif1-pp1 A. Bianchi MV1332 h? rif1-pp1 stn1-226 This study 5E TN3487 (SC392) h - rap1 ::ura4 + T. Nakamura SM1331 h? rap1 ::ura4 + stn1-226 This study 6A-E WT h - P. Russell SC1030 h + exo1 ::kanmx6 B. Arcangioli MV1309 h - exo1 ::kanmx6 stn1-226 This study All fission yeast strains are leu1-32 ura1-d18
3 table S2. Plasmids used in this study. Plasmid name Description Plasmid n psh18-34 pjg4-5 peg202 LexAop(x8)-LacZ, URA3, amp r acidic activator B42, TRP1, amp r, HA epitope tag LexA(1-202)DNA-BD, HIS3, amp r pjg4-5-sumo B42-Pmt3 This study, p207 pjg4-5-sumo-tpz1 B42-Pmt3-Tpz This study, p238 pjg4-5-tpz1 B42-Tpz1 This study, p194 pjg4-5-tpz1-k242r B42-Tpz1-K242R This study, p448 pjg4-5-ten1 B42-Ten1 This study, p167 pgad-ten1 B42-Ten1 B. Moser, p423 peg202-ten1stn1 LexA-Ten1Gly5Stn1 This study, p193 peg202-nstn1 LexA-NStn This study, p217 peg202-cstn1 LexA-CStn This study, p219 peg202-cstn1-195 LexA-CStn1-195 ( 195 AAYA 198 ) This study, p242 peg202-cstn1-226 LexA-CStn1-226 ( 226 AAAA 229 ) This study, p243 peg202-stn1 LexA-Stn1 This study, p162 peg202-stn1-226 LexA-Stn1-226 ( 226 AAAA 229 ) This study, p359 prep41-pol1 T. Wang, p379 pjk210-stn1 ura4, stn1+ This study, p323 pjk210-stn1-226 ura4, stn1-226 ( 226 AAAA 229 ) This study, p331 ptopo-stn1-myc stn1-13myc :KanMX6 This study, p348 ptopo-stn1-195-myc stn myc :KanMX6 This study, p382 ptopo-stn1-226-myc stn myc :KanMX6 This study, p383
4 fig. S1. Comparison of Stn1-226 with other Stn1 mutants. (A) Fission yeast Stn1 protein sequence: N-terminal domain (1-155) in grey and the C-terminal domain ( ), including the winged-helix-turn-helix domain (WH1, ) in blue and the WH2 domain ( ) are represented. The 177 IRQM, 195 IIYL and 226 ILAL that
5 are mutated in stn1-1, stn1-195 and stn1-226 alleles are underlined, respectively. (B) Interaction of Stn1 fragments with SUMO and SUMO-Tpz1 analyzed by Y2H. Y2H interaction was quantified by measurement of β-galactosidase activity. (C) Level of LexA fusion proteins used in this study (Anti LexA (N-19) antibody, Santa Cruz Biotechnology). (D) Tetrad dissections at 25 C of stn1+/ stn1-myc, stn1+/ stn myc and stn1+/ stn1-226-myc heterozygous diploid strains. Spore colonies with the indicated genotypes are shown. (E) Five-fold serial dilutions of the indicated cell cultures. (F) Telomere length analysis of the indicated spore colonies. ApaI-digested genomic DNA was analyzed by Southern blotting with a radiolabelled telomeric probe. fig. S2. Deletion of rif1 + and exo1 + restores viability of stn1-226 allele. (A, B) Analysis of viability of the indicated strains at different temperatures. Cells were grown at 25 C, then serially diluted and plated on YES rich medium supplemented by the indicated amounts of CPT, MMS and HU.
7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
2. Yeast two-hybrid system
2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates
EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring
Current Biology Supplemental Information Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Caroline Laplante, Julien Berro, Erdem Karatekin,
Optimization of Immunoblot Protocol for Use with a Yeast Strain Containing the CDC7 Gene Tagged with myc
OPTIMIZATION OF IMMUNOBLOT PROTOCOL 121 Optimization of Immunoblot Protocol for Use with a Yeast Strain Containing the CDC7 Gene Tagged with myc Jacqueline Bjornton and John Wheeler Faculty Sponsor: Anne
Heterozygous BMN lines
Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30
A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces cerevisiae.
Genetics: Published Articles Ahead of Print, published on July 30, 2012 as 10.1534/genetics.112.143818 A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces
Supplemental Table 1: Strains used in this study
Supplemental Table : Strains used in this study Name Parent Genotype Reference GA-8 MATa, ade-; can-; his3-,5; trp-; ura3-; leu-3, W33-A GA-3 GA-8 his3-,5::gfp-laci-his3, NUP49::GFP-NUP49-URA3 [] GA-46
Supplementary Information Genome architecture is a selectable trait that can be maintained by antagonistic pleiotropy
Supplementary Information Genome architecture is a selectable trait that can be maintained by antagonistic pleiotropy Ana Teresa Avelar, Lília Perfeito, Isabel Gordo and Miguel Godinho Ferreira 1 Supplementary
allosteric cis-acting DNA element coding strand dominant constitutive mutation coordinate regulation of genes denatured
A B C D E F G H I J K L M N O P Q R S T U V W X Y Z AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UU VV allosteric cis-acting DNA element coding strand codominant constitutive mutation coordinate
Which of these best predicts the outcome of the changes illustrated in the diagrams?
1. The diagrams below show two different scenarios for a pair of homologous chromosomes, known as a tetrad, undergoing a change where segments of DNA switch on parts of the chromosomes. In each scenario,
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
Analysis and modelling of protein interaction networks
Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment Karin Stibius Jensen Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment
cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work
SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)
Supplemental Information. Expanded Coverage of the 26S Proteasome. Conformational Landscape Reveals. Mechanisms of Peptidase Gating
Cell Reports, Volume 24 Supplemental Information Expanded Coverage of the 26S Proteasome Conformational Landscape Reveals Mechanisms of Peptidase Gating Markus R. Eisele, Randi G. Reed, Till Rudack, Andreas
Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures
Nature Methods Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures Yannick Doyon, Thuy D Vo, Matthew C Mendel, Shon G Greenberg, Jianbin Wang, Danny F Xia, Jeffrey
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/5/e1500358/dc1 Supplementary Materials for Transplantability of a circadian clock to a noncircadian organism Anna H. Chen, David Lubkowicz, Vivian Yeong,
Matrix and Steiner-triple-system smart pooling assays for high-performance transcription regulatory network mapping
Matrix and Steiner-triple-system smart pooling assays for high-performance transcription regulatory network mapping Vanessa Vermeirssen, Bart Deplancke, M Inmaculada Barrasa, John S Reece-Hoyes, H Efsun
Prof. Fahd M. Nasr. Lebanese university Faculty of sciences I Department of Natural Sciences.
Prof. Fahd M. Nasr Lebanese university Faculty of sciences I Department of Natural Sciences fnasr@ul.edu.lb B3206 Microbial Genetics Eukaryotic M. G. The yeast Saccharomyces cerevisiae as a genetic model
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Purification of yeast CKM. (a) Silver-stained SDS-PAGE analysis of CKM purified through a TAP-tag engineered into the Cdk8 C-terminus. (b) Kinase activity
P. syringae and E. coli
CHAPTER 6 A comparison of the recd mutant phenotypes of P. syringae and E. coli 6.1 INTRODUCTION The RecBCD complex is essential for recombination mediated repair of double strand breaks (DSBs) of DNA
downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6
A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight
Verification of the Principles of Genetics by Manipulating Saccharomyces Cerevisiae and Observing Meiotic Products ABSTRACT
November 27, 2002 Bio251 Dr. Calhoon Verification of the Principles of Genetics by Manipulating Saccharomyces Cerevisiae and Observing Meiotic Products ABSTRACT The experiment was conducted to verify the
Functional Characterization of the N Terminus of Sir3p
MOLECULAR AND CELLULAR BIOLOGY, Oct. 1998, p. 6110 6120 Vol. 18, No. 10 0270-7306/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Functional Characterization of the
Glc7/Protein Phosphatase 1 Regulatory Subunits Can Oppose the Ipl1/Aurora Protein Kinase by Redistributing Glc7
MOLECULAR AND CELLULAR BIOLOGY, Apr. 2006, p. 2648 2660 Vol. 26, No. 7 0270-7306/06/$08.00 0 doi:10.1128/mcb.26.7.2648 2660.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved.
Saccharomyces cerevisiae mutants that tolerate centromere plasmids
Proc. NatI. Acad. Sci. USA Vol. 84, pp. 7203-7207, October 1987 Genetics Saccharomyces cerevisiae mutants that tolerate centromere plasmids at high copy number (yeast centromeres/yeast transposons/g418
Protocol S1. Replicate Evolution Experiment
Protocol S Replicate Evolution Experiment 30 lines were initiated from the same ancestral stock (BMN, BMN, BM4N) and were evolved for 58 asexual generations using the same batch culture evolution methodology
SUMO Localizes to the Central Element of Synaptonemal Complex and Is Required for the Full Synapsis of Meiotic Chromosomes in Budding Yeast
SUMO Localizes to the Central Element of Synaptonemal Complex and Is Required for the Full Synapsis of Meiotic Chromosomes in Budding Yeast Karen Voelkel-Meiman 1., Louis F. Taylor 1., Pritam Mukherjee
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,
The geneticist s questions
The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does
Roles of a Fimbrin and an -Actinin-like Protein in Fission Yeast Cell Polarization and Cytokinesis
Molecular Biology of the Cell Vol. 12, 1061 1077, April 2001 Roles of a Fimbrin and an -Actinin-like Protein in Fission Yeast Cell Polarization and Cytokinesis Jian-Qiu Wu, Jürg Bähler,* and John R. Pringle
Eukaryotic Translation Initiation Factor 3 (eif3) and eif2 Can Promote mrna Binding to 40S Subunits Independently of eif4g in Yeast
MOLECULAR AND CELLULAR BIOLOGY, Feb. 2006, p. 1355 1372 Vol. 26, No. 4 0270-7306/06/$08.00 0 doi:10.1128/mcb.26.4.1355 1372.2006 Eukaryotic Translation Initiation Factor 3 (eif3) and eif2 Can Promote mrna
D The WD40 Protein Caf4p is a Component of the Mitochondrial Fission Machinery and Recruits Dnm1p to Mitochondria
153 D The WD4 Protein Caf4p is a Component of the Mitochondrial Fission Machinery and Recruits Dnm1p to Mitochondria This chapter represents a further example of the use of MudPIT to analyze the polypeptide
An Internal Domain of Exo70p Is Required for Actin-independent Localization and Mediates Assembly of Specific Exocyst Components
Molecular Biology of the Cell Vol. 20, 153 163, January 1, 2009 An Internal Domain of Exo70p Is Required for Actin-independent Localization and Mediates Assembly of Specific Exocyst Components Alex H.
The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia
From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
JBC Papers in Press. Published on June 21, 2002 as Manuscript M Kyung-Won Park, Kyung-Jin Kim, Andrew J. Howard,
JBC Papers in Press. Published on June 21, 2002 as Manuscript M203820200 Vitreoscilla Hemoglobin Binds to Subunit I of Cytochrome bo Ubiquinol Oxidases Kyung-Won Park, Kyung-Jin Kim, Andrew J. Howard,
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
The phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
When one gene is wild type and the other mutant:
Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10244 a O07391_MYCAV/127-243 NLPC_HAEIN/80-181 SPR_SHIFL/79-183 P74160_SYNY3/112-245 O24914_HELPY/301-437 Q51835_PORGI/68-178 DPP6_BACSH/163-263 YKFC_BACSU/185-292 YDHO_ECOLI/153-263
ESR1 Allele Frequency. PIK3CA Allele Frequency
Supplementary Figure 1 Distribution of mutant allele frequencies ESR1 Allele Frequency Median allele frequency 0.45% Inset graph 10 20 30 40 50 PIK3CA Allele Frequency Median allele frequency 3.6% Inset
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/5/e1602426/dc1 Supplementary Materials for In vivo mapping of tissue- and subcellular-specific proteomes in Caenorhabditis elegans The PDF file includes: Aaron
A thesis submitted in partial fulfillment of the requirements for the degree in Master of Science
Western University Scholarship@Western Electronic Thesis and Dissertation Repository August 2012 Phenotypic Analysis of Schizosaccharomyces Pombe Strains bearing Site-Directed Mutations in the Carboxy
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.1244624/dc1 Supplementary Materials for Cytoneme-Mediated Contact-Dependent Transport of the Drosophila Decapentaplegic Signaling Protein Sougata Roy, Hai Huang,
Cannibalism by Sporulating Bacteria
Cannibalism by Sporulating Bacteria José E. González-Pastor, Erret C. Hobbs, Richard Losick 2003. Science 301:510-513 Introduction Some bacteria form spores. Scientist are intrigued by them. Bacillus subtilis
Ebs1p, a Negative Regulator of Gene Expression Controlled by the Upf Proteins in the Yeast Saccharomyces cerevisiae
EUKARYOTIC CELL, Feb. 2006, p. 301 312 Vol. 5, No. 2 1535-9778/06/$08.00 0 doi:10.1128/ec.5.2.301 312.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Ebs1p, a Negative Regulator
Supplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
ACE2, CBK1, and BUD4 in Budding and Cell Separation
EUKARYOTIC CELL, June 2005, p. 1018 1028 Vol. 4, No. 6 1535-9778/05/$08.00 0 doi:10.1128/ec.4.6.1018 1028.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. ACE2, CBK1, and BUD4
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2362 Figure S1 CYLD and CASPASE 8 genes are co-regulated. Analysis of gene expression across 79 tissues was carried out as described previously [Ref: PMID: 18636086]. Briefly, microarray
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular iology of the Cell Figure S1 Krüger et al. Arabidopsis Plasmodium H. sapiens* 1) Xenopus* 1) Drosophila C.elegans S.cerevisae S.pombe L.major T.cruzi T.brucei DCP5 CITH
Analysis of Escherichia coli amino acid transporters
Ph.D thesis Analysis of Escherichia coli amino acid transporters Presented by Attila Szvetnik Supervisor: Dr. Miklós Kálmán Biology Ph.D School University of Szeged Bay Zoltán Foundation for Applied Research
Name: Period: EOC Review Part F Outline
Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences
Last time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
Investigation 7: Cell Division Part B: Meiosis and Crossing Over
Background Investigation 7: Cell Division Part B: Meiosis and Crossing Over Ascomycota are a diverse group of fungi including the familiar single-celled baker s yeast, the complex morel mushroom, and the
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11419 Supplementary Figure 1 Schematic representation of innate immune signaling pathways induced by intracellular Salmonella in cultured macrophages. a, During the infection Salmonella
Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor
Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,
JMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue
Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion
Rho1 binding site PtdIns(4,5)P2 binding site Both sites
localization Mutation site DMSO LatB WT F77A I115A I131A K134A Rho1 binding site PtdIns(4,5)P2 binding site Both sites E186A E199A N201A R84A-E186A-E199A L131A-K136A-E186A L131A-E186A-E199A K136A-E186A-E199A
Genetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR
Chapter 6 Microbial Growth With a focus on Bacteria
Chapter 6 Microbial Growth With a focus on Bacteria Temperature Minimum growth temperature Optimum growth temperature Maximum growth temperature Usually within a 30-40 degree range Microbial growth = increase
Regulation of Cell Polarity through Phosphorylation of Bni4 by Pho85 G1 Cyclin-dependent Kinases in Saccharomyces cerevisiae
Molecular Biology of the Cell Vol. 20, 3239 3250, July 15, 2009 Regulation of Cell Polarity through Phosphorylation of Bni4 by Pho85 G1 Cyclin-dependent Kinases in Saccharomyces cerevisiae Jian Zou,* Helena
NUCLEOCYTOPLASMIC transport is a process specific
Copyright Ó 2005 by the Genetics Society of America DOI: 10.1534/genetics.105.042598 The Fission Yeast Schizosaccharomyces pombe Has Two Importin-a Proteins, Imp1p and Cut15p, Which Have Common and Unique
FSA Notebook Mrs. Forman
FSA Notebook 2014-15 Mrs. Forman Page 1 Lab Safety 1. Your teacher is describing the rules of the lab, but you were finishing up your bellwork and forgot the safety rules. Your teacher might be mad if
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
7.06 Problem Set
7.06 Problem Set 5 -- 2006 1. In the first half of the course, we encountered many examples of proteins that entered the nucleus in response to the activation of a cell-signaling pathway. One example of
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle
Genome 371, Autumn 2018 Quiz Section 4 Molecular analysis of inheritance: An amphibian puzzle Goals: To illustrate how molecular tools can be used to track inheritance. In this particular example, we will
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI:.38/ncb2864 a b mad mad+- mad+- mad3+- mad3+- mad mad2+- mad2+- bub+- bub+- mph+-s(ggggs)3- mph+-s(ggggs)3- mad bub3+-s(ggggs)3-2x bub3+-s(ggggs)3-3x mad apc5+- apc5+- mad
Genetically Engineering Yeast to Understand Molecular Modes of Speciation
Genetically Engineering Yeast to Understand Molecular Modes of Speciation Mark Umbarger Biophysics 242 May 6, 2004 Abstract: An understanding of the molecular mechanisms of speciation (reproductive isolation)
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06072 SUPPLEMENTARY INFORMATION Molecular noise and size control: origins of variability in the budding yeast cell cycle. Stefano Di Talia 1,2, Jan M. Skotheim 2, James M. Bean 1,*,
3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed
3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed replication Initiation of Replication http://www.orst.edu/instruction/bb492/figletters/figh3.gif
Supporting Online Material
Supporting Online Material 1 Materials and Methods 1.1 Strains and Plasmids All plasmids used in this study were derived from a set of yeast single integration vectors which were gifts from N. Helman and
Multistep Phosphorelay Proteins Transmit Oxidative Stress Signals to the Fission Yeast Stress-activated Protein Kinase
Molecular Biology of the Cell Vol. 11, 1169 1181, April 2000 Multistep Phosphorelay Proteins Transmit Oxidative Stress Signals to the Fission Yeast Stress-activated Protein Kinase Aaron Ngocky Nguyen,
Direct detection of antibodies in blood plasma using bioluminescent
Supplementary information Direct detection of antibodies in blood plasma using bioluminescent sensor proteins and a smartphone. Remco Arts, Ilona den Hartog, Stefan Zijlema, Vito Thijssen, Stan van der
byr2, a Schizosaccharomyces pombe gene encoding a protein kinase capable of partial suppression of the ras1 mutant phenotype.
byr2, a Schizosaccharomyces pombe gene encoding a protein kinase capable of partial suppression of the ras1 mutant phenotype. Y Wang, H P Xu, M Riggs, L Rodgers and M Wigler Mol. Cell. Biol. 1991, 11(7):3554.
Three different fusions led to three basic ideas: 1) If one fuses a cell in mitosis with a cell in any other stage of the cell cycle, the chromosomes
Section Notes The cell division cycle presents an interesting system to study because growth and division must be carefully coordinated. For many cells it is important that it reaches the correct size
depends on the translocation assembly module nanomachine
ARTICLE NUMBER: 16064 DOI: 10.1038/NMICROBIOL.16.64 Effective assembly of fimbriae in Escherichia coli depends on the translocation assembly module nanomachine Christopher Stubenrauch 1, Matthew J. Belousoff
4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.
Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty
Heptad-Specific Phosphorylation of RNA Polymerase II CTD
olecular Cell Supplemental Information Heptad-Specific Phosphorylation of RNA Polymerase II CTD Roland Schüller, Ignasi Forné, Tobias Straub, Amelie Schreieck, Yves Texier, Nilay Shah, Tim-ichael Decker,
MEIOSIS is an essential step in the life cycle of sex- upon nitrogen starvation. Cells of opposite mating type
Copyright 2001 by the Genetics Society of America Characterization of rec7, an Early Meiotic Recombination Gene in Schizosaccharomyces pombe Monika Molnar,*,1 Sandro Parisi,*,1,2 Yoshito Kakihara, Hiroshi
Takamune T. Saito, Takahiro Tougan, Daisuke Okuzaki, Takashi Kasama and Hiroshi Nojima*
Research Article 447 Mcp6, a meiosis-specific coiled-coil protein of Schizosaccharomyces pombe, localizes to the spindle pole body and is required for horsetail movement and recombination Takamune T. Saito,
Production of recombinant proteins in microalgae at pilot greenhouse scale
Production of recombinant proteins in microalgae at pilot greenhouse scale Javier Gimpel University of California, San Diego Volvox carteri Algae Biomass Summit 2014 San Diego, CA 10/01/14 Expression of
Biological Networks. Gavin Conant 163B ASRC
Biological Networks Gavin Conant 163B ASRC conantg@missouri.edu 882-2931 Types of Network Regulatory Protein-interaction Metabolic Signaling Co-expressing General principle Relationship between genes Gene/protein/enzyme
UNIT IV - FOUNDATIONS OF GENETIC ENGINEERING. Cell Reproduction and Genetics. Study Questions. 1. What is mitosis? 2. What is meiosis?
UNIT IV - FOUNDATIONS OF GENETIC ENGINEERING Lesson 2: Cell Reproduction and Genetics Competency/Objective: Explain how cells reproduce. Study Questions References 1. What is mitosis? 2. What is meiosis?
Introduction and Objectives:
Introduction and Objectives: My research program asks why bacteria are naturally competent (able to take up DNA fragments from their surroundings). Answering this question will determine whether competence
Chapter 2: Chromosomes and cellular reproduction
Chapter 2: Chromosomes and cellular reproduction I. Contrast between prokaryotes and eukaryotes. See Figure 2.1 Nucleus absent Small diameter 1 to 10 µm Genome usually 1 circular molecule Small genome;
ACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC
SUPPLEMENTAL TABLE S1. Promoter and riboswitch sequences used in this study. Predicted transcriptional start sites are bolded and underlined. Riboswitch sequences were obtained from Topp et al., Appl Environ
Cover Page. The handle holds various files of this Leiden University dissertation
Cover Page The handle http://hdl.handle.net/1887/41480 holds various files of this Leiden University dissertation Author: Tleis, Mohamed Title: Image analysis for gene expression based phenotype characterization
Rif1 and Rif2 Shape Telomere Function and Architecture through Multivalent Rap1 Interactions
Rif1 and Rif2 Shape Telomere Function and Architecture through Multivalent Rap1 Interactions Tianlai Shi, 1 Richard D. Bunker, 1 Stefano Mattarocci, 2 Cyril Ribeyre, 2,4 Mahamadou Faty, 1 Heinz Gut, 1
Lecture 10: Cyclins, cyclin kinases and cell division
Chem*3560 Lecture 10: Cyclins, cyclin kinases and cell division The eukaryotic cell cycle Actively growing mammalian cells divide roughly every 24 hours, and follow a precise sequence of events know as
Topic 8 Mitosis & Meiosis Ch.12 & 13. The Eukaryotic Genome. The Eukaryotic Genome. The Eukaryotic Genome
Topic 8 Mitosis & Meiosis Ch.12 & 13 The Eukaryotic Genome pp. 244-245,268-269 Genome All of the genes in a cell. Eukaryotic cells contain their DNA in long linear pieces. In prokaryotic cells, there is
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09414 Supplementary Figure 1 FACS-isolated 8c hepatocytes are highly pure. a, Gating strategy for identifying hepatocyte populations based on DNA content. b, Detection of mchry and mchr9
Relationship between the function and the location of G1 cyclins in S. cerevisiae
RESEARCH ARTICLE 4599 Relationship between the function and the location of G1 cyclins in S. cerevisiae Nicholas P. Edgington and Bruce Futcher* Department of Molecular Genetics and Microbiology, Life
Behavior of DNA-lacking mitochondria in Entamoeba histolytica revealed by organelle transplant
9 10 11 Behavior of DNA-lacking mitochondria in Entamoeba histolytica revealed by organelle transplant Makoto Kazama 1 *, Sanae Ogiwara, Takashi Makiuchi 1, Kazuhiro Yoshida 1, Kumiko Nakada-Tsukui, Tomoyoshi
Dominance of Old End Growth is Inherited in Fission Yeast
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2015 Dominance of Old End Growth