Section 4 Professor Donald McFarlane
|
|
- Aldous Warren
- 5 years ago
- Views:
Transcription
1 Characteristics Section 4 Professor Donald McFarlane Lecture 11 Animals: Origins and Bauplans Multicellular heterotroph Cells lack cell walls Most have nerves, muscles, capacity to move at some point in the life cycle Ability to reproduce sexually Specialized sensory structures and nervous system 2 Traditional classifications Most biologists agree kingdom is monophyletic About 35 recognized animal phyla Most likely ancestor a colonial flagellated protist similar to choanoflagellates Some are colonial Some cells my have taken on specialized functions Choanoflagellate cell Sponge cell (choanocyte) 3 (a) Colonial choanoflagellate (b) Sponge 4 1
2 Traditional classification based on body plans 4 main morphological and developmental features used 1. Presence or absence of different tissue types 2. Type of body symmetry 3. Presence or absence of a true body cavity 4. Patterns of embryonic development 1. Tissues Metazoa - all animals Divided into Parazoa (no specialized tissues or organs) Porifera sponges Eumetazoa (more than one type of tissue and organs) Symmetry Eumetazoa are radially symmetrical (Radiata) or bilaterally symmetrical (Bilateria) Bilateral animals have cephalization and dorsal and ventral ends 3 germ layers Radial animals have oral and aboral sides 2 germ layers 7 8 2
3 Number of cell layers Bilateria are triplobalstic 3 layers Radiata are diploblastic 2 layers Cell layers develop during gastrulation Inner layer endoderm Outer layer ectoderm Mesoderm - 3 rd layer in bilateral animals Forms muscles and most other organs 9 10 Blastula (hollow ball) 8-cell stage 8-cell stage
4 Endoderm Archenteron Blastula (hollow ball) Blastula (hollow ball) Ectoderm 8-cell stage Gastrulation Gastrula Mesoderm Blastopore 8-cell stage Gastrulation Body cavity True coelom body cavity is completely lined with mesoderm (coelomates) Pseudocoelom coelom is not completely lined by tissue derived from mesoderm (pseudocoelomates) Acoelomates lack a body cavity entirely Fluid-filled body cavity can protect internal organs or be used as hydrostatic skeleton
5 4. Embryonic development Protostome Spiral cleavage determinate Blastopore becomes mouth Deuterostome Radial cleavage is indeterminate- pluripotent stem cells Blastopore becomes anus Other methods of classification Possession of exoskeleton Development of notochord Presence or absence of segmentation Traced to changes in homeotic or Hox genes
6 Changes in Hox Gene Expression Control Body Segment Specialization Hox genes involved in pattern formation in early embryos. Relatively simple changes in the expression patterns of these genes can account for the large variation in arthropod appendage types Hox genes designated 1-13 Shifts in patterns of gene expression in the embryo along the anteroposterior axis govern transition from one type of vertebra to another and short or long necks Mice, chicken, goose, and snake Illustrates descent with modification GAGGTTCGAAGACGATCAGATACCGTCGTAGTTCCGACCATAAACGATG Sponge GAGGTTCGAAGACGATCAGAT ACCGTCGTAGTTCCAACCATAAACGATG Flatworm GAGGTTCGAAGACGATCAGAT ACCGTCGTAGT TCTGACCATAAACGATG Seagull GGGGATCAAAGACGATCAGAT ACCGTCGTAGTCTTAACTATAAACT ATA Paramecium KEY Identical in all four species Identical in two or three species Dissimilar in one animal species Dissimilar in the protist Fig
7 Similarities between traditional and molecular phylogeny 1. The clade called Metazoa is monophyletic, meaning all animals came from a single common ancestor. 2. At the earliest stages of evolution, molecular phylogeny supports the traditional view of the split between Parazoa and Eumetazoa. 3. There is also agreement about an early split between Radiata and Bilateria, with most animal phyla belonging to the Bilateria. 4. Molecular phylogeny also agrees that the echinoderms and chordates belong to a clade called the Deuterostomia. 2 additional key differences between traditional and molecular phylogeny 1. Relationships among Bilateria 2. Presence or absence of a body cavity
Outline. v Definition and major characteristics of animals v Dividing animals into groups based on: v Animal Phylogeny
BIOSC 041 Overview of Animal Diversity: Animal Body Plans Reference: Chapter 32 Outline v Definition and major characteristics of animals v Dividing animals into groups based on: Body symmetry Tissues
More informationv Scientists have identified 1.3 million living species of animals v The definition of an animal
Biosc 41 9/10 Announcements BIOSC 041 v Genetics review: group problem sets Groups of 3-4 Correct answer presented to class = 2 pts extra credit Incorrect attempt = 1 pt extra credit v Lecture: Animal
More informationBiosc 41 9/10 Announcements
Biosc 41 9/10 Announcements v Genetics review: group problem sets Groups of 3-4 Correct answer presented to class = 2 pts extra credit Incorrect attempt = 1 pt extra credit v Lecture: Animal Body Plans
More information8/23/2014. Introduction to Animal Diversity
Introduction to Animal Diversity Chapter 32 Objectives List the characteristics that combine to define animals Summarize key events of the Paleozoic, Mesozoic, and Cenozoic eras Distinguish between the
More informationChapter 32, 10 th edition Q1.Which characteristic below is shared by plants, fungi, and animals? ( Concept 32.1)
Chapter 32, 10 th edition Q1.Which characteristic below is shared by plants, fungi, and animals? ( Concept 32.1) A) They are multicellular eukaryotes. B) They are heterotrophs. C) Their cells are supported
More informationAnimal Diversity. Features shared by all animals. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers
Animal Diversity Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers Nutritional mode Ingest food and use enzymes in the body to digest Cell structure and
More informationAn Introduction to Animal Diversity
Chapter 32 An Introduction to Animal Diversity PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationAn Introduction to Animal Diversity
Chapter 32 An Introduction to Animal Diversity PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: Welcome to Your Kingdom The animal kingdom
More informationAn Introduction to Animal Diversity
Chapter 32 An Introduction to Animal Diversity PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions
More informationChapter 32 Introduction to Animal Diversity. Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings
Chapter 32 Introduction to Animal Diversity Welcome to Your Kingdom The animal kingdom extends far beyond humans and other animals we may encounter 1.3 million living species of animals have been identified
More information1. General Features of Animals
Chapter 32: An Overview of Animal Diversity 1. General Features of Animals 2. The History of Animals 1. General Features of Animals General Characteristics of Animals animals are multicellular eukaryotic
More informationBIOLOGY. Chapter 27 Introduction to Animal Diversity
BIOLOGY Chapter 27 Introduction to Animal Diversity Fig. 32-1 An Overview of Animal Diversity Multicellular Nutrition mode: Heterotrophic (ingestion) Cell structure & specialization Tissues develop from
More informationBIOLOGY - CLUTCH CH.32 - OVERVIEW OF ANIMALS.
!! www.clutchprep.com Animals are multicellular, heterotrophic eukaryotes that feed by ingesting their food Most animals are diploid, and produce gametes produced directly by meiosis Animals lack cell
More informationAnimal Diversity. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers 9/20/2017
Animal Diversity Chapter 32 Which of these organisms are animals? Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers Animals share the same: Nutritional
More informationANIMAL DIVERSITY AND THE EVOLUTION OF BODY PLANS
ANIMAL DIVERSITY AND THE EVOLUTION OF BODY PLANS GENERAL FEATURES OF ANIMALS Heterotrophy - obtain energy and organic molecules by ingesting other organisms Multicellularity - Many have complex bodies
More informationAnimal Origins and Evolution
Animal Origins and Evolution Common Features of Animals multicellular heterotrophic motile Sexual reproduction, embryo Evolution of Animals All animals are multicellular and heterotrophic, which means
More informationIntroduction to Animal Diversity Lecture 7 Winter 2014
Introduction to Animal Diversity Lecture 7 Winter 2014 Evolution of Animals 1 Prokaryotes Eukaryotes Prokaryotes No nucleus Nucleoid region Simple No membrane bound organelles Smaller (1-5 nm) Evolutionarily
More informationBIOLOGY. An Introduction to Animal Diversity CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson
CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 32 An Introduction to Animal Diversity Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick A Kingdom of Consumers
More informationChapter 32 Introduction to Animal Diversity
Chapter 32 Introduction to Animal Diversity Review: Biology 101 There are 3 domains: They are Archaea Bacteria Protista! Eukarya Endosymbiosis (proposed by Lynn Margulis) is a relationship between two
More informationBIOLOGY. An Overview of Animal Diversity CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson
CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 32 An Overview of Animal Diversity Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Concept 32.1: Animals are
More informationWhat Is an Animal? Section 25.1 Typical Animal Characteristics. I. Characteristics of Animals. Biology II Mrs. Michaelsen
What Is an Animal? Section 25.1 Typical Animal Characteristics Biology II Mrs. Michaelsen I. Characteristics of Animals A. All animals are eukaryotic, multicellular, have ways of moving to reproduce, obtain
More informationLearning Objectives. The Animal Kingdom: An Introduction to Animal Diversity. Sexual Reproduction
Learning Objectives The Animal Kingdom: An Introduction to Animal Diversity Chapter 29 What characters are common to most animals? Advantages and disadvantages of different environments Searching for relationships
More informationChapter 32. Objectives. Table of Contents. Characteristics. Characteristics, continued. Section 1 The Nature of Animals
Introduction to Animals Table of Contents Objectives Identify four important characteristics of animals. List two kinds of tissues found only in animals. Explain how the first animals may have evolved
More informationAn Overview of Animal Diversity
Figure 32.1 CAMPBELL BIOLOGY Figure 32.1a A Kingdom of Consumers TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson! Most animals are mobile and use traits such as strength, speed, toxins, or camouflage
More information3. Choanoflagellates resemble what? What is the significance of this resemblance?
I. Animal Diversity 1. What are some basic characteristics of the animal kingdom? What characteristics make them different from plants? - Eukaryotic, heterotrophic (we don t make our own food), we store
More informationA. Incorrect! Sponges are mostly marine animals. This is a feature of sponges.
College Biology - Problem Drill 15: The Evolution of Animal Diversity Question No. 1 of 10 1. Which is not a feature of the phyla porifera- sponges? Question #01 (A) Most are marine animals. (B) They have
More informationRevision Based on Chapter 25 Grade 11
Revision Based on Chapter 25 Grade 11 Biology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. A cell that contains a nucleus and membrane-bound organelles
More informationBiology 11. The Kingdom Animalia
Biology 11 The Kingdom Animalia Objectives By the end of the lesson you should be able to: Describe the 5 ways we classify animals Symmetry Germ layers Body plan Segmentation Animal Evolution Hank Video
More informationAn Introduction to Animal Diversity
Chapter 32 An Introduction to Animal Diversity Lecture Outline Overview: Welcome to Your Kingdom Biologists have identified 1.3 million living species of animals. Estimates of the total number of animal
More informationIntroduction to Animal Kingdom. Invertebrates and Vertebrates
Introduction to Animal Kingdom Invertebrates and Vertebrates Introduction To Animals Vertebrate animal with a backbone. Invertebrate animal without a backbone; includes more than 95% of all animal species
More informationInstructor Information!
Instructor Information Dr. Anne Boettger Office: 610-430-4601 email: aboettger@wcupa.edu Schmucker North 475 Office hours: Monday 1-2 pm Tuesday/Thursday 9-11am otherwise by appointment All pertinent information
More informationWorkshop: The Evolution of Animalia body symmetry embryonic germ layers ontogenetic origins I. What is an Animal? II. Germ Layers
Workshop: The Evolution of Animalia by Dana Krempels Perhaps even more than the other Eukarya, Animalia is characterized by a distinct progression of complexity in form and function as one moves from the
More informationBiology 211 (1) Exam 2 Worksheet!
Biology 211 (1) Exam 2 Worksheet Chapter 33 Introduction to Animal Diversity Kingdom Animalia: 1. Approximately how many different animal species are alive on Earth currently. How many those species have
More informationFeatures of the Animal
Features of the Animal Kingdom Bởi: OpenStaxCollege Even though members of the animal kingdom are incredibly diverse, animals share common features that distinguish them from organisms in other kingdoms.
More informationLecture XII Origin of Animals Dr. Kopeny
Delivered 2/20 and 2/22 Lecture XII Origin of Animals Dr. Kopeny Origin of Animals and Diversification of Body Plans Phylogeny of animals based on morphology Porifera Cnidaria Ctenophora Platyhelminthes
More informationPage 1. Skill: Knowledge/Comprehension. Skill: Application/Analysis. Skill: Knowledge/Comprehension
Chapter 32 An Introduction to Animal Diversity Multiple-Choice Questions 1) Which of the following terms or structures is properly associated only with animals? A) Hox genes B) cell wall C) autotrophy
More informationKINGDOM ANIMALIA CHARACTERISTICS
KINGDOM ANIMALIA CHARACTERISTICS EUKARYOTIC MULTICELLULAR HETEROTROPHIC (by ingestion) MOVE AT SOME POINT IN LIFE (not all - sponges are sessile) DIGEST FOOD TO GET NUTRIENTS LACK CELL WALLS CHARACTERISTICS
More informationChapter 8-9 Intro to Animals. Image from:
Chapter 8-9 Intro to Animals Image from: http://animaldiversity.ummz.umich.edu/index.html Zoology Definition: the scientific study of the behavior, structure, physiology, classification, and distribution
More informationIntroduction to Animals
Introduction to Animals Moving Forward Quizlet Each section we cover, 1 group will go to our class on Quizlet and create 20 flash cards on the topic (/5mks) If I warn you about talking while I m talking,
More informationAre these organisms. animals or not?
1 2 3 4 5 Are these organisms 6 7 8 animals or not? 9 10 11 12 13 14 15 16 1 2 3 4 5 6 7 8 9 10 11 12 Typical Animal Characteristics Eukaryotic Multicellular Ability to move Reproduce Obtain food (heterotrophic)
More informationChapter 32 Intro to Animals. Image from:
Chapter 32 Intro to Animals Image from: http://animaldiversity.ummz.umich.edu/index.html Animals Invertebrates (animals without a backbone) Porifera Cnidaria Worms Mollusks Echinoderms Arthropods Animals
More informationWhat defines the zygote, the blastula, and the gastrula? Draw pictures.
What makes a multicellular organism multicellular? a) Multiple cells b) Multiple cells that work together c) Specialized cells d) Multiple specialized cells that work together What defines the zygote,
More information1/30/2009. Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display.
CHAPTER 9 Architectural Pattern of an Animal New Designs for Living Zoologists recognize 34 major phyla of living multicellular animals Survivors of around 100 phyla that appeared 600 million years ago
More informationWorkshop: The Evolution of Animalia body symmetry embryonic germ layers ontogenetic origins I. What is an Animal?
Workshop: The Evolution of Animalia by Dana Krempels Perhaps even more than the other Eukarya, Animalia is characterized by a distinct progression of complexity in form and function as one moves from the
More informationKingdom Animalia. Zoology the study of animals
Kingdom Animalia Zoology the study of animals Summary Animals are multicellular and eukaryotic. consume and digest organic materials thereby being heterotrophs. Most are motile at some time in their lives.
More informationIntroduction to Animals
Introduction to Animals Characteristics of Animals multicellular Except for sponges, animal cells are arranged into tissues. Tissues are necessary to produce organs and organ systems. Tissues, organs,
More informationResources. Visual Concepts. Chapter Presentation. Copyright by Holt, Rinehart and Winston. All rights reserved.
Chapter Presentation Visual Concepts Transparencies Standardized Test Prep Introduction to Animals Table of Contents Section 2 Animal Body Systems Objectives Identify the features that animals have in
More informationAnimals. What are they? Where did they come from? What are their evolutionary novelties? What characterizes their diversification?
Animals What are they? Where did they come from? What are their evolutionary novelties? What characterizes their diversification? What synapomorphies unite Animals Multicellular Heterotrophs (Metazoans)?
More informationIf done properly, is based on evolutionary relationships (at least to some extent). Kingdom -> Phylum -> Class -> Order -> Family -> Genus -> species
Taxonomy. (Your text makes a real mess of this. Use these notes as a guide through the book.) Study of classifying and naming organisms. Founded by Linnaeus. If done properly, is based on evolutionary
More informationBrief Introduction to the Animal Kingdom
Brief Introduction to the Animal Kingdom Vocabulary Vertebrate Invertebrate Detritivore Asymmetry Bilateral symmetry Radial symmetry Cephalization Coelum Pseudocoelum Acoelomates Blastula Blastophore Protosome
More informationThe Radiata-Bilateria split. Second branching in the evolutionary tree
The Radiata-Bilateria split Second branching in the evolutionary tree Two very important characteristics are used to distinguish between the second bifurcation of metazoans Body symmetry Germinal layers
More information23.1 Animal Characteristics EQ Although diverse, what common characteristics do all animal share?
23.1 Animal Characteristics EQ Although diverse, what common characteristics do all animal share? Sea Slug 23.1 Animal Characteristics Animals are the most physically diverse kingdom of organisms and all
More informationBacteria, Protists, Fungi, Plants, Animals: Phylogeny and Diversity
Bacteria, Protists, Fungi, Plants, Animals: Phylogeny and Diversity 1/8/2006 Phylogeny 2 1/8/2006 Phylogeny 3 Proteobacteria Chlamydias Spirochetes Cyanobacteria Gram positive bacteria Korarchaeotes Euryarchaeotes,
More informationAnimal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, Rotifera, Annelida
1 Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, Rotifera, Annelida Objectives: Be able to distinguish radial symmetry from bilateral symmetry. Be able to identify which of the phyla
More informationEmbryonic Development. Chapters 32-34: Animal Diversity AP Biology Fig Zygote Cleavage Blastocoel. Cleavage.
Chapters 32-34: Animal Diversity AP Biology 2012 1 Animal Characteristics Heterotrophs Multicellular Eukaryotes Cells lack cell walls Bodies held together by structural proteins like collagen Contain nervous
More information31.1 What Evidence Indicates the Animals Are Monophyletic?
31.1 What Evidence Indicates the Animals Are Monophyletic? What traits distinguish the animals from the other groups of organisms? In contrast to the Bacteria, Archaea, and most microbial eukaryotes, all
More informationBIO 170 General Biology I Spring 2014 Freeman Lecture Exam 1
BIO 170 General Biology I Spring 2014 Freeman Lecture Exam 1 Part A 1) This is part Aof the lecture exam. Please choose the answer a below: a. Choose this answer b. Do not choose this answer 2) How many
More informationInvertebrate Survey Lab
Answer these questions before lab. 1. What kingdom do all animals fall into? a. Protist b. Animalia c. Eukarya 2. How many phyla of invertebrates are in appendix E on pages 1074-1076? a. 9 b. 7 c. 8 3.
More informationBIO 221 Invertebrate Zoology I Spring Correction: Porifera. Lower Metazoan Clades: Choanoflagellata Porifera Placozoa Cnidaria Ctenophora
BIO 221 Invertebrate Zoology I Spring 2010 Stephen M. Shuster Northern Arizona University http://www4.nau.edu/isopod Lecture 6 Correction: Porifera a. Are distinct from the Placozoa by: 1. Have collar
More informationThe Evolution of Animal Diversity. Dr. Stephen J. Salek Biology 130 Fayetteville State University
The Evolution of Animal Diversity Dr. Stephen J. Salek Biology 130 Fayetteville State University Create your own animal? Start with a basic plant. Make the plant into a simple animal such as a worm. Consider:
More informationEukaryote Phylogeny. Glycogen. Kingdom Animalia. Amoebozoa Animalia. Plantae. Chromalveolata Rhizaria. Fungi. Excavata
Eukaryote Phylogeny most protozoans, brown algae, & water molds Excavata Chromalveolata Rhizaria Plantae Amoebozoa Animalia Fungi cpsts. w/ 2 memb. chitin, hyphae glycogen eukaryotic cells (nucleus, etc.)
More informationChapter 32: An Introduction to Animal Diversity
Chapter 32: An Introduction to Animal Diversity Chapter 32: An Introduction to Animal Diversity Name Period Concept 32.1 Animals are multicellular, heterotrophic eukaryotes with tissues that develop from
More informationQuestions in developmental biology. Differentiation Morphogenesis Growth/apoptosis Reproduction Evolution Environmental integration
Questions in developmental biology Differentiation Morphogenesis Growth/apoptosis Reproduction Evolution Environmental integration Representative cell types of a vertebrate zygote => embryo => adult differentiation
More informationUnit 10: Animals Guided Reading Questions (80 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 32 An Introduction to Animal Diversity 1. Define the following
More informationOverview of Animal Diversity
Chapter 32 CHAPTER Overview of Animal Diversity Chapter Outline 32.1 Some General Features of Animals 32.2 Evolution of the Animal Body Plan 32.3 The Classification of Animals 32.4 The Roots of the Animal
More informationBIOS1101 Lab Notes. Contents ANIMALS. Lab 1: Animal Diversity invertebrates. Lab 2: Animal Diversity 2 vertebrates
Contents ANIMALS Lab 1: Animal Diversity invertebrates Lab 2: Animal Diversity 2 vertebrates Lab 3: Animal Structure 1 Gross morphology Lab 4: Animal Structure 2 Histology Lab 5: The Nervous System & Sensory
More informationINVERTEBRATE DIVERSITY
INVERTEBRATE DIVERSITY 1 INVERTEBRATES Animals that lack a backbone Invertebrates 2 1 ANIMAL DEVELOPMENT Meiosis Egg Sperm Zygote Adult Blastula hollow ball of cells in a developing animal Gastrula Stage
More informationOpenStax-CNX module: m Animal Phylogeny * OpenStax. Abstract. 1 Constructing an Animal Phylogenetic Tree
OpenStax-CNX module: m44658 1 Animal Phylogeny * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able
More informationA mind is a fire to be kindled, not a vessel to be filled.
A mind is a fire to be kindled, not a vessel to be filled. - Mestrius Plutarchus, or Plutarch, a leading thinker in the Golden Age of the Roman Empire (lived ~45 125 A.D.) Lecture 2 Distinction between
More informationThe Animals, or Metazoa. Approximate proportions of animal species presently known; The true diversity of animals may be more than 90% Arthropods
The Animals, or Metazoa Are some of the best-studied organisms Comprise over a million known species Originated c. the Cambrian (~550 MYA) Most animal phyla are marine; however, due to the diversity of
More informationSuperphylum Deuterostomia
Superphylum Deuterostomia Bởi: OpenStaxCollege The phyla Echinodermata and Chordata (the phylum in which humans are placed) both belong to the superphylum Deuterostomia. Recall that protostome and deuterostomes
More informationInvertebrate Diversity
CHAPTER 23 Invertebrate Diversity Summary of Key Concepts Concept 23.1 Diverse animals share several key characteristics. (pp. 494 496) More than a million living species of animals are organized into
More informationIntroduction to Animal Diversity. Chapter 23.1, 23.2 and additional
Introduction to Animal Diversity Chapter 23.1, 23.2 and additional 1 Think of an Animal... Does your choice have hair or fur? Does it have a skeleton? Over a million species of animals described 95% have
More informationChapter 9. Benefits of Being Large. Levels of Organization in Organismal Complexity. Hierarchical Organization of Animal Complexity. Fig. 9.
Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 9 Architectural Pattern of an Animal Levels of Organization in Organismal Complexity Zoologists recognize
More information6 characteristics blastula
Animals Characteristics The animal kingdom is divided into approximately 35 phyla with diverse species. However, all organisms in the animal kingdom share these 6 characteristics Eukaryotic Lack cell walls
More informationPhysiological Evolution of Animals. Principles of Animal Physiology, 3e (Moyes/Schulte)
Principles of Animal Physiology Canadian 3rd Edition Moyes TEST BANK Full download at: https://testbankreal.com/download/principles-of-animal-physiologycanadian-3rd-edition-moyes-test-bank/ Chapter 2 Physiological
More informationNumber of Species. Taxonomy and Animal Phylogeny. Approx. 1.5 million species known. Taxonomy = Systematics = Phylogeny. Miller and Harley Chap.
Taxonomy and Animal Phylogeny Miller and Harley Chap. 7 Number of Species Approx. 1.5 million species known Taxonomy = Systematics = Phylogeny 1 Taxonomic Hierarchy Carolus Linnaeus (1707-1778) Kingdom
More informationClassification. The three-domains. The six-kingdom system. The traditional five-kingdom system. Bacteria Archaea Eukarya
Classification The three-domains Bacteria Archaea Eukarya The six-kingdom system Bacteria Archaea Protista Plantae Fungi Animalia The traditional five-kingdom system Monera Protista Plantae Fungi Animalia
More informationUnit 10: Animals Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 32 An Introduction to Animal Diversity 1. Define the following
More informationComparative Anatomy Biology 440 Fall semester
Comparative Anatomy Biology 440 Fall semester TuTh 10:00 11:15 G23 Lab at 1:00 in 3106 or 3108 Comparative Anatomy Biology 440 Spring semester TuTh 11:30-12:45 G23 Lab at 2:00 in either 3108 or 3106 Dr.
More informationLecture 5 Sex Determination and genes influenced by sex (7/08/17)
Lecture 5 Sex Determination and genes influenced by sex (7/08/17) Antigen antibody reaction - Any molecule which induces an immune response is called an antigen (antibody generator) - Antibodies = immunoglobulins
More informationNumber of Species. Taxonomy and Animal Phylogeny. Approx. 1.5 million species known. Taxonomy = Systematics = Phylogeny. Miller and Harley Chap.
Taxonomy and Animal Phylogeny Miller and Harley Chap. 7 Number of Species Approx. 1.5 million species known Taxonomy = Systematics = Phylogeny 1 Taxonomic Hierarchy Carolus Linnaeus (1707-1778) Kingdom
More informationBIOLOGY. An Introduction to Invertebrates CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson
CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 33 An Introduction to Invertebrates Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Figure 33.UN08 Metazoa Eumetazoa
More informationBiology 1030 Winter 2009
Animal Diversity Chapters 32, 33 and 34 (select pages) Living Organisms Three Domains of life Bacteria Archaea Eukarya True nucleus True organelles Heterotrophic Animals Fungi Protists Autotrophic Plants
More informationA Brief Survey of Life s Diversity 1
Name A Brief Survey of Life s Diversity 1 AP WINTER BREAK ASSIGNMENT (CH 25-34). Complete the questions using the chapters of your textbook Campbell s Biology (8 th edition). CHAPTER 25: The History of
More informationBiology 340 Comparative Embryology Lecture 4 Dr. Stuart Sumida. Overview of Pre-Metazoan. and Protostome Development (Insects)
Biology 340 Comparative Embryology Lecture 4 Dr. Stuart Sumida Overview of Pre-Metazoan and Protostome Development (Insects) Plants Fungi Animals In1998 fossilized animal embryos were reported from the
More informationLEARNING OBJECTIVES FOR BY 124 EXAM II. 1. List characteristics that distinguish fungi from organisms in other kingdoms.
LEARNING OBJECTIVES FOR BY 124 EXAM II CHAPTER 31 1. List characteristics that distinguish fungi from organisms in other kingdoms. 2. Explain how fungi obtain their nutrients. 3. Describe the basic body
More informationINTRODUCTION TO ANIMALS
CHAPTER 32 INTRODUCTION TO ANIMALS The diversity of animal life is staggering. Animals have adapted to Earth s lushest environments and to its harshest environments. This Sally Lightfoot crab, Grapsus
More informationCHAPTER 32 INTRODUCTION TO ANIMAL EVOLUTION. Section A: What is an animal?
CHAPTER 32 INTRODUCTION TO ANIMAL EVOLUTION Section A: What is an animal? 1. Structure, nutrition, and life history define animals 2. The animal kingdom probably evolved from a colonial, flagellated protist
More informationNumber of Species. Taxonomic Hierarchy. Representing the Groups. Binomial Nomenclature. Taxonomy and Animal Phylogeny. Carolus Linnaeus ( )
Taxonomy and Animal Phylogeny Number of Species Approx. 1.5 million species known Miller and Harley Chap. 7 Taxonomy = Systematics = Phylogeny Taxonomic Hierarchy Carolus Linnaeus (1707-1778) Kingdom Phylum
More informationSurvey of the Phyla- Animalia, Invertebrates
Survey of the Phyla- Animalia, Invertebrates The Kingdom Animalia is in the domain Eukarya and in the supergroup Unikonta. They are in the group Opisthkonta with fungi. Both groups have different unicellular
More informationLecture V Eukaryotes and the Cambrian Explosion.
Lecture V Eukaryotes and the Cambrian Explosion. I. Early Metabolisms. 1. Heterotrophs: Anaerobic; aerobic; 2. Autotrophs: Anoxic; oxygenic. Some Metabolic Pathways Heterotrophy Pathway Energy Source Initial
More informationWhat is an animal? Introduction to Animals. Germ Layers. Tissues and Organs. Structural Support. Types of Symmetry 11/3/2015
What is an animal? Introduction to Animals Multicellular chemoorganoheterotrophs Eukaryotes that lack cell walls and chloroplasts Have mitochondria Are motile at some point in their lives Contain collagen
More informationOf all the kingdoms of organisms, the animal kingdom is the
26 1 Introduction to the Animal Kingdom Of all the kingdoms of organisms, the animal kingdom is the most diverse in appearance. Some animals are so small that they live on or inside the bodies of other
More informationChapter 24 Introduction to Animals
1 Chapter 24 Introduction to Animals I. Animal characteristics A. General Animal Features Multicellular B. Feeding and Digestion a. acquire nutrients from various sources obtaining nutrients unique to
More informationTHE EVOLUTION OF METAZOAN AXIAL PROPERTIES
THE EVOLUTION OF METAZOAN AXIAL PROPERTIES Mark Q. Martindale Abstract Renewed interest in the developmental basis of organismal complexity, and the emergence of new molecular tools, is improving our ability
More informationAnimal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, and Lophotrochozoa
1 Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, and Lophotrochozoa Objectives: Be able to distinguish radial symmetry from bilateral symmetry. Be able to identify which of the phyla
More informationNatural Sciences 360 Legacy of Life Lecture 07 Dr. Stuart S. Sumida ANIMALIA. (More Similar to Fungi than Plants)
Natural Sciences 360 Legacy of Life Lecture 07 Dr. Stuart S. Sumida ANIMALIA (More Similar to Fungi than Plants) ANIMAL SIMILARITIES PLANTS FUNGI Cell Walls - Immobile - Often need - substrate - Heterotrophs
More informationProterozoic Eon. BIO1130 Organismal Biology. Page 1. Phanerozoic Paleozoic era. Phanerozoic. Paleozoic era. Major Era
Phanerozoic Paleozoic era 1 Geological time scale and building height ( 1floor 60Ma, 72 floors, 12 feet/floor) Major Era Phanerozoic Cenozoic (65 Ma to present time, 72 nd floor) Mesozoic (245-65 Ma, 65
More information