TRANSCRIPTIONAL CHANGES OF BFRUCT3, NHX1, OMT AND PEAMT GENES IN ROOT OF BARLEY (HORDEUM VULGARE L.) UNDER SALINITY STRESS
|
|
- Maude Houston
- 6 years ago
- Views:
Transcription
1 Pk. J. Bot., (): 73-7, 1. TRANSCRIPTIONAL CHANGES OF, NHX1, AND GENES IN ROOT OF BARLEY (HORDEUM VULGARE L.) UNDER SALINITY STRESS ROGHAYEH GHORBANI 1, SEYYED ABOLGHASEM MOHAMMADI 1,*, MAHMOOD TOORCHI 1 AND SARA GHAFARIAN 3 1 Dprtmnt of Plnt Bring & Biothnology, Fulty of Agriultur, Univrsity of Triz, Triz 1, Irn Cntr of Exlln in Crl Molulr Bring, Univrsity of Triz, Triz 1, Irn 3 Dprtmnt of Cllulr n Molulr Biology, Fulty of Sins, Azrijn Shhi Mni Univrsity, Triz, Irn * Corrsponing uthor s mil: mohmmi@trizu..ir Astrt Th xprssion hngs of,, NHX1, gns in root of rly gnotyps; (snsitiv), Shr3771 (tolrnt) n n Irnin vn lin (tolrnt) wr vlut unr, 1 n mm NCl t hours, 3 ys n 3 wks ftr slt trtmnt. of th gns ws nlyz using Rl-Tim PCR Bs on -ΔΔCT t otining from th omprison of iffrnt slinity trtmnts. Anlysis of trnsript lvl of gn rvl uprgultion of this gn in th slt tolrnt gnotyps with prolonging of slt trtmnt urtion n inrs of slinity lvl from 1 to mm NCl. Whrs, gn show up-rgultion in ll th thr gnotyps with inrs of slinity lvl t th rlir stg of slt trtmnt. With inrs of slt lvl to mm NCl, gn show up-rgultion in th vn lin t th rly tim points (h n 3 ys) n in th Shr3771 t th lt tim point (3 wks) ut in xprssion of this gn ws own-rgult. Ky wors: Brly, Gn xprssion, Slinity, Slt rsponsiv gns. Introution Slt strss is on of th most srious limiting ftors for rop growth n proution in th ri rgions. Slinity rus plnt yil y isrupting th vitl funtions of th ll through limiting of wtr sorption n sorption of xss slt (Lopol & Willing, 19). Unr ths onitions, plnts mintin osmoti prssur n ioni ln y th sorption, trnsporttion n istriution of wtr n solutions (Johnson t l., 1; Vrouq t l., ). Slt strss uss mtoli isorrs in plnt lls, whih l to xssiv proution of rtiv oxygn spis (ROS) using progrssiv oxitiv mg suh s lipi oxition, protin strutur hngs, nzym intivtion, loss of pigmnts suh s hlorophyll n ultimtly ll th (Mittlr, ). Plnts vry in trms of tolrn or snsitivity to slinity. Inrsing plnt tolrn to slinity n sltion of suitl gnotyps for plnting in slin rs hs grt griulturl n onomi signifin (Kingsury t l., 19). Brly (Horum vulgr L.) is on of th most tolrnt rls to rought n slinity (Crlli, 197). Th mhnism of slt tolrn in rly, lik most of th plnts, inlus sorption of lss slt, tissu tolrn, umultion of slt in vuols, istintion in sorption of ions suh s K +, N + n So -- y th roots n trnsporttion of thm to th ril prt n vrious iohmil prosss suh s th proution of nzyms, hormons n ntioxints (Spyhll & Dsorough, 199; Gorhm, 199; Bgum & Krmokr, 1999). Th rspons of rly to slinity strss pns on th stg of plnt growth. Th most snsitiv stg to slinity is grmintion n sling stg n with th inrs of g, tolrn to slinity is inrs (Story & Jons, 197). Stuis hv shown tht svrl gns r involv in rspons to slinity (Ozturk t l., ; U t l., ). Gn xprssion in rspons to slt strss is iffrnt in vrious spis n iffrnt growth stgs of plnt (Lig t l., 11). In th rspons to strss, gn xprssion, trnsripts n numrous protins r hng n signifint orrltion xists twn thm. But in most ss, th xt funtion of ths ttriuts is unknown in tolrnt or snsitiv gnotyps (Bry, 1997). High onntrtions of soium ions u to its strutiv fft on th nzyms tivitis, photosynthsis n mtolism, oul vrsly fft th growth of plnts (Niu t l., 199). Plnts pply iffrnt mhnisms suh s limiting th ntry of soium into th ll, inrsing trnsfr of soium out of th ll n storg of soium in th vuol to ru its toxi ffts (Blumwl t l., ; Ahron t l., 3). Rlsing of soium out of lls or its storg in vuols r mit y th tivity of N + /H + ntiportr (NHX) in th plsm n vuolr mmrn (Brkl & Blumwl, 1991). A ky nzym in th synthsis of holin in plnts is whih tlyzs N mthyltion of phosphothnolmin, phospho monothylthnolmin n phospho imthylthnolmin for onvrsion of phosphothnolmin to phosphoholin tht phosphoholin is onvrt to holin uring th stg. Cholin is vitl prursor in th plnt us it is rquir for th synthsis of phosphtiylholin (PC), whih onstituts -% of th ll mmrn (Mou t l., ). Crtin plnts us holin to prou glyintin tht is n osmoprottnt n uss rsistn to slinity, rought n othr strsss (Gorhm, 199). O- mthyltrnsfrs () is lrg fmily of nzyms tht mthylt th oxygn tom in th sonry mtolits suh s phnylpropnois, flvonois n lklois. It plys n importnt rol in th iosynthsis of lignin, ioti strss tolrn n iss rsistn in
2 73 ROGHAYEH GHORBANI ET AL., plnts (Lm t l., 7). It is rport tht invrts protin, lon or in omintion with plnt hormons, is involv in rgultion of plnt vlopmnt, lssifition of rohyrts s wll s ioti n ioti intrtions. gn os invrts protin (Ai tfrutofurnosis3, EC 3..1.), whih is ky mtoli nzym to split suros into t-d- frutos n lph-d-gluos (Fotopoulos, ). In th prsnt stuy, w rport th trnsriptionl rspons of rly v. Shr 3771 n n n vn lin to 1 mm n mm NCl t hours, 3 ys n 3 wks ftr slt trtmnt using rl-tim PCR thniqu. Mtrils n Mthos Plnt mtrils: To invstigt th fft of slinity strss on gn xprssion hngs in rly root, thr gnotyps; (slt snsitiv), Shr3771 (slt tolrn) n n Irnin vn lin (slt tolrn) riv from ross twn Shr n Kvir wr us in th xprimnt. Ss of th gnotyps wr otin from th Univrsity of Wstrn Austrli n S n Plnt Improvmnt Institut, Krj, Irn. Shr3771 is North Afrin lnr n is ommril Austrlin Vrity. Slt Trtmnt n xprimntl onition: Th xprimnt ws onut in hyroponi ultur systm t grnhous. Th gnotyps wr vlut unr 1 n mm NCl trtmnts n root smpl for RNA xtrtion ws hrvst h, 3 ys n 3 wks ftr rhing finl NCl onntrtion of h trtmnt. Th xprimnt ws prform using split plot-ftoril sign with thr rplits n slinity trtmnt ws us s min ftor n omintions of gnotyps n smpling tim s su ftor. Ss wr striliz with soium hypohlorit n grmint in ptri ishs n svn y ol slings of uniform siz wr trnsfrr into lrg sn tnks unr ontroll grnhous (1 h ily light, - µmol m- s-1 photosynthti photon flux nsity (PPFD), thrmo prio ± C y\night, n rltiv humiity /% y/night). Th tnks wr su irrigt n flush four tims ily with moifi Hogln nutrint solution. Eltril onutivity, ph n solution tmprtur wr monitor ily. Slt strss ws impos svn ys ftr th slings wr trnsfrr. NCl onntrtions wr rought up to 1 n mm NCl y inrmnts of mm NCl pr y. CCl ws with NCl to mintin N+/C+ onntrtion rtio of 1:1 on molr sis. RNA isoltion, DNA synthsis n Rl-tim PCR: Totl RNA ws xtrt from rly root smpls using RNX-Plus kit oring to th mnufturr s protool n trt with RNs-fr DNs I. Qulity n quntity of th RNA smpls wr tst y 1% gros formlhy gl ltrophorsis n PioDrop sptrophotomtr, rsptivly. To synthsiz DNA, Frmnts suprsript III Rvrs Trnsripts kit with n oligo(t) primr ws us, following th mnufturr s instrutions. Rl-tim qpcr ws on for h gn in totl volum of 1 μl y ing 1 μl of th DNA, 1. μl forwr n rvrs primrs, 3. μl HO n μl SYBG prmix Ex TqTMII PCR mstr mixtur (TAKARA, Jpn). Th nlysis ws rri out with two rplits for h smpl. qpcr ws prform with PCR onitions of 9 C for minuts, yls of 9 C for sons, primr spifi nnling tmprtur for sons, n 7 C for sons n finl xtnsion t 7 C for minuts. Primrs wr sign to trmin th xprssion of numr of ky gns involv in N+ omprtmnttion n ROS toxifition n inlu mmrs of th, NHX1, n gns (Tl 1). α-tuulin ws us s rfrn gn n t ws quntifi using th omprtiv CT mtho (- CT mtho) s on CT vlus (Livk & Shmittgn, 1). Anlysis of vrin ws prform s on linr mol of th split-plot ftoril sign n mn omprison ws prform y Dunn s multipl rng tst with ritil vlu of p.. Rsults Trnsriptionl hngs in th gn xprssion profil: Th xprssion of gns potntilly involv in plnt ptiv rsponss to slinity ws xmin in th root of hyroponilly-grown plnts. Plnts wr xpos to 1 n mm NCl n th xprssion pttrns of, NHX1, n gns in root wr tst in, Shr3771 n vn lin gnotyps t thr tim points of slt trtmnt: th rly stg ( hours of slt), th intrmit stg (3 ys of slt), n th lt stg (3 wks of slt). Anlysis of vrin for gn xprssion rvl signifint hngs in th xprssion of NHX1 n gns. Trnsriptionl hngs in th gn xprssion profil wr signifint for ll th gns mong tim point of slt trtmnts n mong gnotyps xpt NHX1 gn. Slinity x gnotyps, slinity x tim point n gnotyp x tim point two intrtions n slinity x gnotyp x tim point thr wys intrtion wr signifintly fft th xprssion profils of th gns xpt NHX1 gn whih ws not signifintly fft y slinity x gnotyp n slinity x gnotyp x tim point intrtions (t not shown). Tl 1. Gn spifi primrs for th mplifition of,,, NHX1 n α-tuulin. Gn rvrs primr forwr primrs TTACAAAGCGAGTCTCGCTCG CCAGGAGGATTACGACGACATC AACCTTTCCCCCCATTTCG TCCCTCGTCCCACTATCATACC CAAACATTGCCGGTC GGTTGATCACTCCATCGTGGA NHX1 ACAACATCTGGTCATACTGCCG TACGGTTTTCTGCCTCTGTCACA α-tuulin AGCATGAAGTGGATCCTTGG AGTGTCCTGTCCACCCACTC
3 ROOT OF BARLEY HORDEUM VULGARE UNDER SALINITY STRESS 737 gn: At th rly stg of slt trtmnt ( h), gn ws highly up-rgult in th slt tolrnt vn lin ompr with th vritis unr 1 mm NCl s ompr with ontrol. With prolonging slt trtmnt urtion, trnsript lvl of this gn ws rs in n vn lin. In th roots of Shr 3771, trnsript lvl of ws inrs from h to 3 ys, ut t lt tim point (3 wks) it rs gin (Fig. 1). Unr mm NCl ompr with th ontrol, xprssion of ws inrs t lt stg of trtmnt in slt tolrnt Shr 3771 n vn lin n rs in slt susptil (Fig. 1). Unr mm NCl ompr with 1 mm NCl, gn up-rgult in Shr 3771 n vn lin n own-rgult in gnotyp with inrs slt strss urtion (Fig. 1) h 3y 3wk Shr3771 gn: Anlysis of trnsript lvl of gn rvl tht with prolonging slt trtmnt urtion, it own-rgult slt snsitiv n up rgult in slt tolrnt Shr 3771 vritis unr 1 mm NCl ompr with th ontrol. In vn lin, xprssion of this gn inrs with prolonging of slt urtion from h to 3 ys n thn rs in lt tim point (Fig. ). Unr mm NCl ompr with ontrol, xprssion of this gn ws rs in n vn lin with prolong slt trtmnt urtion, whrs in Shr 3771, its trnsript lvl ws rs from h to 3 ys n thn inrs in lt tim point (Fig. ). In th ll thr gnotyps, xprssion of gn ws signifintly ru with inrs of slinity lvl from 1 to mm NCl with prolong slt trtmnt urtion (Fig. ). gn: Unr 1 mm NCl ompr with th ontrol, 3 ys ftr slt trtmnt, th highst lvl of gn ws osrv in n trnsript lvl of this gn ws rs in Shr 3771 with prolong slt urtion tim ut in trnsript lvl of this gn ws inrs t intrmit tim point n thn rs t lt tim point. In vn lin, t th intrmit tim point, th trnsript lvl of ws rs n thn inrs t th lt tim point (Fig. 3). Compr with th ontrol, unr mm NCl, iffrntil xprssion of th gn t iffrnt tim points of slt trtmnt ws ror t ll th thr gnotyps. In th vn lin n prolong slt trtmnt urtion from hours to 3 ys rsult in own-rgultion of, whrs up-rgultion ws osrv from 3 ys to 3 wks, ut this up-rgultion ws not signifint. For Shr 3771 th xprssion ws inrs from h to 3 ys n thn rs t lt tim point (Fig. 3). Unr mm NCl ompr with 1 mm NCl, with prolong slt trtmnt urtion, th trnsript lvl of this gn ws inrs in Shr3771 ut it ws rs in t intrmit tim point n thn inrs t lt tim point. In vn lin, hngs wr not signifint from h to 3 ys ut in 3 wk tim point xprssion ws highly rs (Fig. 3) mm NCl trtmnt Fig. 1. Mn omprison of xprssion lvl for gn unr ) 1 mm NCl trtmnt ompr with th ontrol, ) mm NCl trtmnt ompr with th ontrol n ) ompr with 1 mm NCl trtmnt h, 3 ys n 3 wks ftr trtmnt. h 3y 3wk - mm NCl trtmnt h 3y 3wk -1 mm NCl trtmnt Shr3771 Shr3771
4 EXprssion 73 ROGHAYEH GHORBANI ET AL., 1 1 Shr Shr h 3y 3wk 1- mm NCl trtmnt 3 1 h 3y 3wk 1- mm NCl trtmnt 1 1 Shr Shr h 3y 3wk 3 1 h 3y 3wk - mm NCl trtmnt - mm NCl trtmnt h 3y 3wk -1 mm NCl trtmnt Shr h 3y 3wk -1 mm NCl trtmnt Shr3771 Fig.. Mn omprison of xprssion lvl for gn unr ) 1 mm NCl trtmnt ompr with th ontrol, ) mm NCl trtmnt ompr with th ontrol n ) ompr with 1 mm NCl trtmnt h, 3 ys n 3 wks ftr trtmnt. Fig. 3. Mn omprison of xprssion lvl for gn unr ) 1 mm NCl trtmnt ompr with th ontrol, ) mm NCl trtmnt ompr with th ontrol n ) ompr with 1 mm NCl trtmnt h, 3 ys n 3 wks ftr trtmnt.
5 ROOT OF BARLEY HORDEUM VULGARE UNDER SALINITY STRESS 739 Disussion Although rly is known s on of th most slttolrnt rop plnt, vrition os xist mong iffrnt vritis. In this stuy, thr gnotyps of rly with iffrntil rspons to slt strss wr us n gn xprssion ws nlyz t iffrnt tim points ftr slt trtmnt. Slinity inus umultion of solul sugrs n ltrs th tivity of sugr mtolism nzyms in plnts. Th up rgultion of xtrllulr invrts () pprs to ommon rspons to vrious ioti n ioti strss rlt stimuli suh slt strss (Roitsh t l., 3). Our rsults show tht xprssion of ws inrs with inrs of slt strss urtion n mount of slinity from 1 to mm NCl t slt tolrnt Shr 3771 n vn lin, ut rs in. (Wli t l., ) stui th xprssion of gn using Morx vrity, 3, n 7 hours ftr slt trtmnt n rport tht th xprssion of th gn rs t th tim prio of 3 hours n inrs t th 7 hours ftr th strss trtmnt. Duy n Singh (1999) rport tht in ri unr slinity, i invrts tivity gn ws rs in shoots of th slt tolrnt vritis n inrs in slt snsitiv vritis. Mny plnts us suros s th mjor form of trnsport ron (Nguyn-Quo & Foyr, 1) n th utiliztion of suros pns on its lvg into gluos n frutos. This rtion is tlyz y two nzyms; suros synths, ytosoli nzym whih is ruil to suros utiliztion in fruit vlopmnt (Sun t l., 199; Wng t l., 1993) n th invrts, hyrols lving suros into th two mono-shris, to mintin th llulr hxoss onntrtion (Yll t l., 19; Shols t l., 199). Inrs lvl of invrts tivity in th lvs of plnts trt with high slt onntrtions inits mjor rqust of hxoss (ontrolling osmoti potntil n ll turgor), sustrts nssry to rspirtory prosss (Musolo t l., 3). In plnts, O-mthyltion is mit y n nzym fmily of O-mthyltrnsfrss (s) tht trnsfr th mthyl groups from th mthyl onor, S-nosyl-Lmthionin (AoMt) to suitl phnoli ptor moluls (Lm t l., 7). In our stuy, th gn highly up-rgult t rly stg of slt strss with inrs slt lvl from 1 to mm NCl, ut with prolong slt urtion th trnsript lvl of this gn ws rs in ll th thr gnotyps. This my init th short-trm rspons of this gn to inrs slt lvl in th ll th thr gnotyps. (Sugimoto t l., 3) rport tht th gn ws xprss onstitutivly in th root of slt-tolrnt rly vrity n th xprssion lvl ws inrs 1. tims y slt strss, ut th slt-snsitiv vrity show no hngs in xprssion of th gn in roots n lvs. (Wli t l., ) rport tht in rly trnsript lvl of gn inrs 3 n 7 hours ftr slt trtmnt ompr with th ontrol. Phosphothnolmin N-mthyltrnsfrs () rlt to th synthsis n umultion of glyintin, wll known omptil solut for osmoti justmnt in plnts unr slt n rought strsss (Gorhm, 199). with inrsing slt lvl from 1 to mm NCl up rgult th xprssion of in shr 3771 t lt tim points (3ys n 3 wks) n in vn-lin t rly tim point (h) ut own-rgult its xprssion in t th ll thr tim points. (U t l., ) nlyz th xprssion of gn in Hrun-Nijyo vrity of rly unr 1 n mm NCl n rport strong xprssion of this gn unr slinity strss ftr 3 ys n 3 wks. Conlusion Rl-tim RT PCR ws us to nlysis th xprssion pttrn of numr of ky gns involv in N + omprtmnttion n ROS toxifition, nmly, NHX1, n in rspons to slt strss in th root of thr rly gnotyps. Slt strss inrs th xprssion of in tolrnt gnotyps with inrs strss urtion n inrs of slinity lvl. This shows long-trm rspons of this gn to slinity strss in th slt tolrnt gnotyps. Whrs, xprssion of gn in ll th thr gnotyps ws signifintly inrs t th rlir stg of slt trtmnt with inrsing mount of slinity. Thrfor, this gn my involv in th rly rspons of slinity strss. It n si tht with inrs of slt lvl from 1 to mm NCl, xprssion of hs signifintly inrs in vn lin t th rly tim point n in Shr3771 t th lt tim point, ut in xprssion of this gn ws own-rgultion. Aknowlgmnt Th uthors grtfully knowlg th fun n lortory filitis provi y th Cntr of Exlln in Crl Molulr Bring, Univrsity of Triz, Irn. Rfrn Ahron, G.S., M.P. Aps, S. Dun, X. Hu n E. Blumwl. 3. Chrtriztion of fmily of vuolr N+/H+ ntiportrs in Ariopsis thlin. Plnt. Soil, 3(1): -. Brkl, B.J. n E. Blumwl Intifition of 17-kD protin ssoit with th vuolr N+/H+ ntiport of Bt vulgris. Pro. Ntl. A. Si., (): Bgum, F. n J. Krmokr Efft of slinity strss on th umultion n istriution of prolin in wht. Rhis, 1(1): -. Blumwl, E., G.S. Ahron n M.P. Aps.. Soium trnsport in plnt lls. Biohim. Biophys. At., 1(1-): 1-1. Bry, E.A Plnt rsponss to wtr fiit. Trns. Plnt. Si., (): -. Crlli, S Yil potntil n rought tolrn of sgrgting popultions of rly in ontrsting nvironmnts. Euphyti, 3(1): -73. Duy, R.S. n A.K. Singh Slinity inus umultion of solul sugrs n ltrs th tivity of sugr mtolizing nzyms in ri plnts. Biol. Plntrum., (): Fotopoulos, V.. Plnt invrtss: strutur, funtion n rgultion of ivrs nzym fmily. J. Biol. Rs., :
6 7 ROGHAYEH GHORBANI ET AL., Gorhm, J Slt tolrn in th Triti: Ion isrimintion in ry n tritil. J. Exp. Bot., 1(): 9-1. Gorhm, J Btins in highr plnts iosynthsis n rol in strss mtolism. In: R.M. Wllsgrov (.), Amino is n thir rivtivs in highr plnts, Soity for Exprimntl Biology Sminr Sris, Vol., Cmrig Univrsity Prss, Cmrig, pp Johnson, U., M. Krlsson, I. Johnsson, S. Gustvsson, S. Sjӧvll, L. Fryss, A.R. Wig n P. Kjllom. 1. Th omplt st of gns noing mjor intrinsi protins in Ariopsis provis frmwork for nw nomnltur for mjor intrinsi protins in plnts. Plnt. Physiol., 1(): Kingsury, R.W., E. Epstin n R.W. Pry. 19. Physiologil rsponss to slinity in slt lins of wht. Plnt. Physiol., 7(): Lm, K.C., R.K. Irhim, B. Bh n S. Dynnn. 7. Strutur, funtion, n volution of plnt O- mthyltrnsfrss. Gnom, (11): Lopol, A.C. n R.P. Willing. 19. Evin for toxiity ffts of slt on mmrns. In: Slinity Tolrn in Plnts. (Es.): Stpls, R.C. n G.H. Tonnissn John Wily n Sons, Nw York, NY, pp Lig, A., M. Ktsuhr, M. Shisk n G. Djir. 11. Aioti strsss moult xprssion of mjor intrinsi protins in rly (Horum vulgr). CR Biol., 33(): Livk, K.J. n T.D. Shmittgn. 1. Anlysis of rltiv gn xprssion t using rl-tim quntittiv PCR n th ΔΔCT mtho. Mthos, (): -. Mittlr, R.. Oxitiv strss, ntioxints n strss tolrn. Trns Plnt Si., 7(9): -1. Mou, Z., X. Wng, Z. Fu, Y. Di, C. Hn, J. Ouyng, F. Bo, Y. Hu n J. Li.. Silning of phosphothnolmin N- mthyltrnsfrs rsults in tmprtur snsitiv ml strility n slt hyprsnsitivity in Ariopsis. Plnt. Cll, 1(9): Musolo, A., M.R. Pnuio n M. Siri. 3. Effts of slinity on growth, rohyrt mtolism n nutritiv proprtis of kikuyu grss (Pnnistum lnstinum Hohst). Plnt. Si., 1(): Nguyn-Quo, B. n C.H.A. Foyr. 1. Rol for futil yls involving invrts n suros synths in suros mtolism of tomto fruit. J. Exp. Bot., (3): 1-9. Niu, X., R.A. Brssn, P.M. Hsgw n J.M. Pro Ion homostsis in NCl strss nvironmnts. Plnt. Physiol., 19(3): Ozturk, Z.N., V. Tlmé, M. Dyholos, C.B. Mihlowski, D.W. Glrith, N. Gozukirmizi, R. Turos n H.J. Bohnrt.. Monitoring lrg-sl hngs in trnsript unn in rought n slt-strss rly. Plnt. Mol. Biol., (): Roitsh, T., M. Blir, M. Hofmnn, R. Prols n A. Sinh. 3. Extrllulr invrts: ky mtoli nzym n PR protin. J. Exp. Bot., (3): 13-. Shols, J.D., N. Bunok, R. Wil n S.A. Rolf Th impt of ru vuolr invrts tivity on th photosynthti n rohyrt mtolism of tomto. Plnt, (): -7. Spyhll, J.P. n S.L. Dsorough Suproxi ismuts, tls, n α-toophrol ontnt of stor potto turs. Plnt. Physiol., 9(3): 11-. Story, R. n R.W. Jons Slt strss n omprtiv physiology in th Grmin. I. Ion rltions of two slt n wtr strss rly vritis, Cliforni Mriout n Arimr. Aust. J. Plnt. Physiol., (): 1-1. Sugimoto, M., Y. Ok, K. Sto, K. Ito n K. Tk. 3. A root-spifi O-mthyltrnsfrs gn xprss in slttolrnt rly. Biosi. Bioth. Bioh., 7(): 9-7. Sun, J., T. Loo, S.J.S. Sung n C.C.J. Blk Suros synths in wil tomto, Lyoprsion hmilwski n tomto fruit sink strngth. Plnt. Physiol., 9(3): U, A., A. Kthirsn, M. In, Y. Nrit, T. Nkmur, W. Shi, T. Tk n J. Bnntt.. Osmoti strss in rly rgults xprssion of iffrnt st of gns thn slt strss os. J. Exp. Bot., (): Vrouq, L., A. Gronin n C. Murl.. Struturfuntion nlysis of plnt quporin AtPIP; 1 gting y ivlnt tions n protons. Biohm. J., 1(3): 9-1. Wli, H., C. Wilson, A. Whi, P. Conmin, X. Cui n T.J. Clos.. nlysis of rly (Horum vulgr L.) uring slinity strss. Funt. Intgr Gnomis., (): Wng, F., A. Snz, M.L. Brnnr n A. Smith Suros synths, strh, umultion n tomto fruit sink strngth. Plnt. Physiol., 11(1): Yll, S., J.D. Hwitt, N.L. Roinson, S. Dmon n A.B. Bnnt. 19. Sink mtolism in tomto fruit. III. Anlysis of rohyrt ssimiltion in wil spis. Plnt. Physiol., 7(3): (Riv for pulition 1 April 17)
Expression pattern of two sugar transporter genes (SuT4 and SuT5) under salt stress in wheat
POJ 3(6):194-198 (21) ISSN:1836-3644 Exprssion pttrn o two sugr trnsportr gns (SuT4 n SuT5) unr slt strss in wht Fhimh Chrkzi, S. Snz Rmznpour *, Hssn Soltnloo Dprtmnt o Plnt Bring n Biothnology, Gorgn
More informationStudy of some physiological characteristics of potato tissue under salinity stress
Intrntionl Journl of Frming n Alli Sins Avill onlin t www.ijfs.om 28 IJFAS Journl-28-7-/-5/ 28 F, 28 ISSN 2322-434 28 IJFAS Stuy of som physiologil hrtristis of potto tissu unr slinity strss Nosrt Mosvi,
More informationWATER STRESS AFFECTS THE GERMINATION, EMERGENCE AND GROWTH OF DIFFERENT SORGHUM CULTIVARS
SINET: Ethiop. J. Si., 28(2):119 128, 25 Fulty of Sin, is Univrsity, 25 ISSN: 379 2897 WTER STRESS FFECTS THE GERMINTION, EMERGENCE ND GROWTH OF DIFFERENT SORGHUM CULTIVRS Wonimu yu 1, N.F.G. Rthmn 2,
More informationEffect of Salinity Stress on Seed Germination Catharanthus roseus Don. Cvs. Rosea and Alba
Asin Journl of Agriulturl Sins 4(2): 117-121, 212 ISSN: 241-389 Mxwll Sintifi Orgniztion, 212 Sumitt: Novmr 21, 211 Apt: Dmr 27, 211 Pulish: Mrh 26, 212 Efft of Slinity Strss on S Grmintion Cthrnthus rosus
More informationAntioxidant enzymes and physiological traits of Vicia faba L. as affected by salicylic acid under salt stress
Journl of Mtrils n Environmntl Sins ISSN : 8-58 Copyright 17, Univrsity of Mohmm 1r Ouj Moroo JMES, 17 Volum 8, Issu 7, Pg 59-563 http://www.jmtrnvironsi.om / Antioxint nzyms n physiologil trits of Vii
More informationThe Effects of NaCl Stress on the Physiological and Oxidative Situation of Maize (Zea mayz L.) Plants in Hydroponic Culture
Currnt Rsrh Journl of Biologil Sins (1): 17-, 1 ISSN: 1-77 Mxwll Sintifi Orgniztion, 1 Sumitt: Sptmr 1, 11 Apt: Otor 9, 11 Pulish: Jnury, 1 Th Effts of NCl Strss on th Physiologil n Oxitiv Sitution of
More informationCRITICAL OSMOTIC, IONIC AND PHYSIOLOGICAL INDICATORS OF SALINITY TOLERANCE IN COTTON (GOSSYPIUM HIRSUTUM L.) FOR CULTIVAR SELECTION
Pk. J. Bot., 42(3): 1685-1694, 21. CRITICAL OSMOTIC, IONIC AND PHYSIOLOGICAL INDICATORS OF SALINITY TOLERANCE IN COTTON (GOSSYPIUM HIRSUTUM L.) FOR CULTIVAR SELECTION M. FAROOQ HUSSAIN MUNIS 1, LILI TU
More informationEFFECTS OF SHADING ON SOME MORPHOLOGICAL AND PHYSIOLOGICAL CHARACTERISTICS OF BEGONIA SEMPERFLORENS
Pk. J. Bot., 5(6): 73-79, 8. EFFECTS OF SHADING ON SOME MORPHOLOGICAL AND PHYSIOLOGICAL CHARACTERISTICS OF BEGONIA SEMPERFLORENS YUANBING ZHANG, AIRONG LIU *, XUEPING ZHANG AND SHOUCHENG HUANG Anhui Sin
More informationEffect of Salt Stress on Growth, Membrane Damage, Antioxidant Metabolism and Artemisinin Accumulation in Artemisia annua L.
Plnt Strss 21 Glol Sin Books Efft of Slt Strss on Growth, Mmrn Dmg, Antioxint Mtolism n Artmisinin Aumultion in Artmisi nnu L. Triq Aft * M. Msroor A. Khn Moh. Irs M. Nm Nm Hshmi Moinuin Plnt Physiology
More informationAbove. Below H&E. Above CD4. CD11b. Fluoromyelin BDA BDA BDA. Cerebral cortex. Focal lesion. Thoracic cord. Lumbar cord. Hindlimb placing score
1. 1. 1 1 3 Tim tr lsion inution () wks wks 3 1 1 1 3 Tim tr lsion inution () i Ltrl sor. Mil Aov Blow.. 1 wk On sgmnt ov g 3. Lsion Fluoromylin Fluoromylin h CD11 Hinlim pling sor CD Aov Blow Fol lsion
More informationEE1000 Project 4 Digital Volt Meter
Ovrviw EE1000 Projt 4 Diitl Volt Mtr In this projt, w mk vi tht n msur volts in th rn o 0 to 4 Volts with on iit o ury. Th input is n nlo volt n th output is sinl 7-smnt iit tht tlls us wht tht input s
More informationCo-expression of NCED and ALO improves vitamin C level and tolerance to drought and chilling in transgenic tobacco and stylo plants
Plnt Biothnology Journl (6) 4, pp. 6 4 oi:./pi.374 Co-xprssion of NCED n ALO improvs vitmin C lvl n tolrn to rought n hilling in trnsgni too n stylo plnts Ggn Bo, Chunliu Zhuo, Chunmi Qin, Ting Xio, Zhnfi
More information, each of which is a tree, and whose roots r 1. , respectively, are children of r. Data Structures & File Management
nrl tr T is init st o on or mor nos suh tht thr is on sint no r, ll th root o T, n th rminin nos r prtition into n isjoint susts T, T,, T n, h o whih is tr, n whos roots r, r,, r n, rsptivly, r hilrn o
More informationCSE 373: AVL trees. Warmup: Warmup. Interlude: Exploring the balance invariant. AVL Trees: Invariants. AVL tree invariants review
rmup CSE 7: AVL trs rmup: ht is n invrint? Mihl L Friy, Jn 9, 0 ht r th AVL tr invrints, xtly? Disuss with your nighor. AVL Trs: Invrints Intrlu: Exploring th ln invrint Cor i: xtr invrint to BSTs tht
More informationQUESTIONS BEGIN HERE!
Points miss: Stunt's Nm: Totl sor: /100 points Est Tnnss Stt Univrsity Dprtmnt of Computr n Informtion Sins CSCI 710 (Trnoff) Disrt Struturs TEST for Fll Smstr, 00 R this for strtin! This tst is los ook
More informationMetabolite modifications in Solanum lycopersicum roots and leaves under cadmium stress
Afrin Journl of Biothnology Vol. 1 (4), pp. 567-579, 24 Jnury, 211 Avill onlin t http://www.mijournls.org/ajb DOI: 1.5897/AJB1.1275 ISSN 1684 5315 211 Ami Journls Full Lngth Rsrh Ppr Mtolit moifitions
More informationMath 61 : Discrete Structures Final Exam Instructor: Ciprian Manolescu. You have 180 minutes.
Nm: UCA ID Numr: Stion lttr: th 61 : Disrt Struturs Finl Exm Instrutor: Ciprin nolsu You hv 180 minuts. No ooks, nots or lultors r llow. Do not us your own srth ppr. 1. (2 points h) Tru/Fls: Cirl th right
More informationModule graph.py. 1 Introduction. 2 Graph basics. 3 Module graph.py. 3.1 Objects. CS 231 Naomi Nishimura
Moul grph.py CS 231 Nomi Nishimur 1 Introution Just lik th Python list n th Python itionry provi wys of storing, ssing, n moifying t, grph n viw s wy of storing, ssing, n moifying t. Bus Python os not
More informationEffects of arbuscular mycorrhizal fungi and Bradyrhizobium japonicum on drought stress of soybean
S324 Biologi, Brtislv, 61/Suppl. 19: S324 S328, 2006 Effts of rusulr myorrhizl fungi n Bryrhizoium jponium on rought strss of soyn Nssr Alisghrz, Mohmm Rz Nyshouri & Gho Slimi Dprtmnt of Soil Sin, Fulty
More informationProtective effect of exogenousnitric oxide onalleviation ofoxidative damage induced by high salinity in rice (Oryza sativa L.
Shirz Univrsity Irn Agriulturl Rsrh(215) 34(1) 63-7 Prottiv t o xognousnitri oxi onllvition ooxitiv mg inu y high slinity in ri (Oryz stiv L.) slings S. AsiSnm 1,M. Zvrh 1*, A. Hshmpour 2 1 Dprtmnt o Agronomy
More informationMeta-analysis the effect of nitrogen fertilizer on quantitative and qualitative characteristics of sugar beet
ISSN No. (Print): 7-3 ISSN No. (Onlin): 224-323 Mt-nlysis th fft of nitrogn frtilizr on quntittiv n qulittiv hrtristis of sugr t Mhi Sghi-Sho*, Driush Fthollh Tlghni* n Frz Pknj* *Sugr Bt S Institut (SBSI),
More informationTURFGRASS DISEASE RESEARCH REPORT J. M. Vargas, Jr. and R. Detweiler Department of Botany and Plant Pathology Michigan State University
I TURFGRASS DISEASE RESEARCH REPORT 9 J. M. Vrgs, Jr. n R. Dtwilr Dprtmnt f Btny n Plnt Pthlgy Mihign Stt Univrsity. Snw Ml Th 9 snw ml fungii vlutin trils wr nut t th Byn Highln Rsrt, Hrr Springs, Mihign
More informationABA Controls H 2 O 2 Accumulation Through the Induction of OsCATB in Rice Leaves Under Water Stress
ontrols H 2 O 2 umultion Through th Inution o OsT in Ri Lvs Unr Wtr Strss Nnghui Y 1,, Guohui Zhu 2,, Yinggo Liu 3, Yingxun Li 1 n Jinhu Zhng 1, * 1 Dprtmnt o iology, Hong Kong ptist Univrsity, Hong Kong,
More informationResponse of Sesame (Sesamum indicum) Cultivars to Hydropriming of Seeds
J. Appl. Environ. Biol. Si., 1(12)638-642, 2011 2011, TxtRo Pulition ISSN: 2090-4215 Journl o Appli Environmntl n Biologil Sins www.txtro.om Rspons o Ssm (Ssmum inium) Cultivrs to Hyropriming o Ss Ahm
More informationECE COMBINATIONAL BUILDING BLOCKS - INVEST 13 DECODERS AND ENCODERS
C 24 - COMBINATIONAL BUILDING BLOCKS - INVST 3 DCODS AND NCODS FALL 23 AP FLZ To o "wll" on this invstition you must not only t th riht nswrs ut must lso o nt, omplt n onis writups tht mk ovious wht h
More informationAquauno Video 6 Plus Page 1
Connt th timr to th tp. Aquuno Vio 6 Plus Pg 1 Usr mnul 3 lik! For Aquuno Vio 6 (p/n): 8456 For Aquuno Vio 6 Plus (p/n): 8413 Opn th timr unit y prssing th two uttons on th sis, n fit 9V lklin ttry. Whn
More informationRefining properties of lavender (Lavandula spica L.) in cadmium contaminated environments
2277 Rfining proprtis of lvnr (Lvnul spi L.) in mium ontmint nvironmnts Anhit Kirostmi 1, Pzhmn Mori 2 * n Vhi Aousi 1 1. Dprtmnt of Hortiulturl Sin, Islmi Az Univrsity, Sin n Rsrh Brnh, Thrn, Irn 2. Dprtmnt
More informationBulgarian Journal of Agricultural Science, 13 (2007), National Centre for Agrarian Sciences
325 Bulgrin Journl of Agriulturl Sin, 13 (27), 325-331 Ntionl Cntr for Agrrin Sins Enhnmnt of P, K, C, Zn n F Aumultion in Grni Plnts (Grni jsminois) Grown in Nutrint Solution s Funtion of P n F Intrtion
More informationPresent state Next state Q + M N
Qustion 1. An M-N lip-lop works s ollows: I MN=00, th nxt stt o th lip lop is 0. I MN=01, th nxt stt o th lip-lop is th sm s th prsnt stt I MN=10, th nxt stt o th lip-lop is th omplmnt o th prsnt stt I
More informationEdit Horváth A,C, Szilvia Brunner A, Krisztina Bela A, Csaba Papdi B, László Szabados B, Irma Tari A and Jolán Csiszár A
CSIRO PUBLISHING Funtionl Plnt Biology, 2015, 42, 1129 1140 http://x.oi.org/10.1071/fp15119 Exognous sliyli i-triggr hngs in th glutthion trnsfrss n proxiss r ky ftors in th sussful slt strss limtion of
More informationJ. Appl. Environ. Biol. Sci., 1(12) , , TextRoad Publication
J. Appl. Environ. Biol. Si., 1(12)602-607, 2011 2011, TxtRo Pulition ISSN: 2090-4215 Journl of Appli Environmntl n Biologil Sins www.txtro.om Efft of Chnopoium Alum Alllophti Extrt n Slyli Ai Priming Unr
More informationQUESTIONS BEGIN HERE!
Points miss: Stunt's Nm: Totl sor: /100 points Est Tnnss Stt Univrsity Dprtmnt o Computr n Inormtion Sins CSCI 2710 (Trno) Disrt Struturs TEST or Sprin Smstr, 2005 R this or strtin! This tst is los ook
More informationInternational Journal of Agriculture and Biosciences
RESEARCH ARTICLE Intrntionl Journl of Agriultur n Biosins www.ijgio.om P-ISSN: 2305-6622 E-ISSN: 2306-3599 itor@ijgio.om Efft of Lhts of Alin Ws on S Grmintion, Sling Growth n Physiology in Mungn NA Ghyl
More informationSolutions for HW11. Exercise 34. (a) Use the recurrence relation t(g) = t(g e) + t(g/e) to count the number of spanning trees of v 1
Solutions for HW Exris. () Us th rurrn rltion t(g) = t(g ) + t(g/) to ount th numr of spnning trs of v v v u u u Rmmr to kp multipl gs!! First rrw G so tht non of th gs ross: v u v Rursing on = (v, u ):
More information12. Traffic engineering
lt2.ppt S-38. Introution to Tltrffi Thory Spring 200 2 Topology Pths A tlommunition ntwork onsists of nos n links Lt N not th st of nos in with n Lt J not th st of nos in with j N = {,,,,} J = {,2,3,,2}
More informationV={A,B,C,D,E} E={ (A,D),(A,E),(B,D), (B,E),(C,D),(C,E)}
s s of s Computr Sin & Enginring 423/823 Dsign n Anlysis of Ltur 03 (Chptr 22) Stphn Sott (Apt from Vinohnrn N. Vriym) s of s s r strt t typs tht r pplil to numrous prolms Cn ptur ntitis, rltionships twn
More informationDinitrogen fixation and residue nitrogen of different managed legumes and nitrogen uptake of subsequent winter wheat
Dinitrogn fixtion n rsiu nitrogn of iffrnt mng lgums n nitrogn uptk of susqunt wintr wht R. Logs 1, A. Ksk 2 n F. Tu 2 1 Dprtmnt of Orgni Frming, Univrsity of Kil, 2 Dprtmnt of Grss n Forg Sin, Univrsity
More informationNITRIC OXIDE AND CALCIUM INDUCED PHYSIO- BIOCHEMICAL CHANGES IN TOMATO (SOLANUM LYCOPERSICUM) PLANT UNDER HEAT STRESS
y PSP Volum 26 No. 2/217, ps 1663-1672 Frsnius Environmntl Bulltin NITRIC OXIDE AND CALCIUM INDUCED PHYSIO- BIOCHEMICAL CHANGES IN TOMATO (SOLANUM LYCOPERSICUM) PLANT UNDER HEAT STRESS Mnzr H Siiqui 1,*,
More informationOverexpression of a NF-YC transcription factor from bermudagrass confers tolerance to drought and salinity in transgenic rice
Plnt Biothnology Journl (), pp. 8 9 oi:./pi.7 Ovrxprssion of NF-YC trnsription ftor from rmugrss onfrs tolrn to rought n slinity in trnsgni ri Mio Chn, Yujun Zho, Chunliu Zhuo, Shoyun Lu* n Zhnfi Guo*
More informationOriginal Research Article. Essubalew Getachew Seyum
Mrit Rsrh Journl of Agriulturl Sin n Soil Sins (ISSN: 2350-2274) Vol. 2(7) pp. 086-095, July, 2014 Avill onlin http://www.mritrsrhjournls.org/r/inx.htm Copyright 2014 Mrit Rsrh Journls Originl Rsrh Artil
More informationRole of phenolics in the antioxidative status of the resurrection plant Ramonda serbica during dehydration and rehydration
PHYSIOLOGIA PLANTARUM 122: 478 485. 24 oi: 1.1111/j.1399-354.24.428.x Print in Dnmrk ll rights rsrv opyright # Physiologi Plntrum 24 Rol of phnolis in th ntioxitiv sttus of th rsurrtion plnt Rmon sri uring
More informationResearch Article Selenium (Se) Regulates Seedling Growth in Wheat under Drought Stress
Avns in Chmistry Volum 2014, Artil ID 143567, 7 pgs http://x.oi.org/10.1155/2014/143567 Rsrh Artil Slnium (S) Rgults Sling Growth in Wht unr Drought Strss Fhim Nwz, 1 Muhmm Ysin Ashrf, 2 Rshi Ahm, 1 Ejz
More informationV={A,B,C,D,E} E={ (A,D),(A,E),(B,D), (B,E),(C,D),(C,E)}
Introution Computr Sin & Enginring 423/823 Dsign n Anlysis of Algorithms Ltur 03 Elmntry Grph Algorithms (Chptr 22) Stphn Sott (Apt from Vinohnrn N. Vriym) I Grphs r strt t typs tht r pplil to numrous
More information(2) If we multiplied a row of B by λ, then the value is also multiplied by λ(here lambda could be 0). namely
. DETERMINANT.. Dtrminnt. Introution:I you think row vtor o mtrix s oorint o vtors in sp, thn th gomtri mning o th rnk o th mtrix is th imnsion o th prlllppi spnn y thm. But w r not only r out th imnsion,
More informationNumbering Boundary Nodes
Numring Bounry Nos Lh MBri Empori Stt Univrsity August 10, 2001 1 Introution Th purpos of this ppr is to xplor how numring ltril rsistor ntworks ffts thir rspons mtrix, Λ. Morovr, wht n lrn from Λ out
More informationDETAIL B DETAIL A 7 8 APPLY PRODUCT ID LABEL SB838XXXX ADJ FOUR POST RACK SQUARE HOLE RAIL B REVISION
RVISION RV SRIPTION Y T HNG NO NOT OR PROUT LL JJH // LR TIL PPLY PROUT I LL TIL INSI UPPR ROSS MMR ON PR RK IS J OUR POST RK SQUR HOL RIL IS MN MS G NUT, PNL RNG 99 PPLY PROUT I LL INSI UPPR ROSS MMR
More information1 Introduction to Modulo 7 Arithmetic
1 Introution to Moulo 7 Arithmti Bor w try our hn t solvin som hr Moulr KnKns, lt s tk los look t on moulr rithmti, mo 7 rithmti. You ll s in this sminr tht rithmti moulo prim is quit irnt rom th ons w
More informationUniversity of Uludag, Department of Horticulture, Faculty of Agriculture, Bursa, Turkey
207 Bulrin Journl o Ariulturl Sin, 18 (No 2) 2012, 207-218 Ariulturl Amy Slt tolrn urin vttiv rowth in ross o tomto n t o ytoplsm in rspons to slt tolrn A. Turhn 1 * n V. Sniz 2 1 Univrsity o Ulu, Dprtmnt
More informationEngineering Tumour Cell-Binding Synthetic Polymers with Sensing. Dense Transporters Associated with Aberrant Glutamine Metabolism
Supplmntry Informtion Enginring Tumour Cll-Binding Synthti Polymrs with Snsing Dns Trnsportrs Assoitd with Arrnt Glutmin Mtolism oki Ymd, Yuto ond, iroysu Tkmoto, Tkhiro omoto, Mkoto Mtsui, Kishiro Tomod,
More informationof Nebraska - Lincoln
Univrsity of Nrsk - Linoln DigitlCommons@Univrsity of Nrsk - Linoln Agronomy & Hortiultur -- Fulty Pulitions Agronomy n Hortiultur Dprtmnt 7 Cll Wll Protom in th Miz Primry Root Elongtion Zon. II. Rgion-Spifi
More informationModule 2 Motion Instructions
Moul 2 Motion Instrutions CAUTION: Bor you strt this xprimnt, unrstn tht you r xpt to ollow irtions EXPLICITLY! Tk your tim n r th irtions or h stp n or h prt o th xprimnt. You will rquir to ntr t in prtiulr
More informationHumic acid application alleviate salinity stress of bean (Phaseolus vulgaris L.) plants decreasing membrane leakage
Afrin Journl of Agriulturl Rsrh Vol. 7(7), pp. 173-186, 19 Frury, 212 Avill onlin t http://www.mijournls.org/ajar DOI: 1.897/AJAR1.274 ISSN 1991-637X 212 Ami Journls Full Lngth Rsrh Ppr Humi i pplition
More informationEffects of foliar application of salicylic acid and nitric oxide in alleviating iron deficiency induced chlorosis of Arachis hypogaea L.
Kong t l. Botnil Stuis 214, 55:9 RESEARCH Opn Ass Effts of folir pplition of sliyli i n nitri oxi in llviting iron fiiny inu hlorosis of Arhis hypog L. Jing Kong, Yunji Dong *, Linlin Xu, Shung Liu n Xioying
More informationInfluence of sulfur on cadmium (Cd) stress tolerance in Triticum aestivum L.
Arin Journl o iothnology Vol.11(43), pp. 118-1114, 29 My, 212 Avill onlin t http://www.mijournls.org/aj DOI:1.5897/AJ11.426 ISSN 1684-5315 212 Ami Journls Full Lngth Rsrh Ppr Inlun o sulur on mium (C)
More informationCS September 2018
Loil los Distriut Systms 06. Loil los Assin squn numrs to msss All ooprtin prosss n r on orr o vnts vs. physil los: rport tim o y Assum no ntrl tim sour Eh systm mintins its own lol lo No totl orrin o
More information12/3/12. Outline. Part 10. Graphs. Circuits. Euler paths/circuits. Euler s bridge problem (Bridges of Konigsberg Problem)
12/3/12 Outlin Prt 10. Grphs CS 200 Algorithms n Dt Struturs Introution Trminology Implmnting Grphs Grph Trvrsls Topologil Sorting Shortst Pths Spnning Trs Minimum Spnning Trs Ciruits 1 Ciruits Cyl 2 Eulr
More informationSeed Priming With Leaf Aqueous Extract of Lesser Bulrush Improves Resistance against Salt Stress in Pea a,b
Highr Dprtmnt n IJISET - Intrntionl Journl of Innovtiv Sin, Enginring & Thnology, Vol. 4 Issu 8, August 217 ISSN (Onlin) 2348 7968 Impt Ftor (216) 5.264 www.ijist.om S riming With Lf Aquous Extrt of Lssr
More informationSection 3: Antiderivatives of Formulas
Chptr Th Intgrl Appli Clculus 96 Sction : Antirivtivs of Formuls Now w cn put th is of rs n ntirivtivs togthr to gt wy of vluting finit intgrls tht is ct n oftn sy. To vlut finit intgrl f(t) t, w cn fin
More information5/9/13. Part 10. Graphs. Outline. Circuits. Introduction Terminology Implementing Graphs
Prt 10. Grphs CS 200 Algorithms n Dt Struturs 1 Introution Trminology Implmnting Grphs Outlin Grph Trvrsls Topologil Sorting Shortst Pths Spnning Trs Minimum Spnning Trs Ciruits 2 Ciruits Cyl A spil yl
More informationArsenic toxicity and salinity stress effects on macronutrient uptake in watercress (Nasturtium officinale)
Avilbl onlin t www.sinzr.om Sinzr Journl of Agriulturl n Biologil Sins, Vol, Issu, (6): -5 DOI:.634/SJABS...5 ISSN 45-5 Arsni toxiity n slinity strss ffts on mronutrint uptk in wtrrss (Nsturtium offiinl)
More informationA Low Noise and Reliable CMOS I/O Buffer for Mixed Low Voltage Applications
Proings of th 6th WSEAS Intrntionl Confrn on Miroltronis, Nnoltronis, Optoltronis, Istnul, Turky, My 27-29, 27 32 A Low Nois n Rlil CMOS I/O Buffr for Mix Low Voltg Applitions HWANG-CHERNG CHOW n YOU-GANG
More informationPaths. Connectivity. Euler and Hamilton Paths. Planar graphs.
Pths.. Eulr n Hmilton Pths.. Pth D. A pth rom s to t is squn o gs {x 0, x 1 }, {x 1, x 2 },... {x n 1, x n }, whr x 0 = s, n x n = t. D. Th lngth o pth is th numr o gs in it. {, } {, } {, } {, } {, } {,
More informationEffects of Weed Control Methods on the Growth and Yield of Cowpea (Vigna unguiculata (L.) Walp) under Rain-Fed Conditions of Owerri
Amrin-Eursin J. Agri. & Environ. Si., 1 (11): 146-1430, 01 ISSN 1818-6769 IDOSI Pulitions, 01 DOI: 10.589/iosi.js.01.1.11.1791 Effts of W Control Mthos on th Growth n Yil of Cowp (Vign unguiult (L.) Wlp)
More informationDifferential Responses of the Activities of Antioxidant Enzymes to Thermal Stresses between Two Invasive Eupatorium Species in China
Journl o Intgrtiv Plnt Biology 28 Dirntil Rsponss o th Ativitis o Antioxint Enzyms to Thrml Strsss twn Two Invsiv Euptorium Spis in Chin Ping Lu 1,2, Wi-Guo Sng 1 n K-Ping M 1 ( 1 Ky Lortory o Vgttion
More informationINFLUENCE OF SALT STRESS ON GROWTH AND ANTIOXIDANT RESPONSES OF TWO MALUS SPECIES AT CALLUS AND PLANTLET STAGES
Pk. J. Bot., 45(2): 375-381, 213. INFLUENCE OF SALT STRESS ON GROWTH AND ANTIOXIDANT RESPONSES OF TWO MALUS SPECIES AT CALLUS AND PLANTLET STAGES KAI WANG 1, LIXIN ZHANG 1*, MEI GAO 1, LIXIA LV 2, YONGGUI
More informationRelationship between phosphorus deficiency tolerance and root/rhizosphere management in Vicia faba and Vicia sativa
Rltionship twn phosphorus fiiny tolrn n root/rhizosphr mngmnt in Vii f n Vii stiv Wissl M shli *, Krim Jlli, Ni Klll, Hythm Mhhi Lortory of Lgums, ntr of Biothnology of Borj-ri, BP 91, Hmmm-Lif 25, Tunisi
More informationWhy the Junction Tree Algorithm? The Junction Tree Algorithm. Clique Potential Representation. Overview. Chris Williams 1.
Why th Juntion Tr lgorithm? Th Juntion Tr lgorithm hris Willims 1 Shool of Informtis, Univrsity of Einurgh Otor 2009 Th JT is gnrl-purpos lgorithm for omputing (onitionl) mrginls on grphs. It os this y
More informationTranscriptome analysis of potato phosphorus-tolerant variety seedlings (Atlantic) revealing the gene expression profile under low phosphorus stress
POJ 8(4):34-347 (5) ISSN:836-3644 Trnsriptom nlysis of potto phosphorus-tolrnt vrity slings (Atlnti) rvling th gn xprssion profil unr low phosphorus strss Liqin Li, Xu Zou, Jio Li, Xiyo Wng*, Su Ni, Fn
More informationScreening of Millet (Pennisetum glaucum L.) Varieties for Salt Tolerance in Semi-Arid Soil of Northern Nigeria
Worl Journl o Ariulturl Sins 6 (4): 374-380, 200 ISSN 87-3047 IDOSI Pulitions, 200 Srnin o Millt (Pnnistum luum L.) Vritis or Slt Tolrn in Smi-Ari Soil o Northrn Niri 2 H. Ykuu, A.L. Nl n I.Y. Duj Dprtmnt
More informationPlanar Upward Drawings
C.S. 252 Pro. Rorto Tmssi Computtionl Gomtry Sm. II, 1992 1993 Dt: My 3, 1993 Sri: Shmsi Moussvi Plnr Upwr Drwings 1 Thorm: G is yli i n only i it hs upwr rwing. Proo: 1. An upwr rwing is yli. Follow th
More informationDecimals DECIMALS.
Dimls DECIMALS www.mthltis.o.uk ow os it work? Solutions Dimls P qustions Pl vlu o imls 0 000 00 000 0 000 00 0 000 00 0 000 00 0 000 tnths or 0 thousnths or 000 hunrths or 00 hunrths or 00 0 tn thousnths
More informationCorresponding author: * ABSTRACT
Plnt Strss 29 Glol Sin Books Diffrntil Rspons of Slt-Snsitiv n Slt-Tolrnt Brssi jun L. Gnotyps to N Applition: Enhnmnt of N-Mtolism n Anti-Oxitiv Proprtis in th Slt-Tolrnt Typ Mnzr H. Siiqui 1,2* Firoz
More informationConstructive Geometric Constraint Solving
Construtiv Gomtri Constrint Solving Antoni Soto i Rir Dprtmnt Llngutgs i Sistms Inormàtis Univrsitt Politèni Ctluny Brlon, Sptmr 2002 CGCS p.1/37 Prliminris CGCS p.2/37 Gomtri onstrint prolm C 2 D L BC
More informationA PROPOSAL OF FE MODELING OF UNIDIRECTIONAL COMPOSITE CONSIDERING UNCERTAIN MICRO STRUCTURE
18 TH INTERNATIONAL CONFERENCE ON COMPOSITE MATERIALS A PROPOSAL OF FE MODELING OF UNIDIRECTIONAL COMPOSITE CONSIDERING UNCERTAIN MICRO STRUCTURE Y.Fujit 1*, T. Kurshii 1, H.Ymtsu 1, M. Zo 2 1 Dpt. o Mngmnt
More informationCSE 373: More on graphs; DFS and BFS. Michael Lee Wednesday, Feb 14, 2018
CSE 373: Mor on grphs; DFS n BFS Mihl L Wnsy, F 14, 2018 1 Wrmup Wrmup: Disuss with your nighor: Rmin your nighor: wht is simpl grph? Suppos w hv simpl, irt grph with x nos. Wht is th mximum numr of gs
More informationChem 104A, Fall 2016, Midterm 1 Key
hm 104A, ll 2016, Mitrm 1 Ky 1) onstruct microstt tl for p 4 configurtion. Pls numrt th ms n ml for ch lctron in ch microstt in th tl. (Us th formt ml m s. Tht is spin -½ lctron in n s oritl woul writtn
More informationOptimization of Protease Enzyme Production Using Bacillus Sp. Isolated from Different Wastes
Botny Rsrh Intrntionl 2 (2): 83-87, 2009 ISSN 2221-3635 IDOSI Pulitions, 2009 Optimiztion of Prots Enzym Proution Using Billus Sp. Isolt from Diffrnt Wsts 1 1 Uni Boominhn, Rjnrn Rjkumr, 2 2 Plnivl Krpg
More informationThe Influence of Rhizobium and Arbuscular Mycorrhizal Fungi on Nitrogen and Phosphorus Accumulation by Vicia faba
Annls of Botny 94: 251 258, 24 oi:1.193/o/mh135, vill onlin t www.o.oupjournls.org Th Influn of Rhizoium n Arusulr Myorrhizl Fungi on Nitrogn n Phosphorus Aumultion y Vii f YINSUO JIA, VINCENT MYLES GRAY*
More informationSimilarity Search. The Binary Branch Distance. Nikolaus Augsten.
Similrity Srh Th Binry Brnh Distn Nikolus Augstn nikolus.ugstn@sg..t Dpt. of Computr Sins Univrsity of Slzurg http://rsrh.uni-slzurg.t Vrsion Jnury 11, 2017 Wintrsmstr 2016/2017 Augstn (Univ. Slzurg) Similrity
More informationReaction of certain malvaceae cultivars to meloidogyne incognita infection under greenhouse conditions
AGRICULTURE AND BIOLOGY JOURNAL OF NORTH AMERICA ISSN Print: 21517517, ISSN Onlin: 21517525, oi:10.5251/jn.2013.4.3.309.315 2013, SinHuβ, http://www.sihu.org/abjna Rtion o rtin mlv ultivrs to mloiogyn
More informationCORRELATION ANALYSIS OF NUTRIENTS, ENZYMES, AND MICROBIAL BIOMASS IN SOILS WITH PHENOLICS OF Artemisia annua L.
Pk. J. Agri. Si., Vol. 56(1), 171-178; 219 ISSN (Print) 552-934, ISSN (Onlin) 276-96 DOI:1.21162/PAKJAS/19.565 http://www.pkjs.om.pk CORRELATION ANALYSIS OF NUTRIENTS, ENZYMES, AND MICROBIAL BIOMASS IN
More informationS.G. Solomon, L.O. Tiamiyu and U.J. Agaba Department of Fisheries and Aquaculture, Federal University of Agriculture, Makurdi, Nigeria
Pkistn Journl of Nutrition 6 (3): 271-275, 2007 ISSN 1680-5194 Asin Ntwork for Sintifi Informtion, 2007 Efft of Fing Diffrnt Grin Sours on th Growth Prformn n Boy Composition of Tilpi, (Orohromis nilotius)
More informationCycles and Simple Cycles. Paths and Simple Paths. Trees. Problem: There is No Completely Standard Terminology!
Outlin Computr Sin 331, Spnnin, n Surphs Mik Joson Dprtmnt o Computr Sin Univrsity o Clry Ltur #30 1 Introution 2 3 Dinition 4 Spnnin 5 6 Mik Joson (Univrsity o Clry) Computr Sin 331 Ltur #30 1 / 20 Mik
More informationb. How many ternary words of length 23 with eight 0 s, nine 1 s and six 2 s?
MATH 3012 Finl Exm, My 4, 2006, WTT Stunt Nm n ID Numr 1. All our prts o this prolm r onrn with trnry strings o lngth n, i.., wors o lngth n with lttrs rom th lpht {0, 1, 2}.. How mny trnry wors o lngth
More informationHydrogen Peroxide and Nitric Oxide are Involved in Salicylic Acid-Induced Salvianolic Acid B Production in Salvia miltiorrhiza Cell Cultures
Moluls 2014, 19, 5913-5924; oi:10.3390/moluls19055913 Artil OPEN ACCESS moluls ISSN 1420-3049 www.mpi.om/journl/moluls Hyrogn Proxi n Nitri Oxi r Involv in Sliyli Ai-Inu Slvinoli Ai B Proution in Slvi
More informationH. Sule and B.I. Ahmed. Department of Crop Science, Adamawa State University, P.M.B. 25 Mubi, Adamawa State, Nigeria 2
Ami Journl of Entomology 2 (1): 22-30, 2009 ISSN 1995-8994 IDOSI Pulitions, 2009 Efft of Plnt Prout, Applition Rts n Grin Typ on th of R Flour Btl Triolium stnum Hrst (Coloptr: Tnrioni) on Stor Millt (Pnnistum
More informationPotential of calcium silicate to mitigate water deficiency in maize
DOI: http://x.oi.org/.59/7-99. BASIC AREA - Artil Potntil of lium silit to mitigt wtr fiiny in miz Dougls José Mrqus, Mozrt Mrtins Frrir, Alln Klyngr Silv Loto 3, Wllington Alvs Frits, Jinto Assunção Crvlho,
More informationAlgorithmic and NP-Completeness Aspects of a Total Lict Domination Number of a Graph
Intrntionl J.Mth. Comin. Vol.1(2014), 80-86 Algorithmi n NP-Compltnss Aspts of Totl Lit Domintion Numr of Grph Girish.V.R. (PES Institut of Thnology(South Cmpus), Bnglor, Krntk Stt, Ini) P.Ush (Dprtmnt
More informationDrought mitigation potential of Azospirillum inoculation in canola (Brassica napus)
Journl o Appli Botny n Foo Qulity 89, 270-278 (2016), DOI:10.5073/JABFQ.2016.089.035 1* Dprtmnt o Botny, PMAS Ari Ariultur Univrsity Rwlpini, Pkistn Drouht mitition potntil o Azospirillum inoultion in
More informationPaul E. Nyren, Qingwu Xue, Ezra Aberle, Gordon Bradbury, Eric Eriksmoen, Mark
Composition n Proution of Prnnil Grsss for Bioful Proution in Cntrl n Wstrn North Dkot 2 1 3 4 5 Pul E. Nyrn, Qingwu Xu, Ezr Arl, Goron Brury, Eri Eriksmon, Mrk 6 7 7 2 2 2 Hlvorson, Kris Nihols, Mrk Liig,
More informationGrowth and photochemical responses of three crop species treated with textile azo dyes
Rsrh Artil Turk J Bot 36 (2012) 529-537 TÜBİTAK oi:10.3906/ot-1109-6 Growth n photohmil rsponss of thr rop spis trt with txtil zo ys Nurn ÇİÇEK 1, *, Bnu EFEOĞLU 2, Dniz TANYOLAÇ 3, Ysmin EKMEKÇİ 1, Rto
More informationJournal of Integrative Agriculture 2019, 18(2): Available online at ScienceDirect
Journl o Intgrtiv Agriultur 219, 18(2): 428 437 Avill onlin t www.sinirt.om SinDirt RESEARCH ARTICLE Prottiv rols o trhlos in Plurotus pulmonrius uring ht strss rspons LIU Xiu-ming *, WU Xing-li *, GAO
More informationEffect of cadmium supply levels to cadmium accumulation by Salix
Int. J. Environ. Si. Th., 8 (3), 493-5, Summr 211 ISSN 1735-1472 IRSEN, CEERS, IAU T. Ling t l. Efft of mium supply lvls to mium umultion y Slix T. Ling; *R. Jun; Y. Fngk 1 Shool of Environmntl n Muniipl
More information# 1 ' 10 ' 100. Decimal point = 4 hundred. = 6 tens (or sixty) = 5 ones (or five) = 2 tenths. = 7 hundredths.
How os it work? Pl vlu o imls rprsnt prts o whol numr or ojt # 0 000 Tns o thousns # 000 # 00 Thousns Hunrs Tns Ons # 0 Diml point st iml pl: ' 0 # 0 on tnth n iml pl: ' 0 # 00 on hunrth r iml pl: ' 0
More informationA Simple Code Generator. Code generation Algorithm. Register and Address Descriptors. Example 3/31/2008. Code Generation
A Simpl Co Gnrtor Co Gnrtion Chptr 8 II Gnrt o for singl si lok How to us rgistrs? In most mhin rhitturs, som or ll of th oprnsmust in rgistrs Rgistrs mk goo tmporris Hol vlus tht r omput in on si lok
More informationJournal of Solid Mechanics and Materials Engineering
n Mtrils Enginring Strss ntnsit tor of n ntrf Crk in Bon Plt unr Uni-Axil Tnsion No-Aki NODA, Yu ZHANG, Xin LAN, Ysushi TAKASE n Kzuhiro ODA Dprtmnt of Mhnil n Control Enginring, Kushu nstitut of Thnolog,
More informationph controlled assembly of a polybutadiene poly(methacrylic acid) copolymer in water: packing considerations and kinetic limitations
Supplmtry Mtril (ESI) for Soft Mttr This jourl is Th Royl Soity of hmistry 2009 p otroll ssmly of polyuti poly(mthryli i) opolymr i wtr pkig osirtios kiti limittios hristi Fryhough, Athoy J. Ry, Giuspp
More informationInfluence of Magnesium as a Major Contributor of Water Hardness on Some Cardiac Disease Risk Factors
Influn of Mgnsium s Mjor Contriutor of Wtr Hrnss on Som Cri Diss Risk Ftors Engy Smih Sk 1* Zin Khlil El-Awmry 1 Hssn Mohm Sohy 2 Wfi Mikhil 2 1. Rgionl Cntr for Foo n F, Agriulturl Rsrh Cntr, Giz, Egypt
More informationEFFECT OF LOW SALINITY ON CADMIUM ACCUMULATION AND CALCIUM HOMEOSTASIS IN THE SHORE CRAB (CARCINUS MAENAS) AT FIXED FREE Cd 2 CONCENTRATIONS
Environmntl Toxiology n Chmistry, Vol. 22, No. 11, pp. 2761 2767, 2003 2003 SETAC Print in th USA 0730-7268/04 $12.00.00 EFFECT OF LOW SALINITY ON CADMIUM ACCUMULATION AND CALCIUM HOMEOSTASIS IN THE SHORE
More informationDOI: 10.1038/n3296 Supplmntry Figur 1 PN2 PN5 Exprssion o Tt trnsripts uring mryos vlopmnt. x3 x7 x9 x4 2lls 4lls Blstoyst 5C 5C 5C 5C x3 x1 x4 Mrg (5C/5C, PI) x6 x9 x8 x10 100 ng ntioy C ntioy C 200ng
More information