TRANSCRIPTIONAL CHANGES OF BFRUCT3, NHX1, OMT AND PEAMT GENES IN ROOT OF BARLEY (HORDEUM VULGARE L.) UNDER SALINITY STRESS

Size: px

Start display at page:

Download "TRANSCRIPTIONAL CHANGES OF BFRUCT3, NHX1, OMT AND PEAMT GENES IN ROOT OF BARLEY (HORDEUM VULGARE L.) UNDER SALINITY STRESS"

Maude Houston
6 years ago
Views:

1 Pk. J. Bot., (): 73-7, 1. TRANSCRIPTIONAL CHANGES OF, NHX1, AND GENES IN ROOT OF BARLEY (HORDEUM VULGARE L.) UNDER SALINITY STRESS ROGHAYEH GHORBANI 1, SEYYED ABOLGHASEM MOHAMMADI 1,*, MAHMOOD TOORCHI 1 AND SARA GHAFARIAN 3 1 Dprtmnt of Plnt Bring & Biothnology, Fulty of Agriultur, Univrsity of Triz, Triz 1, Irn Cntr of Exlln in Crl Molulr Bring, Univrsity of Triz, Triz 1, Irn 3 Dprtmnt of Cllulr n Molulr Biology, Fulty of Sins, Azrijn Shhi Mni Univrsity, Triz, Irn * Corrsponing uthor s mil: mohmmi@trizu..ir Astrt Th xprssion hngs of,, NHX1, gns in root of rly gnotyps; (snsitiv), Shr3771 (tolrnt) n n Irnin vn lin (tolrnt) wr vlut unr, 1 n mm NCl t hours, 3 ys n 3 wks ftr slt trtmnt. of th gns ws nlyz using Rl-Tim PCR Bs on -ΔΔCT t otining from th omprison of iffrnt slinity trtmnts. Anlysis of trnsript lvl of gn rvl uprgultion of this gn in th slt tolrnt gnotyps with prolonging of slt trtmnt urtion n inrs of slinity lvl from 1 to mm NCl. Whrs, gn show up-rgultion in ll th thr gnotyps with inrs of slinity lvl t th rlir stg of slt trtmnt. With inrs of slt lvl to mm NCl, gn show up-rgultion in th vn lin t th rly tim points (h n 3 ys) n in th Shr3771 t th lt tim point (3 wks) ut in xprssion of this gn ws own-rgult. Ky wors: Brly, Gn xprssion, Slinity, Slt rsponsiv gns. Introution Slt strss is on of th most srious limiting ftors for rop growth n proution in th ri rgions. Slinity rus plnt yil y isrupting th vitl funtions of th ll through limiting of wtr sorption n sorption of xss slt (Lopol & Willing, 19). Unr ths onitions, plnts mintin osmoti prssur n ioni ln y th sorption, trnsporttion n istriution of wtr n solutions (Johnson t l., 1; Vrouq t l., ). Slt strss uss mtoli isorrs in plnt lls, whih l to xssiv proution of rtiv oxygn spis (ROS) using progrssiv oxitiv mg suh s lipi oxition, protin strutur hngs, nzym intivtion, loss of pigmnts suh s hlorophyll n ultimtly ll th (Mittlr, ). Plnts vry in trms of tolrn or snsitivity to slinity. Inrsing plnt tolrn to slinity n sltion of suitl gnotyps for plnting in slin rs hs grt griulturl n onomi signifin (Kingsury t l., 19). Brly (Horum vulgr L.) is on of th most tolrnt rls to rought n slinity (Crlli, 197). Th mhnism of slt tolrn in rly, lik most of th plnts, inlus sorption of lss slt, tissu tolrn, umultion of slt in vuols, istintion in sorption of ions suh s K +, N + n So -- y th roots n trnsporttion of thm to th ril prt n vrious iohmil prosss suh s th proution of nzyms, hormons n ntioxints (Spyhll & Dsorough, 199; Gorhm, 199; Bgum & Krmokr, 1999). Th rspons of rly to slinity strss pns on th stg of plnt growth. Th most snsitiv stg to slinity is grmintion n sling stg n with th inrs of g, tolrn to slinity is inrs (Story & Jons, 197). Stuis hv shown tht svrl gns r involv in rspons to slinity (Ozturk t l., ; U t l., ). Gn xprssion in rspons to slt strss is iffrnt in vrious spis n iffrnt growth stgs of plnt (Lig t l., 11). In th rspons to strss, gn xprssion, trnsripts n numrous protins r hng n signifint orrltion xists twn thm. But in most ss, th xt funtion of ths ttriuts is unknown in tolrnt or snsitiv gnotyps (Bry, 1997). High onntrtions of soium ions u to its strutiv fft on th nzyms tivitis, photosynthsis n mtolism, oul vrsly fft th growth of plnts (Niu t l., 199). Plnts pply iffrnt mhnisms suh s limiting th ntry of soium into th ll, inrsing trnsfr of soium out of th ll n storg of soium in th vuol to ru its toxi ffts (Blumwl t l., ; Ahron t l., 3). Rlsing of soium out of lls or its storg in vuols r mit y th tivity of N + /H + ntiportr (NHX) in th plsm n vuolr mmrn (Brkl & Blumwl, 1991). A ky nzym in th synthsis of holin in plnts is whih tlyzs N mthyltion of phosphothnolmin, phospho monothylthnolmin n phospho imthylthnolmin for onvrsion of phosphothnolmin to phosphoholin tht phosphoholin is onvrt to holin uring th stg. Cholin is vitl prursor in th plnt us it is rquir for th synthsis of phosphtiylholin (PC), whih onstituts -% of th ll mmrn (Mou t l., ). Crtin plnts us holin to prou glyintin tht is n osmoprottnt n uss rsistn to slinity, rought n othr strsss (Gorhm, 199). O- mthyltrnsfrs () is lrg fmily of nzyms tht mthylt th oxygn tom in th sonry mtolits suh s phnylpropnois, flvonois n lklois. It plys n importnt rol in th iosynthsis of lignin, ioti strss tolrn n iss rsistn in

2 73 ROGHAYEH GHORBANI ET AL., plnts (Lm t l., 7). It is rport tht invrts protin, lon or in omintion with plnt hormons, is involv in rgultion of plnt vlopmnt, lssifition of rohyrts s wll s ioti n ioti intrtions. gn os invrts protin (Ai tfrutofurnosis3, EC 3..1.), whih is ky mtoli nzym to split suros into t-d- frutos n lph-d-gluos (Fotopoulos, ). In th prsnt stuy, w rport th trnsriptionl rspons of rly v. Shr 3771 n n n vn lin to 1 mm n mm NCl t hours, 3 ys n 3 wks ftr slt trtmnt using rl-tim PCR thniqu. Mtrils n Mthos Plnt mtrils: To invstigt th fft of slinity strss on gn xprssion hngs in rly root, thr gnotyps; (slt snsitiv), Shr3771 (slt tolrn) n n Irnin vn lin (slt tolrn) riv from ross twn Shr n Kvir wr us in th xprimnt. Ss of th gnotyps wr otin from th Univrsity of Wstrn Austrli n S n Plnt Improvmnt Institut, Krj, Irn. Shr3771 is North Afrin lnr n is ommril Austrlin Vrity. Slt Trtmnt n xprimntl onition: Th xprimnt ws onut in hyroponi ultur systm t grnhous. Th gnotyps wr vlut unr 1 n mm NCl trtmnts n root smpl for RNA xtrtion ws hrvst h, 3 ys n 3 wks ftr rhing finl NCl onntrtion of h trtmnt. Th xprimnt ws prform using split plot-ftoril sign with thr rplits n slinity trtmnt ws us s min ftor n omintions of gnotyps n smpling tim s su ftor. Ss wr striliz with soium hypohlorit n grmint in ptri ishs n svn y ol slings of uniform siz wr trnsfrr into lrg sn tnks unr ontroll grnhous (1 h ily light, - µmol m- s-1 photosynthti photon flux nsity (PPFD), thrmo prio ± C y\night, n rltiv humiity /% y/night). Th tnks wr su irrigt n flush four tims ily with moifi Hogln nutrint solution. Eltril onutivity, ph n solution tmprtur wr monitor ily. Slt strss ws impos svn ys ftr th slings wr trnsfrr. NCl onntrtions wr rought up to 1 n mm NCl y inrmnts of mm NCl pr y. CCl ws with NCl to mintin N+/C+ onntrtion rtio of 1:1 on molr sis. RNA isoltion, DNA synthsis n Rl-tim PCR: Totl RNA ws xtrt from rly root smpls using RNX-Plus kit oring to th mnufturr s protool n trt with RNs-fr DNs I. Qulity n quntity of th RNA smpls wr tst y 1% gros formlhy gl ltrophorsis n PioDrop sptrophotomtr, rsptivly. To synthsiz DNA, Frmnts suprsript III Rvrs Trnsripts kit with n oligo(t) primr ws us, following th mnufturr s instrutions. Rl-tim qpcr ws on for h gn in totl volum of 1 μl y ing 1 μl of th DNA, 1. μl forwr n rvrs primrs, 3. μl HO n μl SYBG prmix Ex TqTMII PCR mstr mixtur (TAKARA, Jpn). Th nlysis ws rri out with two rplits for h smpl. qpcr ws prform with PCR onitions of 9 C for minuts, yls of 9 C for sons, primr spifi nnling tmprtur for sons, n 7 C for sons n finl xtnsion t 7 C for minuts. Primrs wr sign to trmin th xprssion of numr of ky gns involv in N+ omprtmnttion n ROS toxifition n inlu mmrs of th, NHX1, n gns (Tl 1). α-tuulin ws us s rfrn gn n t ws quntifi using th omprtiv CT mtho (- CT mtho) s on CT vlus (Livk & Shmittgn, 1). Anlysis of vrin ws prform s on linr mol of th split-plot ftoril sign n mn omprison ws prform y Dunn s multipl rng tst with ritil vlu of p.. Rsults Trnsriptionl hngs in th gn xprssion profil: Th xprssion of gns potntilly involv in plnt ptiv rsponss to slinity ws xmin in th root of hyroponilly-grown plnts. Plnts wr xpos to 1 n mm NCl n th xprssion pttrns of, NHX1, n gns in root wr tst in, Shr3771 n vn lin gnotyps t thr tim points of slt trtmnt: th rly stg ( hours of slt), th intrmit stg (3 ys of slt), n th lt stg (3 wks of slt). Anlysis of vrin for gn xprssion rvl signifint hngs in th xprssion of NHX1 n gns. Trnsriptionl hngs in th gn xprssion profil wr signifint for ll th gns mong tim point of slt trtmnts n mong gnotyps xpt NHX1 gn. Slinity x gnotyps, slinity x tim point n gnotyp x tim point two intrtions n slinity x gnotyp x tim point thr wys intrtion wr signifintly fft th xprssion profils of th gns xpt NHX1 gn whih ws not signifintly fft y slinity x gnotyp n slinity x gnotyp x tim point intrtions (t not shown). Tl 1. Gn spifi primrs for th mplifition of,,, NHX1 n α-tuulin. Gn rvrs primr forwr primrs TTACAAAGCGAGTCTCGCTCG CCAGGAGGATTACGACGACATC AACCTTTCCCCCCATTTCG TCCCTCGTCCCACTATCATACC CAAACATTGCCGGTC GGTTGATCACTCCATCGTGGA NHX1 ACAACATCTGGTCATACTGCCG TACGGTTTTCTGCCTCTGTCACA α-tuulin AGCATGAAGTGGATCCTTGG AGTGTCCTGTCCACCCACTC

3 ROOT OF BARLEY HORDEUM VULGARE UNDER SALINITY STRESS 737 gn: At th rly stg of slt trtmnt ( h), gn ws highly up-rgult in th slt tolrnt vn lin ompr with th vritis unr 1 mm NCl s ompr with ontrol. With prolonging slt trtmnt urtion, trnsript lvl of this gn ws rs in n vn lin. In th roots of Shr 3771, trnsript lvl of ws inrs from h to 3 ys, ut t lt tim point (3 wks) it rs gin (Fig. 1). Unr mm NCl ompr with th ontrol, xprssion of ws inrs t lt stg of trtmnt in slt tolrnt Shr 3771 n vn lin n rs in slt susptil (Fig. 1). Unr mm NCl ompr with 1 mm NCl, gn up-rgult in Shr 3771 n vn lin n own-rgult in gnotyp with inrs slt strss urtion (Fig. 1) h 3y 3wk Shr3771 gn: Anlysis of trnsript lvl of gn rvl tht with prolonging slt trtmnt urtion, it own-rgult slt snsitiv n up rgult in slt tolrnt Shr 3771 vritis unr 1 mm NCl ompr with th ontrol. In vn lin, xprssion of this gn inrs with prolonging of slt urtion from h to 3 ys n thn rs in lt tim point (Fig. ). Unr mm NCl ompr with ontrol, xprssion of this gn ws rs in n vn lin with prolong slt trtmnt urtion, whrs in Shr 3771, its trnsript lvl ws rs from h to 3 ys n thn inrs in lt tim point (Fig. ). In th ll thr gnotyps, xprssion of gn ws signifintly ru with inrs of slinity lvl from 1 to mm NCl with prolong slt trtmnt urtion (Fig. ). gn: Unr 1 mm NCl ompr with th ontrol, 3 ys ftr slt trtmnt, th highst lvl of gn ws osrv in n trnsript lvl of this gn ws rs in Shr 3771 with prolong slt urtion tim ut in trnsript lvl of this gn ws inrs t intrmit tim point n thn rs t lt tim point. In vn lin, t th intrmit tim point, th trnsript lvl of ws rs n thn inrs t th lt tim point (Fig. 3). Compr with th ontrol, unr mm NCl, iffrntil xprssion of th gn t iffrnt tim points of slt trtmnt ws ror t ll th thr gnotyps. In th vn lin n prolong slt trtmnt urtion from hours to 3 ys rsult in own-rgultion of, whrs up-rgultion ws osrv from 3 ys to 3 wks, ut this up-rgultion ws not signifint. For Shr 3771 th xprssion ws inrs from h to 3 ys n thn rs t lt tim point (Fig. 3). Unr mm NCl ompr with 1 mm NCl, with prolong slt trtmnt urtion, th trnsript lvl of this gn ws inrs in Shr3771 ut it ws rs in t intrmit tim point n thn inrs t lt tim point. In vn lin, hngs wr not signifint from h to 3 ys ut in 3 wk tim point xprssion ws highly rs (Fig. 3) mm NCl trtmnt Fig. 1. Mn omprison of xprssion lvl for gn unr ) 1 mm NCl trtmnt ompr with th ontrol, ) mm NCl trtmnt ompr with th ontrol n ) ompr with 1 mm NCl trtmnt h, 3 ys n 3 wks ftr trtmnt. h 3y 3wk - mm NCl trtmnt h 3y 3wk -1 mm NCl trtmnt Shr3771 Shr3771

4 EXprssion 73 ROGHAYEH GHORBANI ET AL., 1 1 Shr Shr h 3y 3wk 1- mm NCl trtmnt 3 1 h 3y 3wk 1- mm NCl trtmnt 1 1 Shr Shr h 3y 3wk 3 1 h 3y 3wk - mm NCl trtmnt - mm NCl trtmnt h 3y 3wk -1 mm NCl trtmnt Shr h 3y 3wk -1 mm NCl trtmnt Shr3771 Fig.. Mn omprison of xprssion lvl for gn unr ) 1 mm NCl trtmnt ompr with th ontrol, ) mm NCl trtmnt ompr with th ontrol n ) ompr with 1 mm NCl trtmnt h, 3 ys n 3 wks ftr trtmnt. Fig. 3. Mn omprison of xprssion lvl for gn unr ) 1 mm NCl trtmnt ompr with th ontrol, ) mm NCl trtmnt ompr with th ontrol n ) ompr with 1 mm NCl trtmnt h, 3 ys n 3 wks ftr trtmnt.

5 ROOT OF BARLEY HORDEUM VULGARE UNDER SALINITY STRESS 739 Disussion Although rly is known s on of th most slttolrnt rop plnt, vrition os xist mong iffrnt vritis. In this stuy, thr gnotyps of rly with iffrntil rspons to slt strss wr us n gn xprssion ws nlyz t iffrnt tim points ftr slt trtmnt. Slinity inus umultion of solul sugrs n ltrs th tivity of sugr mtolism nzyms in plnts. Th up rgultion of xtrllulr invrts () pprs to ommon rspons to vrious ioti n ioti strss rlt stimuli suh slt strss (Roitsh t l., 3). Our rsults show tht xprssion of ws inrs with inrs of slt strss urtion n mount of slinity from 1 to mm NCl t slt tolrnt Shr 3771 n vn lin, ut rs in. (Wli t l., ) stui th xprssion of gn using Morx vrity, 3, n 7 hours ftr slt trtmnt n rport tht th xprssion of th gn rs t th tim prio of 3 hours n inrs t th 7 hours ftr th strss trtmnt. Duy n Singh (1999) rport tht in ri unr slinity, i invrts tivity gn ws rs in shoots of th slt tolrnt vritis n inrs in slt snsitiv vritis. Mny plnts us suros s th mjor form of trnsport ron (Nguyn-Quo & Foyr, 1) n th utiliztion of suros pns on its lvg into gluos n frutos. This rtion is tlyz y two nzyms; suros synths, ytosoli nzym whih is ruil to suros utiliztion in fruit vlopmnt (Sun t l., 199; Wng t l., 1993) n th invrts, hyrols lving suros into th two mono-shris, to mintin th llulr hxoss onntrtion (Yll t l., 19; Shols t l., 199). Inrs lvl of invrts tivity in th lvs of plnts trt with high slt onntrtions inits mjor rqust of hxoss (ontrolling osmoti potntil n ll turgor), sustrts nssry to rspirtory prosss (Musolo t l., 3). In plnts, O-mthyltion is mit y n nzym fmily of O-mthyltrnsfrss (s) tht trnsfr th mthyl groups from th mthyl onor, S-nosyl-Lmthionin (AoMt) to suitl phnoli ptor moluls (Lm t l., 7). In our stuy, th gn highly up-rgult t rly stg of slt strss with inrs slt lvl from 1 to mm NCl, ut with prolong slt urtion th trnsript lvl of this gn ws rs in ll th thr gnotyps. This my init th short-trm rspons of this gn to inrs slt lvl in th ll th thr gnotyps. (Sugimoto t l., 3) rport tht th gn ws xprss onstitutivly in th root of slt-tolrnt rly vrity n th xprssion lvl ws inrs 1. tims y slt strss, ut th slt-snsitiv vrity show no hngs in xprssion of th gn in roots n lvs. (Wli t l., ) rport tht in rly trnsript lvl of gn inrs 3 n 7 hours ftr slt trtmnt ompr with th ontrol. Phosphothnolmin N-mthyltrnsfrs () rlt to th synthsis n umultion of glyintin, wll known omptil solut for osmoti justmnt in plnts unr slt n rought strsss (Gorhm, 199). with inrsing slt lvl from 1 to mm NCl up rgult th xprssion of in shr 3771 t lt tim points (3ys n 3 wks) n in vn-lin t rly tim point (h) ut own-rgult its xprssion in t th ll thr tim points. (U t l., ) nlyz th xprssion of gn in Hrun-Nijyo vrity of rly unr 1 n mm NCl n rport strong xprssion of this gn unr slinity strss ftr 3 ys n 3 wks. Conlusion Rl-tim RT PCR ws us to nlysis th xprssion pttrn of numr of ky gns involv in N + omprtmnttion n ROS toxifition, nmly, NHX1, n in rspons to slt strss in th root of thr rly gnotyps. Slt strss inrs th xprssion of in tolrnt gnotyps with inrs strss urtion n inrs of slinity lvl. This shows long-trm rspons of this gn to slinity strss in th slt tolrnt gnotyps. Whrs, xprssion of gn in ll th thr gnotyps ws signifintly inrs t th rlir stg of slt trtmnt with inrsing mount of slinity. Thrfor, this gn my involv in th rly rspons of slinity strss. It n si tht with inrs of slt lvl from 1 to mm NCl, xprssion of hs signifintly inrs in vn lin t th rly tim point n in Shr3771 t th lt tim point, ut in xprssion of this gn ws own-rgultion. Aknowlgmnt Th uthors grtfully knowlg th fun n lortory filitis provi y th Cntr of Exlln in Crl Molulr Bring, Univrsity of Triz, Irn. Rfrn Ahron, G.S., M.P. Aps, S. Dun, X. Hu n E. Blumwl. 3. Chrtriztion of fmily of vuolr N+/H+ ntiportrs in Ariopsis thlin. Plnt. Soil, 3(1): -. Brkl, B.J. n E. Blumwl Intifition of 17-kD protin ssoit with th vuolr N+/H+ ntiport of Bt vulgris. Pro. Ntl. A. Si., (): Bgum, F. n J. Krmokr Efft of slinity strss on th umultion n istriution of prolin in wht. Rhis, 1(1): -. Blumwl, E., G.S. Ahron n M.P. Aps.. Soium trnsport in plnt lls. Biohim. Biophys. At., 1(1-): 1-1. Bry, E.A Plnt rsponss to wtr fiit. Trns. Plnt. Si., (): -. Crlli, S Yil potntil n rought tolrn of sgrgting popultions of rly in ontrsting nvironmnts. Euphyti, 3(1): -73. Duy, R.S. n A.K. Singh Slinity inus umultion of solul sugrs n ltrs th tivity of sugr mtolizing nzyms in ri plnts. Biol. Plntrum., (): Fotopoulos, V.. Plnt invrtss: strutur, funtion n rgultion of ivrs nzym fmily. J. Biol. Rs., :

6 7 ROGHAYEH GHORBANI ET AL., Gorhm, J Slt tolrn in th Triti: Ion isrimintion in ry n tritil. J. Exp. Bot., 1(): 9-1. Gorhm, J Btins in highr plnts iosynthsis n rol in strss mtolism. In: R.M. Wllsgrov (.), Amino is n thir rivtivs in highr plnts, Soity for Exprimntl Biology Sminr Sris, Vol., Cmrig Univrsity Prss, Cmrig, pp Johnson, U., M. Krlsson, I. Johnsson, S. Gustvsson, S. Sjӧvll, L. Fryss, A.R. Wig n P. Kjllom. 1. Th omplt st of gns noing mjor intrinsi protins in Ariopsis provis frmwork for nw nomnltur for mjor intrinsi protins in plnts. Plnt. Physiol., 1(): Kingsury, R.W., E. Epstin n R.W. Pry. 19. Physiologil rsponss to slinity in slt lins of wht. Plnt. Physiol., 7(): Lm, K.C., R.K. Irhim, B. Bh n S. Dynnn. 7. Strutur, funtion, n volution of plnt O- mthyltrnsfrss. Gnom, (11): Lopol, A.C. n R.P. Willing. 19. Evin for toxiity ffts of slt on mmrns. In: Slinity Tolrn in Plnts. (Es.): Stpls, R.C. n G.H. Tonnissn John Wily n Sons, Nw York, NY, pp Lig, A., M. Ktsuhr, M. Shisk n G. Djir. 11. Aioti strsss moult xprssion of mjor intrinsi protins in rly (Horum vulgr). CR Biol., 33(): Livk, K.J. n T.D. Shmittgn. 1. Anlysis of rltiv gn xprssion t using rl-tim quntittiv PCR n th ΔΔCT mtho. Mthos, (): -. Mittlr, R.. Oxitiv strss, ntioxints n strss tolrn. Trns Plnt Si., 7(9): -1. Mou, Z., X. Wng, Z. Fu, Y. Di, C. Hn, J. Ouyng, F. Bo, Y. Hu n J. Li.. Silning of phosphothnolmin N- mthyltrnsfrs rsults in tmprtur snsitiv ml strility n slt hyprsnsitivity in Ariopsis. Plnt. Cll, 1(9): Musolo, A., M.R. Pnuio n M. Siri. 3. Effts of slinity on growth, rohyrt mtolism n nutritiv proprtis of kikuyu grss (Pnnistum lnstinum Hohst). Plnt. Si., 1(): Nguyn-Quo, B. n C.H.A. Foyr. 1. Rol for futil yls involving invrts n suros synths in suros mtolism of tomto fruit. J. Exp. Bot., (3): 1-9. Niu, X., R.A. Brssn, P.M. Hsgw n J.M. Pro Ion homostsis in NCl strss nvironmnts. Plnt. Physiol., 19(3): Ozturk, Z.N., V. Tlmé, M. Dyholos, C.B. Mihlowski, D.W. Glrith, N. Gozukirmizi, R. Turos n H.J. Bohnrt.. Monitoring lrg-sl hngs in trnsript unn in rought n slt-strss rly. Plnt. Mol. Biol., (): Roitsh, T., M. Blir, M. Hofmnn, R. Prols n A. Sinh. 3. Extrllulr invrts: ky mtoli nzym n PR protin. J. Exp. Bot., (3): 13-. Shols, J.D., N. Bunok, R. Wil n S.A. Rolf Th impt of ru vuolr invrts tivity on th photosynthti n rohyrt mtolism of tomto. Plnt, (): -7. Spyhll, J.P. n S.L. Dsorough Suproxi ismuts, tls, n α-toophrol ontnt of stor potto turs. Plnt. Physiol., 9(3): 11-. Story, R. n R.W. Jons Slt strss n omprtiv physiology in th Grmin. I. Ion rltions of two slt n wtr strss rly vritis, Cliforni Mriout n Arimr. Aust. J. Plnt. Physiol., (): 1-1. Sugimoto, M., Y. Ok, K. Sto, K. Ito n K. Tk. 3. A root-spifi O-mthyltrnsfrs gn xprss in slttolrnt rly. Biosi. Bioth. Bioh., 7(): 9-7. Sun, J., T. Loo, S.J.S. Sung n C.C.J. Blk Suros synths in wil tomto, Lyoprsion hmilwski n tomto fruit sink strngth. Plnt. Physiol., 9(3): U, A., A. Kthirsn, M. In, Y. Nrit, T. Nkmur, W. Shi, T. Tk n J. Bnntt.. Osmoti strss in rly rgults xprssion of iffrnt st of gns thn slt strss os. J. Exp. Bot., (): Vrouq, L., A. Gronin n C. Murl.. Struturfuntion nlysis of plnt quporin AtPIP; 1 gting y ivlnt tions n protons. Biohm. J., 1(3): 9-1. Wli, H., C. Wilson, A. Whi, P. Conmin, X. Cui n T.J. Clos.. nlysis of rly (Horum vulgr L.) uring slinity strss. Funt. Intgr Gnomis., (): Wng, F., A. Snz, M.L. Brnnr n A. Smith Suros synths, strh, umultion n tomto fruit sink strngth. Plnt. Physiol., 11(1): Yll, S., J.D. Hwitt, N.L. Roinson, S. Dmon n A.B. Bnnt. 19. Sink mtolism in tomto fruit. III. Anlysis of rohyrt ssimiltion in wil spis. Plnt. Physiol., 7(3): (Riv for pulition 1 April 17)

Expression pattern of two sugar transporter genes (SuT4 and SuT5) under salt stress in wheat

Expression pattern of two sugar transporter genes (SuT4 and SuT5) under salt stress in wheat POJ 3(6):194-198 (21) ISSN:1836-3644 Exprssion pttrn o two sugr trnsportr gns (SuT4 n SuT5) unr slt strss in wht Fhimh Chrkzi, S. Snz Rmznpour *, Hssn Soltnloo Dprtmnt o Plnt Bring n Biothnology, Gorgn