Supplementary Information Genome architecture is a selectable trait that can be maintained by antagonistic pleiotropy

Transcription

1 Supplementary Information Genome architecture is a selectable trait that can be maintained by antagonistic pleiotropy Ana Teresa Avelar, Lília Perfeito, Isabel Gordo and Miguel Godinho Ferreira 1

2 Supplementary Figures Supplementary Figure S1: NotI restriction sites. (a) localization of NotI restriction sites in S. pombe L972 reference strain. Adapted from Garkavtsev and Mizukami 61. (b) PCR amplification and NotI restriction of the different known NotI restriction sites and a control PCR in natural isolates. 2

3 Supplementary Figure S2: Southern Blot analysis of WC-PFGE. Probe used is indicated in the lower left corner. 3

4 Supplementary Figure S3: Southern blots analysis of NotI-PFGE. Probe used is indicated in the lower left corner. 4

5 Supplementary Figure S4: Schematic representation of mating-type locus in S. pombe. PCR1 and PCR2 correspond to the sequences clones in order to disrupt the minimal 50bp of the homology region H1. Adapted from Benoit Arcangioli (Institut Pasteur, Paris). 5

6 Supplementary Figure S5: Representation of steps for the construction of engineered strains. Example for translocation T9 with breakpoints at locus lys3 + and lys4 +. 6

7 Supplementary Figure S6: Recombination between breakpoint loci. (a) Frequency of recombination between the two loci involved in rearrangements. Heterozygotic crosses with strains containing any of the CRs leads to the production of hybrids that contain in the breakpoints either one of the two parental combinations (parental or rearranged). Therefore, inversions and translocations cause total linkage between genes close to the breakpoint. Errors correspond to 2xSE for a Binomial Distribution. (b) Outcomes of meiotic recombination between breakpoints loci. 7

8 Supplementary Figure S7: Mitotic growth of wild-type L972 S. pombe in different environments. a,b,c, measurements are for lag (a) and exponential (b) phases and carrying capacity (c). Statistical comparisons were all made against growth in YES. (*** for P< 0.001, ** for P< 0.01 and * for P< 0.05 according to Mann-Whitney U test). Error bars represent 2xSE for n=8 independent experiments. 8

9 Supplementary Figure S8: Mitotic fitness of chromosomal rearrangements in different environments. The mitotic fitness in multiple environments of strains containing CRs. Averages were calculated from more than 10 independent experiments each with two independent clones. Statistical comparisons were all made between growth of the rearrangement and its parental ura4 + strain after competition against a control expressing GFP. Error bars represent 2xSE (*** for P< 0.001, ** for P< 0.01 and * for P< 0.05 according to Mann-Whitney U test). 9

10 Supplementary Figure S9: Experimental data from antagonistic pleiotropy. Frequency of T4 and T10 in competition with their GFP marked control. Each line represents an independent replicate experiment starting from the same initial mix. The black lines show the lines that evolved asexually while the grey bars show the lines where mating was induced. Further details can be found in the supplementary methods. (a) Frequency of T4 in competition with its Control-GFP in YES. (b) Frequency of T4 in competition with its Control-GFP in YES with 3% ethanol. (c) Frequency of T10 in competition with its Control-GFP in YES. 10

11 Supplementary Figure S10: Model predictions for the fixation or maintenance of CRs. The figure shows nine examples of the predicted evolution of parental and CR strains based on the simple model of antagonistic pleiotropy described in the supplementary text. In all panels, one meiotic cycle (change in frequency given by f s ) is introduced every 5 mitotic generations (change in frequency given by f s per generation). The values of s and d used are the ones show in the figure. Depending on the combination of these effects, there can be maintenance, loss or fixation of the rearrangement. 11

12 Supplementary Figure S11: mrna levels for genes involved in stress and ethanol consumption. (a) Parental and translocation T5. (b) Parental and translocation T7. mrna was extracted from exponentially growing cultures without (T0) and with 15 and 30 minutes (T15 and T30) exposure to 3%EtOH. Error bars represent S.E. (* for P< 0.05, ** for P< 0.01 according to Mann-Whitney U test). 12

13 Supplementary Tables Supplementary Table S1: Natural isolate strains. Strain name Origin Geographical location L972 Grape Juice Europe ATCC 2456 Rum Europe NCYC132 African Millet Beer Africa UFMG-A571 Must of Brazilian cachaça Brazil UFMG-826 Must of Brazilian cachaça Brazil UFMG-1153 Must of Brazilian cachaça Brazil UFMG-1263 Must of Brazilian cachaça Brazil UFMG-R418 Frozen pulp of Eugenic uniflore ( pitanga, Brazil UFMG-R435 Frozen pulp of Eugenic uniflore ( pitanga, Brazil UFMG-SPW23 Frozen pulp of Eugenic uniflore ( pitanga, Myrtaceae) Brazil 13

14 Supplementary Table S2: Strains used in this study. Strain name Genotype Common name Creator NCYC132 h90::mat1-m-natmx6 NCYC-M NCYC132 h90::mat1-p-natmx6 NCYC-P R435 h90::mat1-m-natmx6 R435-M R435 h90::mat1-p-natmx6 R435-P SPW23 h90::mat1-m-natmx6 SPW23-M SPW23 h90::mat1-p-natmx6 SPW23-M ATCC2476 h90::mat1-m-natmx6 ATCC2476-M ATCC2476 h90::mat1-p-natmx6 ATCC2476-P L972 h90::mat1-m-natmx6 L972-M L972 h90::mat1-p-natmx6 L972-P A826 h90::mat1-m-natmx6 A826-M A826 h90::mat1-p-natmx6 A826-P 14

15 A1153 h90::mat1-m-natmx6 A1153-M A1153 h90::mat1-p-natmx6 A1153-P 852 A1263 h90::mat1-m-natmx6 A1263-M 853 A1263 h90::mat1-p-natmx6 A1263-P 527 h- leu1-32 ura4-d18 ade6-m210 NK 118 N. Kleckner 2097 h- arg1::padh1-loxp-kanmx6 leu1-32 ura4-d18 ade6-m 216 NK 5AU/2 N. Kleckner 529 h- lys3::padh1-loxp-kanmx6 his1::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 1A2U (111) N. Kleckner 530 h- arg7::padh1-loxp-kanmx6 lys4::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m216 NK 3A4U (113) N. Kleckner 533 h- lys3::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 1U/2 (134) N. Kleckner 534 h- lys3::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m216 NK 1U/2 (146) N. Kleckner MHG 535 h his1::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 2U/1 (140) N. Kleckner 537 h- arg7::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 3U/1 (141) N. Kleckner 538 h- arg7::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m216 NK 3U/2 (125) N. Kleckner 539 h- his1::padh1-loxp-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 2A/1 (122) N. Kleckner 15

16 540 h- his1::padh1-loxp-kanmx6 leu1-32 ura4-d18 ade6-m216 NK 2 A/2 (158) N. Kleckner 541 h- lys4::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 4U/1 (147) N. Kleckner 542 h- lys4::loxp-ura4-kanmx6 leu1-32 ura4-d18 ade6-m216 NK 4U/2 (148) N. Kleckner 544 h- arg7::padh1-loxp-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 3A/1 (162) N. Kleckner 546 h- lys4::padh1-loxp-kanmx6 leu1-32 ura4-d18 ade6-m210 NK 4A/1 (161) N. Kleckner 2079 h- arg1::padh1-loxp-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m 216 NK 5AU/2-M 2080 h+ arg1::padh1-loxp-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m 216 NK 5AU/2-P 2081 h- arg7::loxp-ura4-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m210 NK 141-M 2082 h+ arg7::loxp-ura4-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m210 NK 141-P 2083 h- lys3::loxp-ura4-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m210 NK 134-M 2084 h+ lys3::loxp-ura4-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m210 NK 134-P 2085 h- lys3::loxp-ura4-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m216 NK 146-M 2086 h+ lys3::loxp-ura4-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m216 NK 146-P 2087 h- his1::loxp-ura4-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m210 NK 140-M 16

17 2088 h- his1::loxp-ura4-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m210 NK 140-P 2089 h- lys4::padh1-loxp-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m210 NK 161-M 2090 h+ lys4::padh1-loxp-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m210 NK 161-P 2091 h-arg7::padh1-loxp-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m210 NK 162-M 2092 h- arg7::padh1-loxp-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m210 NK 162-P 2093 h- his1::padh1-loxp-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m216 NK 158-M 2094 h- his1::padh1-loxp-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m216 NK 158-P 2095 h- lys4::loxp-ura4-kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m210 NK 147-M 2096 h- lys4::loxp-ura4-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m210 NK 147-P 1497 h- ade6-m210 mat1-m::mat1-m-natmx6 leu1-32 NK 118-M 1498 h+ ade6-m210 mat1-p::mat1-p-natmx6 leu1-32 NK 118-P 1495 h- his1::padh1-loxp-kanmx6 lys3::loxp-ura4-kanmx6 mat1- M::mat1-M-natMX6 leu1-32 ura4-d18 ade6-m210 Parental h+ his1::padh1-loxp-kanmx6 lys3::loxp-ura4-kanmx6 mat1- P::mat1-P-natMX6 leu1-32 ura4-d18 ade6-m210 Parental h- lys3::padh1-loxp- kanmx6r his1::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 Control 1 (Parental ura4 + ) 17

18 1521 h+ his1::padh1-loxp-kanmx6r lys3::loxp-ura4- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m210 his1- gfp-hphmx6r Parental 1- GFP 1720 h- lys3::padh1-loxp-kanmx6 his1::loxp-ura4-kanmx6 mat1- M::mat1-M-natMX6 leu1-32 ade6-m210 Control 1-GFP 1122 h- his1::loxp- kanmx6r lys3::padh1-loxp-ura4+ - kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 Inv h+ his1::loxp- kanmx6r lys3::padh1-loxp-ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 Inv h- arg7::padh1-loxp-kanmx6 lys4:: loxp-ura4-kanmx6 mat1- M::mat1-M-natMX6 leu1-32 ura4-d18 ade6-m216 Parental h+ arg7::padh1-loxp-kanmx6 lys4:: loxp-ura4-kanmx6 mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m216 Parental h- arg7::padh1-loxp- kanmx6r lys4::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m216 ura4+ Control 2 (Parental ura4 + ) 1318 h- arg7::padh1-loxp- kanmx6r lys4:: loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m216 ura4-d18 lys4- GFP-hphMX6R Parental 2- GFP 1513 h- arg7::padh1-loxp- kanmx6r lys4::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 lys4-gfphphmx6r Control 2- GFP 824/149 2 h- arg7::loxp- kanmx6r lys4:: padh1-loxp- ura4+ - kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m216 ura4-d18 Inv h+ arg7::loxp- kanmx6r lys4:: padh1-loxp- ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m216 ura4- D18 Inv h- lys3::loxp-ura4- kanmx6r arg7::padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 Parental 3 (Parental ura4 + ) 1745 h+ lys3::loxp-ura4- kanmx6r arg7::padh1-loxp- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 Parental h- lys3::loxp-ura4- kanmx6r arg7:: padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 Control 3 18

19 1485 h- lys3::loxp-ura4- kanmx6r arg7:: padh1-loxp- kanmx6r leu1-32 ade6-m216 ura4-d18 matm- natmx6r lys3-gfphphmx6r Parental 3- GFP 1505 h- lys3::loxp-ura4- kanmx6r arg7:: padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ lys3-gfphphmx6r Control 3-GFP 1138 h+ arg7:: loxp- kanmx6r lys3::padh1-loxp- ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m216 ura4- D18 T h- arg7:: loxp- kanmx6r lys3::padh1-loxp- ura4+ - kanmx6r ade6-m210 leu1-32 mat1-m::mat1-m-natmx6 ura4-d18 T h- arg1::padh1-loxp- kanmx6r lys4::loxp-ura4- kanmx6r leu1-32 ade6-m210 ura4-d18 Parental h+ arg1::padh1-loxp- kanmx6r lys4::loxp-ura4- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 Parental h- arg1::padh1-loxp- kanmx6r lys4::loxp-ura4-k kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 Control 4 (Parental ura4 + ) 1581 h- arg1::padh1-loxp-k kanmx6r lys4::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm- natmx6r lys4-gfp- hphmx6r Parental 4- GFP 1633 h- arg1::padh1-loxp- kanmx6r lys4::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r lys4-gfp- hphmx6r Control 4-GFP 1099 h- arg1::loxp- kanmx6r lys4::padh1-loxp- ura4+ - kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm- natmx6r T h+ arg1::loxp- kanmx6r lys4::padh1-loxp- ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4- D18 matm- natmx6r T h- his1::padh1-loxp- kanmx6r lys4::loxp-ura4-k kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm- natmx6r Parental h+ his1::padh1-loxp- kanmx6r lys4::loxp-ura4-k kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 matmnatmx6r Parental 5 MF 1279 h- his1::loxp- kanmx6r lys4::padh1-loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matm Control 5 (Parental ura4 + ) 19

20 1489 h- his1::padh1-loxp- kanmx6r lys4::loxp-ura4- kanmx6r leu1-32 ade6-m210 ura4-d18 matm- natmx6r lys4-gfphphmx6r Parental 5- GFP 1582 h-his1::padh1-loxp- kanmx6r lys4::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r lys4-gfp- hphmx6r #5 Control 5-GFP 1089 h- his1::loxp- kanmx6r lys4::padh1-loxp- ura4+ - kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm T h+ his1::loxp- kanmx6r lys4::padh1-loxp- ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 T h- arg7::loxp-ura4- kanmx6r his1::padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ura4-d18 ade6-m210 matm- natmx6r Parental h+ arg7::loxp-ura4- kanmx6r his1::padh1-loxp- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ura4-d18 ade6-m216 matmnatmx6r Parental h- arg7::loxp-ura4- kanmx6r his1::padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r Control 6 (Parental ura4 + ) 1551 h+ arg7::loxp-ura4- kanmx6r his1::padh1-loxp- kanmx6r leu1-32 ura4-d18 ade6-m216 matm- natmx6r his1-gfphphmx6r Parental 6- GFP 1574 h- arg7::loxp-ura4- kanmx6r his1::padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r his1-gfp- hphmx6r #7 Control 6-GFP 1164/17 94 h- his1::loxp- kanmx6r arg7::padh1-loxp- ura4+ - kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm- natmx6r T h+ his1::loxp- kanmx6r arg7::padh1-loxp- ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m216 ura4- D18 matp- natmx6r T h- arg1::padh1-loxp- kanmx6r lys3::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm- natmx6r Parental h+ arg1::padh1-loxp- kanmx6r lys3::loxp-ura4- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 matmnatmx6r Parental h- arg1::padh1-loxp- kanmx6r lys3::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r Control 7 (Parental ura4 + ) 20

21 1522 h- arg1::padh1-loxp- kanmx6r lys3::loxp-ura4- kanmx6 mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm-natmx6r lys3-gfp- hphmx6r Parental 7- GFP 1736 h- arg1::padh1-loxp- kanmx6r lys3::loxp-ura4- kanmx6r 6 mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r lys3-gfp- hphmx6r Control 7-GFP 1795 h- arg1::padh1-loxp- kanmx6r lys3::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r T h+ arg1::padh1-loxp- kanmx6r lys3::loxp-ura4- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r T h- arg1::padh1-loxp- kanmx6r arg7::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm-natmx6r Parental h+ arg1::padh1-loxp- kanmx6r arg7::loxp-ura4- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 matmnatmx6r Parental h- arg1::padh1-loxp- kanmx6r arg7::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r Control 8 (Parental ura4 + ) 1549 h- arg1::padh1-loxp-kanmx6 arg7::loxp-ura4-kanmx6 mat1- M::mat1-M-natMX6 leu1-32 ade6-m210 ura4-d18 matmnatmx6r arg7-gfp- hphmx6r Parental 8- GFP 1576 h- arg1::padh1-loxp- kanmx6r arg7::loxp-ura4- kanmx6r leu1-32 ade6-m210 arg7-gfp- hphmx6r Control 8-GFP 1058 h- arg1:: loxp- kanmx6r arg7:: padh1-loxp- ura4+ - kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 T h+ arg1:: loxp- kanmx6r arg7:: padh1-loxp- ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4- D18 T h- lys3::loxp-ura4- kanmx6r lys4:: padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m216 ura4-d18 matm- natmx6r Parental h+ lys3::loxp-ura4- kanmx6r lys4:: padh1-loxp- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m216 ura4-d18 matpnatmx6r Parental h+ lys3::loxp-ura4-k kanmx6r lys4:: padh1-loxp- kanmx6r leu1-32 ade6-m216 Control 9 (Parental ura4 + ) 21

22 1487 h- lys3::loxp-ura4- kanmx6r lys4:: padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m216 ura4-d18 matp- natmx6r lys4- gfp -hmx6r Parental 9- GFP 1507 h+ lys3::loxp-ura4- kanmx6r 6 lys4:: padh1-loxp- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m216 lys4-gfphphmx6 Control 9-GFP 1137 h- lys4:: loxp- kanmx6r lys3::padh1-loxp- ura4+ - kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m216 ura4-d18 T h+ lys4:: loxp- kanmx6r lys3::padh1-loxp- ura4+ - kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m216 ura4- D18 h- arg1::padh1-loxp- kanmx6r his1::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 matm- natmx6r h+ arg1::padh1-loxp- kanmx6r his1::loxp-ura4- kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 matmnatmx6r h- arg1::padh1-loxp- kanmx6r his1::loxp-ura4- kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r h- arg1::padh1-loxp- kanmx6r his1::loxp-ura4-kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 his1- gfp- hphmx6r h- arg1::padh1-loxp- kanmx6r his1::loxp-ura4-kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4+ matmnatmx6r #3 T9 Parental 10 Parental 10 Control 10 (Parental ura4 + ) Parental 10- GFP Control 10-GFP 1797 h- arg1::loxp- KanMX6R his1::padh1-loxp-ura4-kanmx6r mat1-m::mat1-m-natmx6 leu1-32 ade6-m210 ura4-d18 T h+ arg1::loxp- KanMX6R his1::padh1-loxp-ura4-kanmx6r mat1-p::mat1-p-natmx6 leu1-32 ade6-m210 ura4-d18 T10 22

23 Supplementary Table S3: Primers used in this study. primer name sequence forw ccgggacatttatttacagc rev taggtgattacatgaaagcg forw aaagcaacgtgcaatctccg rev gggttattttaagggcgagc forw tcaaacggcatagtgaatcc rev gatacaagataatctgcagc forw taacaaatgagacaaggagg rev taacgaggattagtgcatcg forw cggtaatatttcaggtatgc rev ttcagattggcagttactgc forw tgtgtgaattttgtgtgtcg rev gcatcacttagtagatgtgc forw agctttgtcacaggataagg rev atctctgcttcctttgttgg f probe forw f probe rev gcttcttcaatggcctttcg tcggaaagtttacggacacg chrii rev cactggatatcgtgttttcc chrii forw acataccgtttctacttcgc chrii forw ctgtgtactttacgacatcg chrii rev ttgcaaggagaagtttcacc chrii forw tgtgtcgctacaaattctcg chrii rev ctgtttggaattctctgtcc chrii fow acaattgtgccggaagtagc 23

24 chrii rev acgcttgctgttcttcttcc chrii forw gtgattgtaccaaagaagcg chrii rev tatgccaacagtatcttggc imr1l rev imr1l forw imr2l rev imr2l forw imr3l rev imr3l forw lig4 screen f lig4 screen rev mcr forw mcr rev rad forw aagtattaagttttaatgcc gaaagtatacttagattttcg agacacaagcattgttctcg tcacatggtcgataatttcc ctttgataactgaacagcgg tgaaatcgtatatgactgcg gcgagtactaacatattagg aaatggtgctgtaagttgcc ggtagcatcaaagttgtccc gccttgtccttcacttttcc ggatggcaacttatacccat 3 utr rad3 r ko cggatgatgactcagaaaca rad32 screen f rad32 screen rev aataagcgacgagaattacc agtggagtacgttacatcgc 5 mad2 f251 cccaaactgacattattacg mad2 r 556 taz1 seq1620 top taz1 3 r e probe start forw e probe start rev acttcgctgtctttatcagc cgttcgggtacacgcagg gatggcatatgtataaagac ttcatcatcgccgtattccg tggtgctataagggtttgcg chri forw acgatcacgatcaacttagc chri rev tctcgccaattcaagagacc 24

25 forw chri gaggaattagatgtggaggg rev chri ctaggtcgcaactatactcg forw chri ttgcgtatgccattcaatcg rev chri agatatggcttggactcacc 1matm 602 f 1matm 1175 f 1matm 1651 forw 1matp 539 frow 1matp 1124 forw 1matp 1625 forw pcr1 mat1-m forw pcr1 mat1-m rev pcr1 mat-p forw pcr1 mat-p rev pcr2 mat1-m forw pcr2 mat1-m rev pcr2 mat1-p forw mat locus end rev mati-m 98 r mati-m 1065 f mm mp mt1 ptopo +200 r ptopo -200 f cccaatttactgaaccctgc cggaaagacactacgtctac gccatactgttttagaggg gggtaggaacaaagaaagag gcgtattatggcttggtgta ggcttttgttgcactatgac cccaagctttagacgggaattctttaggg gaagatctggagaaagactatacattta cccaagcttgtttattctatgactacagg gaagatctagaaaacaaaggagaaagac gggtttaaacagatatttgcttcgctacgc gcgatatcagacagttaaaattggcggg gggtttaaacccctctaacgagatatttgc tgtgaatggagttggagagg aatatgtcagcagaagacc ttactgccctgattctatcg tacttcagtagacgtagtg acggtagtcatcggtcttcc agaagagagagtagttgaag ctcactatagggcgaattgg gagttagctcactcattagg 25

26 arg7-200 forw arg1-200 forw his1-100 forw lys3-200 forw lys4-200 forw 3 utr adh1 f kanmx 880r ura 671 rev pfa6a rev arg7 locus integr 80mer forw arg7 locus integr 80mer rev his1 locus integr 80mer forw his1 locus integr 80mer rev lys3 locus integr 80mer forw lys3 locus integr 80mer rev lys4 locus integr 80mer forw lys4 locus integr 80mer rev. pfa6 rev his forw his rev lys forw lys rev lys forw lys rev arg forw ttgagtacttgctatccacg tgcaactgaacatacgatgg gactgctttttcgacattgg agtttttggtctccttcgcc atacatacgtgcatccttgc cttcaatttctctactccgc cgcatcaaccaaaccgttat aatgatgatatcgctaccgc gactcactatagggagaccg gtggtgctaaaagcaaatataaaaaatggtgtatgatat tttcct aattaagttactaaaaatctaattgcataaaatcagaattc atttttaattatatttcatttccaaacgtgtctctctgcattgt tttgcaa aatcatttattcacaacatcgaaaaaatgatattaccctgt agctgacctgctttaatatttatcgtcagttaaagtgtcga acgactg caacgaaaactgaattagtaaggaaaaaaagagaatt tttgcattcgatcttcgaacgttgatgtaaagagaccggt ttatcctct aattttaattatatttaaatatataaaagtgatattaccctgt atatatttgactaatttaaatatgataatatacacatttctct gcaaacctcc tttatacttttcgccggtcattgattagaattcgagctcgtt atattggggaaagtttcaagatttatatttaccatataggt aagtggcaa atgcaggatgaaatcctgtttcttaattatatattaccctgt tttttattctattaaaataaaatattttaatttgaaaatttatat tag cacgctcaaggaattacttccttgctacttcgaattcgag ggggtttaaattattttttacaaaaggtaataataggtttg aaa aattatataaaaatacgcattaactttacataaaatatatta gactcactatagggagaccg agaaaaagccgctttgatcc attgagagtgccatctgagc cctgcttcaagccttattgc atcaagaaatcgctcgtgcc ttagacggcattttcgatgc aagcctttccattatcttgg gtaaaatgggttcttcatgc 26

27 arg rev t tef forw t tef forw new version hph rev act1 forw act1rev adh1 forw adh1 rev adh4 forw adh4 rev atf1 forw atf1rev bit61 forw bit61 rev ctt1 forw ctt1 rev cut7 forw cut7 rev dak1 forw dak1 rev dak2 forw dak2 rev ght5 forw ght5 rev hsp9 forw ggtatgcatacaatcaacat tgtcgattcgatactaacgc gcgttagtatcgaatcgaca tgatacacatggggatcagc cggtattgtcaacaactggg agtcatcttctcacggttgg actcttcttgcggtaactgc tggcaatgcagtagtgttgg tcaattggtggtggttctgc caagggaagttgaggtttgg gggtcgcaacaatttaacgg ccattctcggcattttgtcc taacctggttcccatatccg aatagtgcaaagcctcaccc acaaatgaagaagccgctgc ctcgaaagcacttcttcagg ttggtcacgaagacgtatgc ttaccggttccagtttgtcc ctggcaccttggtaatttgc tgatacgtcatctgcaacgg agcttcattggatcactgcg atttgaaggttccaggctcg ttctttggtcgtcgtatgcc acacaatcataacggcaccg atgtctgatcccgcaagaaagtc 27

28 hsp9 rev hxk2 forw hxk2 rev mrpl16 forw mrpl16 rev ntp1 forw ntp1 rev pcr1 forw pcr1 rev pka1 forw pka1 rev pyr1 forw pyr1 rev rec10 forw rec10 rev rrp12 forw rrp12 rev spac2f7.02c forw spac2f7.02c rev spac9e9.09c forw spac9e9.09c rev spac13a11.06 forw spac13a11.06 rev spac22a12.16 forw spac22a12.16 rev cgtaggcaccagtaatggattcc accttcctatgggtttcacc gcaaagtccttgttgatggc tggggagaatatggtatgcg tacgcatactggcacattgc gcaaaggattatggacgtcg ttcttcgagtaagggcatcc tcaacatatggcttaccggc tgttgatttggagggagacc gcaagtgcccattctgttgg gcgaatgtctttgatggctg caaggcttaatgggtcaacc gcagcaggaaggaatttacc caatgcggaaactgtcaagc cgttctgtaaaatgccctcg cgacgagtttcatcttttgcc caactcaaaagccatagcacgc tggagtcagcaattagtccc ggttctgttggttgttcacc tgttcctgaatgtggcttcc aggccaccttatcaatgtcc gtattccttctgatgctggc acttcttgctcaactgctgg ggtgcctcagttgtttatgc taagtttggccgtcagtagg 28

29 spac227.17c forw spac227.17c rev spac922.07c forw spac922.07c rev spbc c forw spbc c rev spcc777.12c forw spcc777.12c rev tdh1 forw tdh1 rev tps1 forw tps1 rev zwf1 forw zwf1 rev cacttttggtcagtatgcgg ttcgacttggttgacagacacc gactatgcggtgaaatctgc cagctaaagtatccgcatgc ggtgtcacaactggatttgg atgattctcgaagcaccagc tttctcctcaggttcttccc caagtgcctttccaaagacc ttccgttgttgacttgaccg cggtcaagtcaacaacggaa tgacctttcaatggttgggc ccaaaaagacgggaatagcg caaagagcctattggtacgg ggtttccatggtcaaaaggg 29

30 Supplementary Table S4: Genes for qrt-pcr. Gene Function Chromosomal location act1 actin II: adh1 alcohol dehydrogenase III: adh4 alcohol dehydrogenase 4 I: atf1 transcription factor, Atf-CREB family II: bit61 TORC2 subunit III: cgs1 camp-dependent protein kinase regulatory I: ctt1 (=cta1) catalase subunit III: cut7 nesin-like protein I: dak1 dihydroxyacetone kinase I: dak2 dihydroxyacetone kinase I: ght5 hexose transporter III: hsp9 heat shock protein 9 I: hxk2 hexokinase 2 I: mrpl16 mitochondrial ribosomal protein subunit L16 II: ntp1 neutral trehalase II : pcr1 (= mts2) transcription factor I : pka1 camp-dependent protein kinase catalytic II: pyr 1 pyruvate subunit carboxylase II: rec10 meiotic recombination protein Rec10 I: rrp12 rrna processing protein II: spac13a11.06 pyruvate decarboxylase I: spbc c glutathione-dependent formaldehyde dehydrogenase II:

31 spac22a12.16 ATP-citrate synthase subunit 2 I: spac2f7.02c NLI interacting factor family phosphatase I: spac227.17c conserved protein I: spac922.07c aldehyde dehydrogenase I: spac9e9.09c aldehyde dehydrogenase I: spcc777.12c thioredoxin family protein III: tps1 alpha,alpha-trehalose-phosphate synthase I : zwf1 glucose [UDP-forming] 6-phosphate 1-dehydrogenase I:

32 Supplementary Notes Supplementary Note 1: Theoretical predictions for the fixation or maintenance of CRs. In rich nutrient conditions, fission yeast cells are generally haploid and propagate asexually through mitotic divisions. Upon nitrogen starvation and in the presence of cells of the opposite mating type, these haploids can undergo karyogamy generating a short-lived diploid zygote that quickly undergoes meiosis. This process generates four haploid spores, which in rich nutrient conditions can restart the mitotic cycle. If the asexual cycle is predominant, we expect that most CRs will either sweep to fixation or become extinct. The time for this to happen depends on the strength of selection acting on the CR strain (s) and on the population size (N). For an effectively neutral genotype (Ns 1), we expect fixation or loss to happen about N generations after the first appearance of the CR. For a genotype under natural selection, fixation or loss are much faster, around 1/s generations. For a rearrangement with s>0 in mitosis, mating can prevent its fixation and maintain a polymorphism if the meiotic cost matches the mitotic advantage. In order to quantify the conditions under which maintenance is likely to occur, we have modeled this simple process. We assume there is a CR and a parental strain in the population, which can evolve through asexual and sexual reproduction. The change in frequency of a rearrangement ( f a ) over 1 mitotic generation (t) is. (S1) The frequency of the CR after one sexual generation (m) will depend on the probability of mating with the parental and on the meiotic cost of that mating. Assuming that both parental and CR populations have the two mating types at equal frequency (as in the case of h90 strains), the probability of a heterozygous cross is given by f x (1-f), where f is the frequency of the rearrangement after mitosis. If we define the cost of mating (d) as the fraction of spores from a heterozygous cross that fail to germinate, then, the frequency of the rearrangement after 1 meiotic generation is given by and the change in frequency over one meiotic generation ( f s ) is (S2) (S3) The change in frequency over one round of mating depends strongly on the frequency of the CR strain in the population. A negative f s means that the CR pays a cost and it happens when most of 32

33 the rearranged cells mate with the parental, i.e., when f < 0.5. At f > 0.5, the rearranged strain is expected to increase in frequency after mating and the parental to pay the cost. The rearrangement can be maintained when f a x t f s x m, which depends on the strength of selection acting on the rearrangement (s), on its frequency (f) and on the cost of a heterozygous cross (d). In Supplementary Fig. S10, we show a few examples of the expected temporal dynamics of genomic rearrangements under these simple conditions. 33

34 Supplementary Reference 61. Garkavtsev, I. & Mizukami, T. Integrated map of the Schizosaccharomyces pombe genome. Chromosoma 106, (1997). 34