Supporting Information
|
|
|
- Primrose Dixon
- 6 years ago
- Views:
Transcription
1 Supporting Information Control of methylglyoxal synthesis in Bacillus subtilis: Structural basis for the regulatory interaction of the methylglyoxal synthase MgsA with the carbon flux regulator Crh Achim Dickmanns 1 *, Christopher P. Zschiedrich 2, Johannes Arens 1, Iwan Parfentev 3, 4, Jan Gundlach 2, Romina Hofele 3, 4, Piotr Neumann 1, Henning Urlaub 3, 4, Boris Görke 2$, Ralf Ficner 1, and Jörg Stülke 2* 1 Department of Molecular Structural Biology, GZMB, Georg-August-University Göttingen, Germany 2 Department of General Microbiology, GZMB, Georg-August-University Göttingen, Germany 3 Bioanalytical Mass Spectrometry Group, Max Planck Institute for Biophysical Chemistry, Göttingen, Germany 4 Bioanalytics Group, Institute for Clinical Chemistry, University Medical Center Göttingen, Germany These authors contributed equally Table of contents Supporting Figures S1 to S8 Figure S1. The Methylglyoxal synthases form hexamers of identical arrangement in crystal structures. Figure S2. The formation and stability of the MgsA hexamer depends on their environment. Figure S3. The MgsA overall-fold is identical to other Methylglyoxal synthases (Mgs). Figure S4. Structure based sequence alignment of MgsA reveals conserved residues. Figure S5. Intra- and intermolecular crosslinks found in Crh and their respective distances. Figure S6. Intra- and intermolecular crosslinks found in MgsA and their respective distances. Figure S7. Interaction of Crh and MgsA as obtained by blind docking experiments. Figure S8. Determination of cross-linking conditions. S-1
2 Figure S1. The Methylglyoxal synthases form hexamers of identical arrangement in crystal structures. Shown are the hexamers with one monomer depicted in a more prominent color. Left panel: E. coli Mgs (PDBid: 1B93; pale cyan/ blue), Thermotoga maritima (PDBid: 1VMD; wheat), and right panel: Thermus thermophilus (PDBid: 1WO8; light orange/ red) and Thermus spec. (PDBid: 2X6W; light blue/ blue). S-2
3 Figure S2. The formation and stability of the MgsA hexamer depends on their environment. Thawed MgsA was analyzed by SEC-MALS using different buffers as indicated. The addition of Pi or Glycerol shifts the hexamer:dimer ratio of MgsA from about roughly 30:70 (buffer only) to 70:30 or 90:10, respectively. S-3
4 Figure S3. The MgsA overall-fold is identical to other Methylglyoxal synthases (Mgs). This allows to deduce identical residues and the active site region. Top panels. The superimposition reveals an identical arrangement of the secondary structure elements for MgsA from B. subtilis (rainbow coloring from blue to red (N- and C-terminus, respectively)) and the methylglyoxal synthases from E. coli (PDBid: 1B93; pale cyan), Thermotoga maritima (PDBid:1VMD; wheat), Thermus thermophilus (PDBid: 1WO8; light orange) and Thermus spec. (PDBid: 2X8W; light blue). Bottom panels. bsmgsa oriented and colored as in top panel with surface representation added. Identical residues in all four structures known reveal two patches of high identity one on the side and one on top of the molecule (indicated by arrows). See text for details. S-4
5 Figure S4. Structure based sequence alignment of MgsA reveals conserved residues. MgsA from B. subtilis was aligned with Mgs from E. coli (PDBid:1B93) Thermotoga maritima (PDBid:1VMD), Thermus thermophilus (PDBid:1WO8) and Thermus spec. (PDBid: 2X8W). The secondary structure element and their numbering assignment is according to B. subtilis MgsA. Active site residues deduced from E. coli MgsA are highly conserved (marked by blue stars) and additionally involved in catalysis (marked by red stars) are indicated. Light orange ellipsoids indicate conserved hydrophobic residues found in Crh docking simulations. Red arrows indicate highly conserved residues involved in an allosteric pathway (See main text for details). S-5
6 Figure S5. Intra- and intermolecular crosslinks found in Crh and their respective distances. The structures show either (A.) a monomer (PDBid: 1K1C) or (B.) a homodimer (PDBid: 2AK7) with the lysines labelled and represented in stick mode. The connections are indicated as red or blue (for K11- K40) dashed lines and the corresponding distances between the C atoms are shown. S-6
7 Figure S6. Intra- and intermolecular crosslinks found in MgsA and their respective distances. The structures show the hexamer with the lysines represented in stick mode and labelled accordingly. The connections are indicated as red dashed lines and the corresponding distances are shown. A. Intramolecular crosslinks with the Lysines labelled and colored in orange. B. overall view of the hexamer displaying the longer distance intra and intermolecular crosslink between Lys-2 (colored in red) and Lys-12. S-7
8 Figure S7. Interaction of Crh and MgsA as obtained by blind docking experiments. A. Dimer formation of MgsA and Crh as obtained does not interfere with hexamer formation. Two views (top and side) of the MgsA hexamer with six Crh molecules bound are shown. The individual MgsA molecules and their bound Crh molecules are colored identically. B. Detailed presentation of the MgsA-Crh interaction. MgsA is depicted in rainbow coloring with a cyan surface, whereas Crh is presented in orange with the surface in grey. The individual secondary structure elements are indicated, as well as the active site residues (in stick mode) and ions (formate and phosphate) in the active site cavity in sphere mode (overlaid from PDBid: 1B93). S-8
9 Figure S8. Determination of cross-linking conditions. A In vitro chemical cross-linking of MgsA and Crh. The complex of MgsA and Crh was treated with increasing amounts of BS3 to determine the optimal protein:cross-linker ratio. According to the size and a Western blot, bands that represent the complex of MgsA and/ or MgsA-Crh were analyzed by LC-MS. B. In vitro chemical cross-linking of MgsA and Crh either alone or in a complex formed in a 1:1 ratio. The samples were treated with the optimal amounts of BS3 using a 1:50 and 1:100 protein:cross-linker ratio. The bands analyzed by MS are indicated by red boxes. S-9
Impact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier
Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent
Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL
SUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
Time-dependence of key H-bond/electrostatic interaction distances in the sirna5-hago2 complexes... Page S14
Supporting Information Probing the Binding Interactions between Chemically Modified sirnas and Human Argonaute 2 Using Microsecond Molecular Dynamics Simulations S. Harikrishna* and P. I. Pradeepkumar*
Protein synthesis I Biochemistry 302. Bob Kelm February 23, 2004
Protein synthesis I Biochemistry 302 Bob Kelm February 23, 2004 Key features of protein synthesis Energy glutton Essential metabolic activity of the cell. Consumes 90% of the chemical energy (ATP,GTP).
Structure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis
Structure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis Xiuying Liu 1,3, Yan Yin 1,2,3, Jinjun Wu 1 and Zhenfeng Liu 1 1 National Laboratory of Biomacromolecules,
Supplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
Supplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
Structure of the α-helix
Structure of the α-helix Structure of the β Sheet Protein Dynamics Basics of Quenching HDX Hydrogen exchange of amide protons is catalyzed by H 2 O, OH -, and H 3 O +, but it s most dominated by base
SUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
Supporting Information
Supporting Information Decoding Allosteric Networks in Biocatalysts: Rational Approach to Therapies and Biotechnologies Johannes T. Cramer 1,2, Jana I. Führing 1, Petra Baruch 2, Christian Brütting 3,
Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
SUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
Structural characterization of NiV N 0 P in solution and in crystal.
Supplementary Figure 1 Structural characterization of NiV N 0 P in solution and in crystal. (a) SAXS analysis of the N 32-383 0 -P 50 complex. The Guinier plot for complex concentrations of 0.55, 1.1,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space
Acta Cryst. (2014). D70, doi: /s
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021166 Supporting information Volume 70 (2014) Supporting information for article: Elucidation of the bicarbonate binding site and insights into the carboxylation
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
Supporting Information
Supporting Information Allosteric communication disrupted by small molecule binding to the Imidazole glycerol phosphate synthase protein-protein interface. Ivan Rivalta*,#, George P. Lisi #, Ning-Shiuan
Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways
Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford
Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
of the Guanine Nucleotide Exchange Factor FARP2
Structure, Volume 21 Supplemental Information Structural Basis for Autoinhibition of the Guanine Nucleotide Exchange Factor FARP2 Xiaojing He, Yi-Chun Kuo, Tyler J. Rosche, and Xuewu Zhang Inventory of
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
Supporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
Isothermal experiments characterize time-dependent aggregation and unfolding
1 Energy Isothermal experiments characterize time-dependent aggregation and unfolding Technical ote Introduction Kinetic measurements have, for decades, given protein scientists insight into the mechanisms
Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples.
Supplementary Figure 1 Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples. (a-b) SDS-PAGE analysis of the hexamer and heptamer samples. The eluted hexamer
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
Model Mélange. Physical Models of Peptides and Proteins
Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
Supplementary Information
Supplementary Information Single molecule FRET reveals the energy landscape of the full length SAM I riboswitch Christoph Manz, 1,2 Andrei Yu. Kobitski, 1 Ayan Samanta, 3 Bettina G. Keller 4, Andres Jäschke,
Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
Protein synthesis I Biochemistry 302. February 17, 2006
Protein synthesis I Biochemistry 302 February 17, 2006 Key features and components involved in protein biosynthesis High energy cost (essential metabolic activity of cell Consumes 90% of the chemical energy
SUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
Cell Compounds, Bonds, Reactions - 1
Biology 12 Name: KEY Cell Compounds, Bonds, Reactions - 1 Order of Subtopics Covered: 1. Chemical Bonds a. Ionic b. Covalent 2. Water a. Hydrogen Bonds b. Importance 3. Acids & Bases a. ph b. Buffers 4.
Supplementary Information for
Supplementary Information for Structural basis for the inhibition of Mycobacterium tuberculosis L,D-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains Hyoun Sook Kim
RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
Supplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor
Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
SUPPLEMENTARY FIGURES. Figure S1
SUPPLEMENTARY FIGURES Figure S1 The substrate for DH domain (2R,3R,4R,6R,7S,8S,9R)-3,7,9-trihydroxy-5-oxo-2,4,6,8 tetramethylundecanoate) was docked as two separate fragments shown in magenta and blue
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
Viewing and Analyzing Proteins, Ligands and their Complexes 2
2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
Transmembrane Domains (TMDs) of ABC transporters
Transmembrane Domains (TMDs) of ABC transporters Most ABC transporters contain heterodimeric TMDs (e.g. HisMQ, MalFG) TMDs show only limited sequence homology (high diversity) High degree of conservation
SUPPLEMENTARY INFORMATION
Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1
Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.
Supplementary Figure 1 CRBN binding assay with thalidomide enantiomers. (a) Competitive elution assay using thalidomide-immobilized beads coupled with racemic thalidomide. Beads were washed three times
SUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
pyridoxal phosphate synthase
Supplementary Information 13 C-NMR snapshots of the complex reaction coordinate of pyridoxal phosphate synthase Jeremiah W. Hanes, Ivan Keresztes, and Tadhg P. Begley * Department of Chemistry and Chemical
Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Zaixing
Lecture 10 (10/4/17) Lecture 10 (10/4/17)
Lecture 10 (10/4/17) Reading: Ch4; 125, 138-141, 141-142 Problems: Ch4 (text); 7, 9, 11 Ch4 (study guide); 1, 2 NEXT Reading: Ch4; 125, 132-136 (structure determination) Ch4; 12-130 (Collagen) Problems:
Thermophilic organism
Thermophilic organism Thermophiles are organisms that grow and thrive at temperatures (60 80 C) that are often too high for mesophiles most thermophiles are Archaea Some organisms grow at even higher temperatures
Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein
Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises
Supplementary Figure 1 Structure of the Orai channel. (a) The hexameric Drosophila Orai channel structure derived from crystallography 1 comprises six Orai subunits, each with identical amino acid sequences
Supplementary Figure 1
Supplementary Figure 1 The correlation of n-score cutoff and FDR in both CID-only and CID-ETD fragmentation strategies. A bar diagram of different n-score thresholds applied in the search, plotted against
Supporting Information. Structural and functional characterization of human and murine C5a anaphylatoxins
Supporting Information Structural and functional characterization of human and murine C5a anaphylatoxins Janus Asbjørn Schatz-Jakobsen a, Laure Yatime a, Casper Larsen a, Steen Vang Petersen b, Andreas
Supporting Information for: Mechanism of Reversible Peptide-Bilayer. Attachment: Combined Simulation and Experimental Single-Molecule Study
Supporting Information for: Mechanism of Reversible Peptide-Bilayer Attachment: Combined Simulation and Experimental Single-Molecule Study Nadine Schwierz a,, Stefanie Krysiak c, Thorsten Hugel c,d, Martin
SUPPLEMENTARY INFORMATION
Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,
Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should
SUPPLEMENTARY INFORMATION
SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed
SI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
Supplementary Information
Supplementary Information The direct role of selenocysteine in [NiFeSe] hydrogenase maturation and catalysis Marta C. Marques a, Cristina Tapia b, Oscar Gutiérrez-Sanz b, Ana Raquel Ramos a, Kimberly L.
SUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. DOI: 10.1038/NCHEM.2675 Real-time molecular scale observation of crystal formation Roy E. Schreiber, 1 Lothar Houben, 2 Sharon G. Wolf, 2 Gregory Leitus,
T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp
S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S
Nucleotide Second Messenger Signaling in Bacteria
Nucleotide Second Messenger Signaling in Bacteria SPP 1879 Kick-off Meeting 16-17 September, 2016, Harnack-Haus, Berlin-Dahlem, Germany Organizers: Regine Hengge, Mihaela Pruteanu & Christine Kanow-Scheel
Computational Biology 1
Computational Biology 1 Protein Function & nzyme inetics Guna Rajagopal, Bioinformatics Institute, guna@bii.a-star.edu.sg References : Molecular Biology of the Cell, 4 th d. Alberts et. al. Pg. 129 190
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached
Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2
A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.
Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta
mechanisms: Discrete molecular dynamics study
Elucidation of amyloid β -protein oligomerization mechanisms: Discrete molecular dynamics study B. Urbanc 1, M. Betnel 2, L. Cruz 1, G. Bitan 3,4, and D. B. Teplow 3,4 1 Department of Physics, Drexel University,
SUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar
Bacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
CH 3 CH 2 OH +H 2 O CHO. 2e + 2H + + O 2 H 2 O +HCOOH
2 4 H CH 3 2e + 2H + + 2 H 2 2 H CH 2 H 2e + 2H + + 2 H 2 2 H +H 2 CH 2e + 2H + + 2 H 2 2 H +HCH Supplemental Figure S. The three-step 4DM reaction, each step requires two reducing equivalents from ADPH
Figure S1. Interaction of PcTS with αsyn. (a) 1 H- 15 N HSQC NMR spectra of 100 µm αsyn in the absence (0:1, black) and increasing equivalent
Figure S1. Interaction of PcTS with αsyn. (a) 1 H- 15 N HSQC NMR spectra of 100 µm αsyn in the absence (0:1, black) and increasing equivalent concentrations of PcTS (100 µm, blue; 500 µm, green; 1.5 mm,
Supplemental Materials and Methods
Supplemental Materials and Methods Time-resolved FRET (trfret) to probe for changes in the Box A/A stem upon complex assembly U3 MINI was folded and the decay of Fl fluorescence was measured at 20 ºC (see
Supporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing
Biophysics 490M Project
Biophysics 490M Project Dan Han Department of Biochemistry Structure Exploration of aa 3 -type Cytochrome c Oxidase from Rhodobacter sphaeroides I. Introduction: All organisms need energy to live. They
Targeting protein-protein interactions: A hot topic in drug discovery
Michal Kamenicky; Maria Bräuer; Katrin Volk; Kamil Ödner; Christian Klein; Norbert Müller Targeting protein-protein interactions: A hot topic in drug discovery 104 Biomedizin Innovativ patientinnenfokussierte,
Structural basis of PROTAC cooperative recognition for selective protein degradation
SUPPLEMENTARY INFORMATION Structural basis of PROTAC cooperative recognition for selective protein degradation Morgan S. Gadd 1, Andrea Testa 1, Xavier Lucas 1, Kwok-Ho Chan, Wenzhang Chen, Douglas J.
NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
Supporting Information
Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2015 Supporting Information Are intramolecular frustrated Lewis pairs also intramolecular
ICM-Chemist-Pro How-To Guide. Version 3.6-1h Last Updated 12/29/2009
ICM-Chemist-Pro How-To Guide Version 3.6-1h Last Updated 12/29/2009 ICM-Chemist-Pro ICM 3D LIGAND EDITOR: SETUP 1. Read in a ligand molecule or PDB file. How to setup the ligand in the ICM 3D Ligand Editor.
Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
Nature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
Biological Sciences 11 Spring Experiment 4. Protein crosslinking
Biological Sciences 11 Spring 2000 Experiment 4. Protein crosslinking = C - CH 2 - CH 2 - CH 2 - C = H H GA Cl - H 2 N N H 2 Cl - C - CH 2 - CH 2 - CH 2 - CH 2 - CH 2 - CH 2 - C DMS CH 3 CH 3 N - - C -
Fig. 1. Stereo images showing (A) the best fit of the atomic model for F actin and the F actin map obtained by cryo-em and image analysis, and (B) goo
Fig. 1. Stereo images showing (A) the best fit of the atomic model for F actin and the F actin map obtained by cryo-em and image analysis, and (B) good correspondence between the location of Cys374 and
SUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
Supplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release
Supplemental Data Structure of the Rb C-Terminal Domain Bound to E2F1-DP1: A Mechanism for Phosphorylation-Induced E2F Release Seth M. Rubin, Anne-Laure Gall, Ning Zheng, and Nikola P. Pavletich Section
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase