Supplemental Information. Tunnel Formation Inferred from the I-Form. Structures of the Proton-Driven. Protein Secretion Motor SecDF

Size: px
Start display at page:

Download "Supplemental Information. Tunnel Formation Inferred from the I-Form. Structures of the Proton-Driven. Protein Secretion Motor SecDF"

Transcription

1 Cell Reports, Volume 19 Supplemental Information Tunnel Formation Inferred from the I-Form Structures of the Proton-riven Protein Secretion Motor SecF rata Furukawa, Kunihito Yoshikaie, Takaharu Mori, Hiroyuki Mori, Yusuke V. Morimoto, Yasunori Sugano, Shigehiro Iwaki, Tohru Minamino, Yuji Sugita, Yoshiki Tanaka, and Tomoya Tsukazaki

2 C Figure S1 Comparison of the I forms of SecF and the pseudosymmetrical transmembrane segments, Related to Figure 1 () The crystal structures of SecF (4.0 Å structure, orange;, green; Mol, pink; Mol, purple) were superposed based on the Cterminal TM segments TM7 12. The introduced S-S bond is coloured red. () The membrane region of (coloured) is cross-sectioned at the middle of the TM region viewed from the periplasm (Peri). The asterisk indicates the pseudo-symmetrical axis. The triangular frames indicate the pseudo-symmetrical units. (C) TM1-6 (red), P1-base and TM7-12 (purple), and P4 of are superimposed with the structurally corresponding Cα atoms of the transmembrane regions. The TM regions are numbered. Cyto, cytoplasm. () P1 domain superimposition. The P1-head domain in I form fluctuates even in the crystal (4.0 Å structure, orange;, green; Mol, pink; Mol, purple, P1 domain fragment (P I 3QO), yellow). () RMSs of the transmembrane segments among Mol, and C.

3 Figure S2 Sequence similarities among SecFs, Related to Figure 1 () Sequence alignment of rsecf, TtSecF, and csec. () Sequence alignment of rsecf, TtSecF, and csecf. The T-Coffee sequence alignment of 11 bacterial Secs and SecFs* is shown in CLUSTL W format (Thompson et al., 1994). The alignment at TM1 was manually modified based on the crystal structures. Secondary structures of rsecf are indicated by a for α-helices and b for β-sheets. Residues indicated by asterisks (red) and colons (orange) are perfectly and highly conserved, respectively. Transmembrane regions are shown in the same colours used in Figure 1. The closed triangles indicate conserved 365 and Y662. * mino acid sequences of the Secs and SecFs of the following bacteria were aligned by T-Coffee: einococcus radiodurans, Thermus thermophilus, scherichia coli, quifex aeolicus, acillus subtilis, Haemophilus influenzae, Pseudomonas aeruginosa, Salmonella choleraesuis, Staphylococcus aureus, Vibrio cholera, and Yersinia pestis.

4 C Figure S3 Polypeptide interaction in the cavity of the SecF P1-head, Related to Figure 1 () Close-up view of the cavities of the P1-head. The corresponding residues in. coli SecF are indicated in parentheses. The Fo-Fc electron density map (3.0 σ) in the cavity is shown in blue. () Formation of translocation intermediates (upper) using pp mutants and a 35S-labelled substrate, proomp(l59), which has two cysteine residues that form an intracellular disulfide bond. The loop hampers protein translocation, as shown in (C). Translocated regions of proomp intermediate were detected as protease-resistant bands. ccumulation of the full-length pp derivatives in the cells (lower). *Unrelated samples. (C) Schematic depiction of the photo-crosslinking and reaction schemes. (), () Photo-crosslinking between Sec with pp and 35S-labelled proomp. Samples were either directly analysed by SSPG and phosphor-imaging () or first immunoprecipitated (IP) with an α-sec antibody before electrophoresis () without proteinase K. Solid triangles indicate specifically observed crosslinked products.

5 I form (Mol) Occupied F form (3QP) Reduced C P1 domain fragment (3QO) mpty Ligand Q253(R407) I form (Mol) mpty I form () mpty F Mol Tunnel Open G Mol Tunnel Closed H Tunnel Closed I 3QP Tunnel Closed 5 H406 (Sec T560) 6 N439 (Sec 593) (Sec 519) Y662 (SecF Y209) 10 Figure S4 Cut-away models of the I and F forms of SecF, Related to Figure 2 () () Cut-away models of the surface representations of the P1-head cavities along the dotted line in Figure S3. Mol in the I form (); F form (P I code 3QP) (); P1 domain fragment (P I code 3QO) (C); Mol in the I form () and in the I form (). PG captured by the cavity in Mol is coloured red; Q253, corresponding to csecf R407, which is crosslinked to the substrate in Figure S3, is coloured green. The corresponding positions of PG and Q253 on the 3QP, 3QO, Mol, and P1 domain fragment structures are coloured red (with 50% transparency as a ghost model) and green, respectively, and were generated by the superimposition of each P1- head region. (F) (I) Cut-away models of the surface representations of the tunnel through the TM region along the plane including Cα of 365, viewed from the periplasmic side. Mol (F); Mol (G); (H) and F form (P I code 3QP) (I). Residues located at the tunnel surface at the cut-away point are shown. The corresponding residues in. coli SecF are indicated in parentheses. TM4, 5, 6, and 10 are coloured as in Figure 1.

6 C Peri. TM5 Mol M (365) Mol M (365P) Cyto. Mol Mol M simulation (eprotonated 365) M simulation (Protonated 365) eprotonated 365 Protonated 365 M 200 ns (run1) Mol Y ( ) Mol F Crystal structures G X ( ) Sec precursor MP mature Omp precursor mature MP translocation (%) Omp translocation (%) eprotonated 365 Sec Cys less Y209F Y209N Y209Q Y209 Protonated 365 Figure S5 Structural dynamics of SecF, Related to Figure 3 () Mol, Mol, and were superimposed based on the transmembrane segments and are coloured as in Figure S1 (left). () SecF (deprotonated 365) structure after 200-ns M simulation, (C) SecF (protonated 365) structure after 200-ns M simulation. The M structures are shown in red and superposed on. Close-up views of TM5 (right). The distance between the Cα atoms of S409 (TM5) in and Mol or in each M simulation structure at 200 ns is shown. Cyto, cytoplasm; Peri, periplasm. () Comparison between the crystal structures Mol (red) and (gray). The membrane regions of Mol and are viewed from the periplasm. () Projection of the trajectories of Ca atoms in TM4, 5, 6, 7, and 10 onto the XY plane, where TM4, 6, 7, and 10 were fitted to the initial structure. Magenta and green dots indicate the instantaneous position of Ca atoms in the 365 deprotonation and 365 protonation simulations (every 40 ps), respectively. TM helices in the X-ray crystal structures are illustrated with black () and red (Mol) solid lines. (F) Functional analysis of mutations in csecf(y209), corresponding to rsecf(y662). (upper) Complementation of sec1 (Cs) growth by the indicated mutants. Cells were spotted onto L-agar plates supplemented with 0.4% glucose and 50 mm Na-citrate ph 5.0. The accumulation of SecF was detected by immunoblotting after cultivation in L medium supplemented with 0.4% glucose and 50 mm Na-citrate ph 5.0. (middle) Translocation analysis of csecf mutants. Cells [sec1(cs)] expressing H-Sec variants were subjected to the procedures described in XPRIMNTL PROCURS. (lower) ccumulation of Sec in the cells was detected using anti-h immunoblotting. (G) Fluctuation of conserved Y662 residue conformation in the SecF tunnel in the M simulations. The crystal structures of Mol and Mol are superimposed onto that of. lue dots represent the trajectory of the oxygen atom in the side chain of Y662, obtained from the 200-ns M simulations for deprotonated and protonated 365. These dots were output every 10ps by fitting the TM helices. In the M simulations, the side chain of Y662 underwent a conformational transition between two orientations as observed in the crystal structures.

7 P1-head Peri. P4 P1-base L268C (Sec L422C) I143C (Sec I272C) Peri. 585 (SecF 132) R285 (Sec R439) Cyto. Cyto. TT + TT S-S form 90 Sec 64 S-S form SecF (rsecf) Cys-less (R439C)F F(132C) (R439C)F(132C) Cys-less (R439C)F F(132C) (R439C)F(132C) Cys-less (R439C)F F(132C) (R439C)F(132C) C WT 365N * * MP translocation (%) SecF (csecf) WT Sec(519N)F I143C,L268C Sec(I272C, L422C)F Y662 SecF(Y209) Y662F SecF(Y209F) WT WT 365N I143C,L268C Sec(I272C, L422C)F F β-m ph9 precursor MP mature Omp precursor mature MP translocation (%) Omp translocation (%) S-S form Sec I ph Cys-less (R439C) F(132C) 47 Figure S6 Importance of P1 and P4 dynamics, Related to Figure 4 () (C) Proton influx activity and the importance of P1 flexibility. The introduced Cys residues on the crystal structure (Mol) (). The corresponding residues in. coli SecF are indicated in parentheses. The intracellular ph of. coli L21 cells overexpressing rsecf was determined at external ph 5.5 using the fluorescence of phluorin, a ratiometric ph indicator (). The cellular ph of SecF overexpressed cells was sensitive for lower ph environment. The inactive mutant 365N (Tsukazaki et al., 2011) was used as a negative control. rror bars indicate the S.. TT was added to reduce the disulphide bond between I143C and L268C, which were introduced to fix the flexible P1-head domain. ccumulation of SecF in the cells was detected using anti-poly-his immunoblotting. WT, wild-type. The protein translocation efficiency using corresponding. coli SecF mutants (Tsukazaki et al., 2011) is shown as a reference (C). * The protein translocation efficiency of Y209 mutants was measured in Figure S5. () (F) Importance of P4 and P1-base dynamics. Close-up view of the boundary between P1-base and P4 (Mol) (). The displayed residues replaced with Cys are shown as red representations. The corresponding residues in. coli SecF are indicated in parentheses. Complementation of the sec1(cs) growth defect by double-cys mutants (). Cells were spotted onto L-agar plates supplemented with 1 mm IPTG, 50 mm Tris-HCl (ph 7.0 or 9.0) and 50 µm FeSO 4 (for ph 9.0). isulphide bond formation and expression of SecF were detected by immunoblotting after cultivation in L medium supplemented with 1 mm IPTG, 50 mm Tris-HCl (ph 7.0 or 9.0) and 50 µm FeSO 4 (for ph 9.0). SS-PG was performed under nonreducing (+iodoacetamide (I)) or reducing (+β-m) conditions. The S-S bond formation prevented SecF activity. Protein translocation analysis of csecf mutants (F). Cells [sec1(cs)] expressing H-Sec variants were subjected to the procedures described in XPRIMNTL PROCURS (upper). TT was added to reduce the disulphide bond. isulphide bond formation in vivo is shown (lower). Cross linked signals are indicated with black dots.

8 Movie S1 Formation of the hydrogen-bonded single-file water chain along the tunnel of SecF, Related to Figure 3 Water chain formation was observed three times in the 200-ns M simulation for deprotonated 365 (see Figure 3). The movie (56-65 ns), corresponds to the first event, which occurred around 62 ns. References Lovell, S.C., avis, I.W., rendall, W.., 3rd, de akker, P.I., Word, J.M., Prisant, M.G., Richardson, J.S., and Richardson,.C. (2003). Structure validation by Calpha geometry: phi,psi and Cbeta deviation. Proteins 50, Thompson, J.., Higgins,.G., and Gibson, T.J. (1994). CLUSTL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic cids Res. 22, Tsukazaki, T., Mori, H., chizen, Y., Ishitani, R., Fukai, S., Tanaka, T., Perederina,., Vassylyev,.G., Kohno, T., Maturana,.., et al. (2011). Structure and function of a membrane component SecF that enhances protein export. Nature 474,

9 Table S1. ata collection and refinement statistics of SecF crystals, Related to Figure 1 ata Collection rsecf (WT) rsecf (S-S mutant ) () Wavelength Space group P2 1 C2 P Cell dimensions rsecf (S-S mutant) (Mol, Mol) a, b, c ( ) 93.3, 62.3, , 69.8, , 73.8, α, β, γ ( ) 90.0, 101.7, , 94.9, , 90.0, 90.0 Resolution ( ) ( ) ( ) ( ) Unique reflections 6,301(127) 28,645 (1,409) 47,548 (2,054) Total reflections 182, , ,654 Completeness (%) 36.0 (14.5) 99.0 (98.9) 97.8 (86.4) I/σ (I) 5.5 (0.48) 15.1 (2.2) 12.0 (1.7) Redundancy 2.5 (2.1) 10.2 (6.5) 6.4 (5.0) R sym * 0.16 (0.82) 0.22 (0.83) 0.14 (0.56) CC(1/2) 85.4 (37.9) 92.8 (73.0) 95.5 (81.3) Refinement Resolution ( ) ( ) ( ) ( ) No. reflections 6,267 28,635 45,733 R work / R free 0.333/0.402 (0.374/0.489) 0.203/0.258 (0.224/0.321) 0.212/0.268 (0.243/0.317) No. atoms Protein 9,852 5,545 11,035 Water Others factors ( 2 ) Protein Water Others R.M.S. deviations ond lengths ( ) ond angles ( ) Ramachandran plot statistics (%) Favored regions llowed regions isallowed regions The X-ray diffraction data were processed using HKL2000 (HKL Research). Ramachandran plots were calculated with RMPG (Lovell et al., 2003). The values in parentheses are for highest resolution shell. *R sym =Σ I avg -I i /ΣI i

SI Text S1 Solution Scattering Data Collection and Analysis. SI references

SI Text S1 Solution Scattering Data Collection and Analysis. SI references SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

More information

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

Biophysics 490M Project

Biophysics 490M Project Biophysics 490M Project Dan Han Department of Biochemistry Structure Exploration of aa 3 -type Cytochrome c Oxidase from Rhodobacter sphaeroides I. Introduction: All organisms need energy to live. They

More information

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

More information

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2

More information

SUPPLEMENTARY INFORMATION. doi: /nature07461

SUPPLEMENTARY INFORMATION. doi: /nature07461 Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic

More information

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain

More information

Supplementary Materials for

Supplementary Materials for www.advances.sciencemag.org/cgi/content/full/1/7/e1500263/dc1 Supplementary Materials for Newton s cradle proton relay with amide imidic acid tautomerization in inverting cellulase visualized by neutron

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code

More information

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1

More information

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5 SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,

More information

Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor

Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,

More information

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,

More information

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,

More information

Structure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis

Structure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis Structure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis Xiuying Liu 1,3, Yan Yin 1,2,3, Jinjun Wu 1 and Zhenfeng Liu 1 1 National Laboratory of Biomacromolecules,

More information

Plasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti

Plasmid Relevant features Source. W18N_D20N and TrXE-W18N_D20N-anti Table S1. E. coli plasmids Plasmid Relevant features Source pdg680 T. reesei XynII AA 2-190 with C-terminal His 6 tag optimized for E. coli expression in pjexpress401 Wan et al. (in press) psbn44d psbn44h

More information

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,

More information

Supporting Information

Supporting Information Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

More information

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2

More information

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2 Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1: The HpUreI crystal used for collection of native diffraction data. The crystal belongs to spacegroup P4 2 2 1 2 and has an approximate maximal dimension of 0.25 mm. Supplementary

More information

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,

More information

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling. Chapter 4 Part I Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

More information

FW 1 CDR 1 FW 2 CDR 2

FW 1 CDR 1 FW 2 CDR 2 Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface

More information

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu. Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.108/nature11899 Supplementar Table 1. Data collection and refinement statistics (+TPMP, native) (-TPMP, native) (+TPMP, recombinant) (MgCl ) (MgSO ) Data collection Space group C P 1 C P 1 1 P 1

More information

Supplemental Information

Supplemental Information Supplemental Information Combinatorial Readout of Unmodified H3R2 and Acetylated H3K14 by the Tandem PHD Finger of MOZ Reveals a Regulatory Mechanism for HOXA9 Transcription Yu Qiu 1, Lei Liu 1, Chen Zhao

More information

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier

More information

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon Wentao Chen,, Leopold Kong, Stephen Connelly, Julia M. Dendle,, Yu Liu,, Ian A. Wilson,#, Evan T. Powers, *, Jeffery

More information

CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH

CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH 2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

More information

Acta Cryst. (2014). D70, doi: /s

Acta Cryst. (2014). D70, doi: /s Acta Cryst. (2014). D70, doi:10.1107/s1399004714021166 Supporting information Volume 70 (2014) Supporting information for article: Elucidation of the bicarbonate binding site and insights into the carboxylation

More information

The Potassium Ion Channel: Rahmat Muhammad

The Potassium Ion Channel: Rahmat Muhammad The Potassium Ion Channel: 1952-1998 1998 Rahmat Muhammad Ions: Cell volume regulation Electrical impulse formation (e.g. sodium, potassium) Lipid membrane: the dielectric barrier Pro: compartmentalization

More information

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae

More information

Bacterial protease uses distinct thermodynamic signatures for substrate recognition

Bacterial protease uses distinct thermodynamic signatures for substrate recognition Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,

More information

Potassium channel gating and structure!

Potassium channel gating and structure! Reading: Potassium channel gating and structure Hille (3rd ed.) chapts 10, 13, 17 Doyle et al. The Structure of the Potassium Channel: Molecular Basis of K1 Conduction and Selectivity. Science 280:70-77

More information

Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA

Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten

More information

Tellurite resistance protein/ethidium efflux transporter/ proflavin transporter. Putative inner membrane protein: function unknown

Tellurite resistance protein/ethidium efflux transporter/ proflavin transporter. Putative inner membrane protein: function unknown Additional file 1. Table S1 and Figures S1-4 of Zhang et al. High-level production of membrane proteins in E. coli BL21(DE3) by omitting the inducer IPTG Table S1. Properties of the membrane proteins used

More information

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile

More information

type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,

type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5, Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed

More information

Role of Mitochondrial Remodeling in Programmed Cell Death in

Role of Mitochondrial Remodeling in Programmed Cell Death in Developmental Cell, Vol. 12 Supplementary Data Role of Mitochondrial Remodeling in Programmed Cell Death in Drosophila melanogaster Gaurav Goyal, Brennan Fell, Apurva Sarin, Richard J. Youle, V. Sriram.

More information

Transporters and Membrane Motors Nov 15, 2007

Transporters and Membrane Motors Nov 15, 2007 BtuB OM vitamin B12 transporter F O F 1 ATP synthase Human multiple drug resistance transporter P-glycoprotein Transporters and Membrane Motors Nov 15, 2007 Transport and membrane motors Concentrations

More information

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166), Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

More information

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Supporting Information

Supporting Information Supporting Information Wilson et al. 10.1073/pnas.0804276105 Fig. S1. Sites of oxazolidinone resistance mutations in bacteria and archaea. (a) Secondary structure of the peptidyltransferase ring of the

More information

Ana-Nicoleta Bondar, Coral Muñoz del Val, J. Alfredo Freites, Douglas J. Tobias, and Stephen H. White

Ana-Nicoleta Bondar, Coral Muñoz del Val, J. Alfredo Freites, Douglas J. Tobias, and Stephen H. White Structure 18 Supplemental Information Dynamics of SecY Translocons with Translocation-Defective Mutations Ana-Nicoleta Bondar, Coral Muñoz del Val, J. Alfredo Freites, Douglas J. Tobias, and Stephen H.

More information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

More information

Macromolecular X-ray Crystallography

Macromolecular X-ray Crystallography Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection

More information

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted

More information

Supplementary Information

Supplementary Information Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),

More information

Crystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model.

Crystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model. I. Solving Phases II. Model Building for CHEM 645 Purified Protein Solve Phase Build model and refine Crystal lattice Real Space Reflections Reciprocal Space ρ (x, y, z) pronounced rho F hkl 2 I F (h,

More information

Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate

Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Shidi Zhao a, Laura Restrepo-Pérez b, Misha Soskine c, Giovanni Maglia c, Chirlmin Joo b, Cees Dekker b and Aleksei Aksimentiev

More information

Rho1 binding site PtdIns(4,5)P2 binding site Both sites

Rho1 binding site PtdIns(4,5)P2 binding site Both sites localization Mutation site DMSO LatB WT F77A I115A I131A K134A Rho1 binding site PtdIns(4,5)P2 binding site Both sites E186A E199A N201A R84A-E186A-E199A L131A-K136A-E186A L131A-E186A-E199A K136A-E186A-E199A

More information

Name: TF: Section Time: LS1a ICE 5. Practice ICE Version B

Name: TF: Section Time: LS1a ICE 5. Practice ICE Version B Name: TF: Section Time: LS1a ICE 5 Practice ICE Version B 1. (8 points) In addition to ion channels, certain small molecules can modulate membrane potential. a. (4 points) DNP ( 2,4-dinitrophenol ), as

More information

Supplementary information for:

Supplementary information for: SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.

More information

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics. Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

Nature Structural and Molecular Biology: doi: /nsmb.2938

Nature Structural and Molecular Biology: doi: /nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples

More information

Protein Structure Basics

Protein Structure Basics Protein Structure Basics Presented by Alison Fraser, Christine Lee, Pradhuman Jhala, Corban Rivera Importance of Proteins Muscle structure depends on protein-protein interactions Transport across membranes

More information

IgE binds asymmetrically to its B cell receptor CD23

IgE binds asymmetrically to its B cell receptor CD23 Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps

More information

Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor

Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Presented by Stephanie Lee Research Mentor: Dr. Rob Coalson Glycine Alpha 1 Receptor (GlyRa1) Member of the superfamily

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

More information

Supplementary information

Supplementary information Supplementary information The structural basis of modularity in ECF-type ABC transporters Guus B. Erkens 1,2, Ronnie P-A. Berntsson 1,2, Faizah Fulyani 1,2, Maria Majsnerowska 1,2, Andreja Vujičić-Žagar

More information

Unfolding CspB by means of biased molecular dynamics

Unfolding CspB by means of biased molecular dynamics Chapter 4 Unfolding CspB by means of biased molecular dynamics 4.1 Introduction Understanding the mechanism of protein folding has been a major challenge for the last twenty years, as pointed out in the

More information

Transmembrane Domains (TMDs) of ABC transporters

Transmembrane Domains (TMDs) of ABC transporters Transmembrane Domains (TMDs) of ABC transporters Most ABC transporters contain heterodimeric TMDs (e.g. HisMQ, MalFG) TMDs show only limited sequence homology (high diversity) High degree of conservation

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

Ion Translocation Across Biological Membranes. Janos K. Lanyi University of California, Irvine

Ion Translocation Across Biological Membranes. Janos K. Lanyi University of California, Irvine Ion Translocation Across Biological Membranes Janos K. Lanyi University of California, Irvine Examples of transmembrane ion pumps Protein Cofactor, substrate, etc. MW Subunits Mitoch. cytochrome oxidase

More information

Supporting Information

Supporting Information Supporting Information Sana et al. 10.1073/pnas.1608858113 Fig. S1. Representation of the SPI-6 type VI secretion system. (A) Representation of the SPI-6 genetic locus starting at STM0266 and ending at

More information

Supporting Information. Synthesis of Aspartame by Thermolysin : An X-ray Structural Study

Supporting Information. Synthesis of Aspartame by Thermolysin : An X-ray Structural Study Supporting Information Synthesis of Aspartame by Thermolysin : An X-ray Structural Study Gabriel Birrane, Balaji Bhyravbhatla, and Manuel A. Navia METHODS Crystallization. Thermolysin (TLN) from Calbiochem

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION GP2 Type I-piliated bacteria FAE M cell M cell pocket idc T cell mdc Generation of antigenspecific T cells Induction of antigen-specific mucosal immune response Supplementary Figure 1 Schematic diagram

More information

Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps

Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,

More information

The structure of Aquifex aeolicus FtsH in the ADP-bound state reveals a C2-symmetric hexamer

The structure of Aquifex aeolicus FtsH in the ADP-bound state reveals a C2-symmetric hexamer Volume 71 (2015) Supporting information for article: The structure of Aquifex aeolicus FtsH in the ADP-bound state reveals a C2-symmetric hexamer Marina Vostrukhina, Alexander Popov, Elena Brunstein, Martin

More information

depends on the translocation assembly module nanomachine

depends on the translocation assembly module nanomachine ARTICLE NUMBER: 16064 DOI: 10.1038/NMICROBIOL.16.64 Effective assembly of fimbriae in Escherichia coli depends on the translocation assembly module nanomachine Christopher Stubenrauch 1, Matthew J. Belousoff

More information

Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences

Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10244 a O07391_MYCAV/127-243 NLPC_HAEIN/80-181 SPR_SHIFL/79-183 P74160_SYNY3/112-245 O24914_HELPY/301-437 Q51835_PORGI/68-178 DPP6_BACSH/163-263 YKFC_BACSU/185-292 YDHO_ECOLI/153-263

More information

Supporting Information

Supporting Information Supporting Information Structural Basis of the Antiproliferative Activity of Largazole, a Depsipeptide Inhibitor of the Histone Deacetylases Kathryn E. Cole 1, Daniel P. Dowling 1,2, Matthew A. Boone 3,

More information