Breeding for freezing tolerance in plants
|
|
|
- Peregrine Hensley
- 5 years ago
- Views:
Transcription
1 Breeding for freezing tolerance in plants Gintaras Brazauskas Lithuanian Research Centre for Agriculture and Forestry
2 Outline Where I am from Freezing tolerance in plants Reverse genetics in winter wheat Association mapping in perennial ryegrass PPP pre-breeding project Future targets
3 LITHUANIAN RESEARCH CENTRE FOR AGRICULTURE AND FORESTRY (LRCAF) was established in 2010 as a merger of three related research institutions: Institute of Agriculture Institute of Horticulture Institute of Forestry Research staff: 183 PhD students: 58 Total staff: 636 Budget: 12 M
4 HISTORY OF THE CENTRE 1911 Agricultural school was established in Dotnuva Dotnuva Agricultural college was set up Breeding Station was founded in Dotnuva Dotnuva experimental station started operating Academy of Agriculture was established in Dotnuva, transferred to Kaunas in A network of experimental stations was established. D. Rudzinskas 1956 Lithuanian Institute of Agriculture was established in Dotnuva Lithuanian Research Centre for Agriculture and Forestry was formed
5 Research programs at the Lithuanian Research Centre for Agriculture and Forestry From single genes to ecosystems
6 Laboratory of Genetics and Physiology Staff: 5 researchers 1 PhD and 2 Bsc students 3 technicians Collaborators: Iowa State University ETH Zurich Aarhus University Research: DNA marker development DH production in wheat Freezing tolerance testing Facilities: DNA laboratory Experimental greenhouse Growth and freezing chambers
7 LITHUANIAN RESEARCH CENTRE 1% FOR AGRICULTURE AND FORESTRY Winter triticale 4% Winter rye 3% Maize 2% INSTITUTE Oat OF AGRICULTURE 3% Pulse crop 2% Potato Sugar beet 1% Spring rape 9% Grasslands 32% Winter rape 4% Spring barley 10% Spring wheat 9% Winter wheat 20% Cultivation area in Lithuania, %
8 Area under wheat in Kha Winter wheat Spring wheat
9 Plant responses to cold (and light) Chilling low above zero temperatures Freezing - below zero temperatures Cold acclimation acquisition of freezing tolerance (easy come easy go) Vernalization - acquisition of competence to flower (takes time and stays) Winter hardiness ability to overwinter
10 Winter versus spring wheat
11 VRN1 controls vernalization Norstar NILs were grown at 20 C and 16-h day from 7 to 42 days and then LT acclimated at 2 C for 28 days. a LT50 versus plant age. b Dissected shoot apices indicating stage of development at the start of LT acclimation. Limin and Fowler, 2006
12 Near-isogenic lines (NILs)
13 Decoupling of Vrn1 and Fr1 Vágújfalvi et al., 2006
14 Wheat transcriptome response to cold (a) Statistically significant two-fold or greater changes (P = 0.05) in transcript abundance in plants exposed to a 4 C for 2 days. (b) Venn diagram showing the number of genes expressed in common between the three varieties after exposure to a cold shock. Winfield et al., 2010
15 Cold acclimation versus cold shock An early light-inducible protein (ELIP) showing a distinct response to a cold shock, but no response to a slow decline in temperature. C, crown; L, leaf; H, Harnesk; P, Paragon; S, Solstice. Winfield et al., 2010
16 Wheat transcriptome response to cold acclimation (a) transcript abundance in plants exposed to a gradual decline in temperature, light intensity and day length; (b) Venn diagrams showing the number of two-fold or greater changes (P = 0.05) in transcript abundance. The values refer to genes that changed in expression during the period days. Winfield et al., 2010
17 Cold response in plant cells ABRE, ABA response element AFP, anti-freeze protein An, annexins CBF, C-repeat binding factor CBP, calcium binding proteins CCH, calcium channel COR, cold-responsive genes CRT, C-repeat elements GLU, glutathione ICE, inducer of CBF expression KIN, kinases and phosphatases LEA, late embryogenesis-abundant PSI/PSII, photosystem I and II RLK, receptor-like kinase ROS, reactive oxygen species Winfield et al., 2010
18 Chilling injury in chilling-sensitive plants Theocharis et al., 2012
19 Cellular processes induced by cold acclimation Theocharis et al., 2012
20 Identification and analysis of FT genes in winter wheat Winter wheat lines and Mutagenesis TILLING population Cold acclimation 0, 2, 4, 6 weeks Mutation detection (HRM analysis) (qrt-pcr analysis) cdna-aflp analysis BLAST analysis Freezing tolerance testing 20
21 AFLP and cdna-aflp
22 cdna-aflp results Crown Leaf A 1000 bp B 1000 bp 1000 bp C 1000 bp D Weeks
23 Differentially expressed genes 2 weeks after the start of cold acclimation Phosphoglycerate kinase, chloroplastic Sucrose synthase 1 Signal recognition particle 54 kda protein, chloroplastic-like ATP-dependent Clp protease ATPbinding subunit ClpC homolog 1 Clp-P protease subunit Leaves Heat-shock protein Serine carboxypeptidase-like Vacuolar-sorting receptor 1 Zinc finger AN1 domain Sucrose + NDP NDP-glucose + fructose Beta-3-tubulin Phototropin-2-like Crown Digalactosyldiacylglycerol synthase 2, chloroplastic
24 TILLING Targeting Induced Local Lesions in Genomes Colbert et al., 2001
25 Mutagenesis and mutation screening (0.4% - 1.0%) Creation of TILLING population ir Winter wheat lines M1 generation (heterozygous and chimeric) M2 seeds M2 generation (segregating) M3 seeds (stored) DNA isolation HRM analysis Exon X Gene X Data Analysis by HRM Software v3.0 Sample Melt 2nd PCR of amplicon with lengths <250 bp 1st PCR region of interest 7500 Fast Real-Time PCR System (Applied Biosystems)
26 Mutation discovery by HRM analysis M631 WT M631 Tm = 79.7 C WT Tm = 80.0 C M692 WT M692 WT Tm = 79.7 C Tm = 80.0 C Aligned curves of fluorescence vs temperature showing wild type (blue) and mutant (red) samples.
27 2 mutations per kb
28 Nonsense-mediated Sucrose synthase 1 mrna decay during cold acclimation in winter wheat Leaf Crown wt wild type M692 missens mutation M631 nonsense mutation A leaf tissue B crown tissue
29 LT50, C Reduced freezing tolerance of M631 0,0 wt ,0 M631-6,0-9,0-12, Cold acclimation, weeks Freezing tolerance of wild type and M631 winter wheat acclimated at 5 C for 0 4 weeks. 29
30 Perennial ryegrass (Lolium perenne L.) The main forage grass species in Denmark and further south and west in Europe Finland: 2%, Estonia: 13%, Norway: 13%, Lithuania: 30% of certified seed sale Superior feed quality and productivity under frequent cutting regimes Is expected to expand further north due to milder winters with shorter periods of snow cover
31 Main problems with perennial ryegrass Susceptibility to low-temperature fungi Inadequate growth cessation in autumn to allow for sufficient cold hardening Can de-harden too early with increased risk of frost injury in spring Festuca arundinacea and L. perenne F. pratensis and L. perenne L. perenne at Vågønes, Bodø
32 PPP perennial ryegrass pre-breeding project Aim: Identify and select new plant materials for development of cultivars with a suitable adaptation to future climates Recombine exotic materials with existing germplasm to create new genetic resources
33 Biparental versus Asociation mapping
34 Linkage disequilibrium (LD) Flint-Garcia et al., 2003
35 LD in plants Mating type Population structure Genetic drift Selection intensity Hamblin et al., 2011
36 Sample preparation for freezing tolerance test Freezing test
37 Regrowth at 3 weeks after freezing Control -4 C -6 C -8 C -10 C -12 C
38 Phenotypic variation for freezing tolerance traits EL electrolyte leakage PTS plant tiller survival PC proline content
39 Correlation between phenotypic traits Trait EL at -8 C EL at -12 C PTS at-8 C PTS at -12 C EL at -8 C - EL at -12 C 0.43*** - PTS at-8 C -0.40*** ns - PTS at -12 C ns -0.49*** 0.46*** - PC ns 0.02 ns ns 0.03 ns EL electrolyte leakage PTS plant tiller survival PC proline content
40 LpIRI1 ice recrystalization inhibition Griffith and Yaish, 2004
41 Controlled ice crystal growth (a) ice crystal morphology in (b) water (c) dilute AFP (d-f) concentrate AFP solution. Scale bar = 10 µm. Recrystallization of ice (g-j) in nonacclimated (NA) and cold-acclimated (CA) winter rye extracts. Scale bar = 1.75 cm. Griffith and Yaish, 2004
42 LpIRI improve FT in Arabidpsis Survival rates and phenotypic appearance of control and transgenic Arabidopsis plants after freezing at -4 C and recovery. From left to right wild-type (Col-0); plants carrying an empty pmdc32 vector (EV-6); transgenic plants overexpressing LpIRI-b; transgenic plants overexpressing LpIRI-a. Zhang et al., 2010
43 Linkage disequilibrium in LpIRI1 ORF 855 bp 52 SNPs (MAF >5) SNP density 1/16 bp 1 INDEL of 15 bp
44 Marker-trait associations in LpIRI1 Wt wild type Rec recombinant EL electrolyte leakage
45 Genotyping by Sequencing (GBS) Elshire et al., 2011
46 Genotyping of 380 PPP populations
47 Evaluation of LT 50 value in perennial ryegrass for PPP (workflow) 1. The collection 2. Cold-acclimation 3. Sample preparation 20 seed per population; 3 replicates; soilless substrate; plants in total. At +2 C for 15 days, 12/12 h photoperiod. Leaves will be trimmed and the tillers will be counted prior the freezing test. 4. Freezing test 5. Regrowth 6. LT 50 calculation 6 freezing temperatures; temperature probes in each cell pack. After freezing plants will be moved to phytotron; regrowth will be evaluated after 21 days. LT 50 values will be calculated for each population.
48
49 GWAFF and Genomic Selection Heffner et al., /75% 10/90%
50
Physiology of Cold Acclimation and Deacclimation of Cool-Season Grasses
Physiology of Cold Acclimation and Deacclimation of Cool-Season Grasses Michelle DaCosta Stockbridge School of Agriculture University of Massachusetts Photo by A. Maddocks Winter 2013-2014 Photo provided
A WEB-BASED MODEL FOR ESTIMATING WINTER SURVIVAL IN CEREALS
A WEB-BASED MODEL FOR ESTIMATING WINTER SURVIVAL IN CEREALS D. B. Fowler 1 and K. Greer 2 1 Crop Development Centre, University of Saskatchewan, Saskatoon, SK S7N 5A8 2 Western Ag Innovations, Saskatoon,
Washington Grain Commission Wheat and Barley Research Annual Progress Reports and Final Reports
Washington Grain Commission Wheat and Barley Research Annual Progress Reports and Final Reports PROJECT #: 30109-5345 Progress report year: 3 of 3 Title: Evaluation And Selection For Cold Tolerance In
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
Investigations into biomass yield in perennial ryegrass (Lolium perenne L.)
Investigations into biomass yield in perennial ryegrass (Lolium perenne L.) Ulrike Anhalt 1,2, Pat Heslop-Harrison 2, Céline Tomaszewski 1,2, Hans-Peter Piepho 3, Oliver Fiehn 4 and Susanne Barth 1 1 2
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
Abiotic Stress in Crop Plants
1 Abiotic Stress in Crop Plants Mirza Hasanuzzaman, PhD Professor Department of Agronomy Sher-e-Bangla Agricultural University E-mail: mhzsauag@yahoo.com Stress Stress is usually defined as an external
Model plants and their Role in genetic manipulation. Mitesh Shrestha
Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
Managing segregating populations
Managing segregating populations Aim of the module At the end of the module, we should be able to: Apply the general principles of managing segregating populations generated from parental crossing; Describe
23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach
Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF
GFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
Lipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
Supplementary Information. Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression
Supplementary Information Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression Liang Jiao Xue, Christopher J. Frost, Chung Jui Tsai, Scott A. Harding
Wheat Genetics and Molecular Genetics: Past and Future. Graham Moore
Wheat Genetics and Molecular Genetics: Past and Future Graham Moore 1960s onwards Wheat traits genetically dissected Chromosome pairing and exchange (Ph1) Height (Rht) Vernalisation (Vrn1) Photoperiodism
Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
Chapter 1 Introduction
Chapter 1 Introduction 1. INTRODUCTION Plants being sessile are exposed to environmental stresses mainly abiotic, caused by non-living effects of environment (temperature extremes, drought, and salinity)
Supplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
Cytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark
Cytokinin Abundant in young, dividing cells Shoot apical meristem Root apical meristem Synthesized in root tip, developing embryos, young leaves, fruits Transported passively via xylem into shoots from
** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
Genetic diversity and population structure in rice. S. Kresovich 1,2 and T. Tai 3,5. Plant Breeding Dept, Cornell University, Ithaca, NY
Genetic diversity and population structure in rice S. McCouch 1, A. Garris 1,2, J. Edwards 1, H. Lu 1,3 M Redus 4, J. Coburn 1, N. Rutger 4, S. Kresovich 1,2 and T. Tai 3,5 1 Plant Breeding Dept, Cornell
Developing summerdormant tall fescue for the southern Great Plains
Developing summerdormant tall fescue for the southern Great Plains Persistence is the major constraint of growing tall fescue in south-central USA 40-60% stand loss in a year Improve persistence Drought
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
Somaclonal Variation
Tissue-culture cycle involves: dedifferentiation in culture proliferation of cells (implies sev. cell generations removed from original differentiated cell) subsequent regeneration to plants no selection
INJURY TO RADIATA PINE AS INFLUENCED BY FREEZING AND THAWING RATE, AND LOW TEMPERATURE DURATION
New Zealand Journal of Forestry Science Vol. 11 No. 1 (1981) 37 INJURY TO RADIATA PINE AS INFLUENCED BY FREEZING AND THAWING RATE, AND LOW TEMPERATURE DURATION I. J. WARRINGTON and A. K. H. JACKSON Plant
Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus. Greening Summit Florida Citrus Growers Institute 2008
Towards the Ultimate Solution: Genetic Resistance to HLB in Commercial Citrus Greening Summit Florida Citrus Growers Institute 2008 Jude Grosser University of Florida, Citrus Research and Education Center,
Cold-Hardiness Testing of Conifer Seedlings1
Cold-Hardiness Testing of Conifer Seedlings1 Karen E. Burr, Stephen J. Wallner, and Richard W. Tinus 2 Abstract.--This paper briefly describes the results of preliminary experiments designed to test four
Crop Development and Components of Seed Yield. Thomas G Chastain CSS 460/560 Seed Production
Crop Development and Components of Seed Yield Thomas G Chastain CSS 460/560 Seed Production White clover seed field Seed Yield Seed yield results from the interaction of the following factors: 1. Genetic
. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
Table S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
Developing and implementing molecular markers in perennial ryegrass breeding
Developing and implementing molecular markers in perennial ryegrass breeding K.F. Smith 1,3, J.W. Forster 2,3, T.A. Ciavarella 1,3, J.L. Dumsday 2, M.P. Dupal 2,3, E.S. Jones 2,3, B.D. Kirkwood 1,3, A.
Climate Change and Plant Reproduction
Quantitative Trait Loci Mapping of Reproductive Traits Involved in Heat Stress Responses in Arabidopsis : Implications for Global Climate Change and Plant Reproduction Lazar Pavlovic, Greta Chiu, Jeffrey
Modeling crop overwintering Focus on survival
Modeling crop overwintering Focus on survival Giulia Vico, VPE April 2th, 21 Modelling of crop survival Air temperature, snow cover Crown temperature detailed models of snow dynamics vs. semi-empirical
SUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
The ways of oat winterhardiness improvement in Poland Bogusław Łapiński and Agnieszka Rachwalska
The ways of oat winterhardiness improvement in Poland Bogusław Łapiński and Agnieszka Rachwalska National Centre for Plant Genetic Resources and Grodkowice Experiment Station of the Plant Breeding and
Biology-Integrated Year-at-a-Glance ARKANSAS STATE SCIENCE STANDARDS
Biology-Integrated Year-at-a-Glance ARKANSAS STATE SCIENCE STANDARDS FIRST SEMESTER FIRST/SECOND SECOND SEMESTER Unit 1 Biochemistry/Cell Division/ Specialization Unit 2 Photosynthesis/ Cellular Respiration
Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence
Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence www.plantcell.org/cgi/doi/10.1105/tpc.110.tt0110 Epigenetics Usually
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
Untitled Document. A. antibiotics B. cell structure C. DNA structure D. sterile procedures
Name: Date: 1. The discovery of which of the following has most directly led to advances in the identification of suspects in criminal investigations and in the identification of genetic diseases? A. antibiotics
From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology
From basic research to crop improvement Dirk Inze VIB-UGent Center for Plant Systems Biology Oct 2017 The Great Challenge By 2050 70% more food on the same land area Growing world population Climate change
THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D.
THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING AnitaHajdu Thesis of the Ph.D. dissertation Supervisor: Dr. LászlóKozma-Bognár - senior research associate Doctoral
SoyBase, the USDA-ARS Soybean Genetics and Genomics Database
SoyBase, the USDA-ARS Soybean Genetics and Genomics Database David Grant Victoria Carollo Blake Steven B. Cannon Kevin Feeley Rex T. Nelson Nathan Weeks SoyBase Site Map and Navigation Video Tutorials:
The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively as positive regulators of salt stress tolerance in rice
Lou et al. BMC Plant Biology (2018) 18:203 https://doi.org/10.1186/s12870-018-1408-0 RESEARCH ARTICLE Open Access The sucrose non-fermenting-1-related protein kinases SAPK1 and SAPK2 function collaboratively
Principles of QTL Mapping. M.Imtiaz
Principles of QTL Mapping M.Imtiaz Introduction Definitions of terminology Reasons for QTL mapping Principles of QTL mapping Requirements For QTL Mapping Demonstration with experimental data Merit of QTL
Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
Growth and Seed Yield in Kentucky Bluegrass. Thomas G Chastain George Hyslop Professor of Crop and Soil Science
Growth and Seed Yield in Kentucky Bluegrass Thomas G Chastain George Hyslop Professor of Crop and Soil Science Central Oregon Grass Seed Urban Grass Seed Winter Wheat Spring Wheat Barley Corn Beans Peas
Supplementary Methods
Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
Arabidopsis thaliana. Lucia Strader. Assistant Professor, Biology
Arabidopsis thaliana Lucia Strader Assistant Professor, Biology Arabidopsis as a genetic model Easy to grow Small genome Short life cycle Self fertile Produces many progeny Easily transformed HIV E. coli
downstream (0.8 kb) homologous sequences to the genomic locus of DIC. A DIC mutant strain (ro- 6
A B C D ts Figure S1 Generation of DIC- mcherry expressing N.crassa strain. A. N. crassa colony morphology. When a cot1 (top, left panel) strain is grown at permissive temperature (25 C), it exhibits straight
Determining the Influence of Temperature on Plants
Lesson C4 2 Determining the Influence of Temperature on Plants Unit C. Plant and Soil Science Problem Area 4. Environmental Factors Affecting Plant Growth Lesson 2. Determining the Influence of Temperature
Genetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
Fei Lu. Post doctoral Associate Cornell University
Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.
The Solute Accumulation: The Mechanism for Drought Tolerance in RD23 Rice (Oryza sativa L) Lines
R ESEARCH ARTICLE ScienceAsia 27 (2001) : 93-97 The Solute Accumulation: The Mechanism for Drought Tolerance in RD23 Rice (Oryza sativa L) Lines Montakan Vajrabhaya, Warunya Kumpun and Supachitra Chadchawan*
CONSTANS is a photoperiod regulated activator of flowering in sorghum
Yang et al. BMC Plant Biology 2014, 14:148 RESEARCH ARTICLE Open Access CONSTANS is a photoperiod regulated activator of flowering in sorghum Shanshan Yang, Brock D Weers, Daryl T Morishige and John E
Duplication of an upstream silencer of FZP increases grain yield in rice
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice
Crop Production and Soil Management Series
Crop Production and Soil Management Series Factors Affecting Cold Hardiness Development FGV-00143 Winter survival of perennial plants is a common problem for amenity, horticultural and agronomic crops
GACE Biology Assessment Test I (026) Curriculum Crosswalk
Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically
EVALUATION OF AVOCADO COLD HARDINESS
Proc. Fla. State Hort. Soc. 88:496-499. 1975. EVALUATION OF AVOCADO COLD HARDINESS R. S. Scorza and W. J. Wiltbank IFAS Fruit Crops Department, Gainesville Abstract Cold hardiness of 'Gainesville' cuttings,
Enduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc.
Enduring Understanding: Change in the genetic makeup of a population over time is evolution. Objective: You will be able to identify the key concepts of evolution theory Do Now: Read the enduring understanding
Essential Questions. Meiosis. Copyright McGraw-Hill Education
Essential Questions How does the reduction in chromosome number occur during meiosis? What are the stages of meiosis? What is the importance of meiosis in providing genetic variation? Meiosis Vocabulary
Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
Genetic and molecular basis of chlorophyll retention in soybean seed
Genetic and molecular basis of chlorophyll retention in soybean seed Henk Hilhorst, Wageningen University, Edvaldo A Amaral da Silva Universidade Estadual Paulista (FCA) Collaborators in Brazil: José França-Neto
Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
Application of Impedance Spectroscopy for Selecting Frost Hardy Varieties of English Ryegrass
Annals of Botany 78: 605 609, 1996 Application of Impedance Spectroscopy for Selecting Frost Hardy Varieties of English Ryegrass TAPANI REPO* and SEPPO PULLI * Uni ersity of Joensuu, Faculty of Forestry,
Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function
Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function Brian D. Gregory Department of Biology Penn Genome Frontiers Institute University of Pennsylvania
Life Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM
Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents
Chloroplastic protein IOJAP is important for coldacclimation
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-216 Chloroplastic protein IOJAP
Classical Selection, Balancing Selection, and Neutral Mutations
Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected
Ph.D. thesis. Study of proline accumulation and transcriptional regulation of genes involved in this process in Arabidopsis thaliana
Ph.D. thesis Study of proline accumulation and transcriptional regulation of genes involved in this process in Arabidopsis thaliana Written by: Edit Ábrahám Temesváriné Supervisors: Dr. László Szabados
EFFECTS OF SEED SIZE AND EMERGENCE TIME ON SUBSEQUENT GROWTH OF PERENNIAL RYEGRASS
Phytol (980) 84, 33-38 EFFECTS OF SEED SIZE AND EMERGENCE TIME ON SUBSEQUENT GROWTH OF PERENNIAL RYEGRASS BY ROBERT E. L. NAYLOR School of Agriculture, The University, Aberdeen {Accepted 2 January 979)
Exam 1 PBG430/
1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.
Area of Focus: Biology. Learning Objective 1: Describe the structure and function of organs. Pre-Learning Evaluation: Teaching Methods and Process:
Area of Focus: Biology Learning Objective 1: Describe the structure and function of organs. Pre- Diagram and label the structure of the primary components of representative organs in plants and animals
Plant Growth and Development
Plant Growth and Development Concept 26.1 Plants Develop in Response to the Environment Factors involved in regulating plant growth and development: 1. Environmental cues (e.g., day length) 2. Receptors
Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport
Ph.D. thesis Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Zsigmond Laura Supervisor: Dr. Szabados László Arabidopsis Molecular Genetic Group Institute of Plant
Jeopardy. Evolution Q $100 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $200 Q $300 Q $300 Q $300 Q $300 Q $300
Jeopardy Mutations Crosses & Punnett Sqs. Meiosis & Variability Evolution Photo, Cell Resp, Energy, Matter Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $300
2 Numbers in parentheses refer to literature cited.
A Genetic Study of Monogerm and Multigerm Characters in Beets V. F. SAVITSKY 1 Introduction Monogerm beets were found in the variety Michigan Hybrid 18 in Oregon in 1948. Two of these monogerm plants,
Supplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus
RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus Haiwei Lu and Steven H. Strauss Oregon State University Forest Tree Workshop PAG XXVI, San Diego, CA, 2018 The containment issue
GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
wild tomato tomato teosinte corn, maize
2 wild tomato tomato teosinte corn, maize 4 Crop Wild Relatives Traditional landraces Modern cultivars Genetic bottlenecks during crop domestication and during modern plant breeding. The circles represent
Reflexions, le site de vulgarisation de l'université de Liège
When tomatoes flower 3/13/12 Understanding the mechanisms responsible for tomato plant flowering will enable new selection procedures to be developed in order to obtain even more productive varieties.
Figure 18.1 Blue-light stimulated phototropism Blue light Inhibits seedling hypocotyl elongation
Blue Light and Photomorphogenesis Q: Figure 18.3 Blue light responses - phototropsim of growing Corn Coleoptile 1. How do we know plants respond to blue light? 2. What are the functions of multiple BL
A dual sgrna approach for functional genomics in Arabidopsis thaliana
A dual sgrna approach for functional genomics in Arabidopsis thaliana CRISPR AgBio Europe 2017 Laurens Pauwels #CRISPRAgBio @laurenspauwels Outline - Workflow for CRISPR/Cas9 in Arabidopsis thaliana -
A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding
Professur Pflanzenzüchtung Professur Pflanzenzüchtung A mixed model based QTL / AM analysis of interactions (G by G, G by E, G by treatment) for plant breeding Jens Léon 4. November 2014, Oulu Workshop
BIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
DOCTOR Of PHILOSOPHY IN AGRICUL TI1.RE
GENOTYPIC EVALUATION AND SCREENING FOR DROUGHT TOLERANCE IN WILD Hevea GERMPLASM '-- By M.A. MERCY THESIS Submitted in partial fulfilment of the requirement for the degree of DOCTOR Of PHILOSOPHY IN AGRICUL
Biological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
It is never so good as expected and never so bad as feared.
2018 General: The weather conditions in the Baltics and Scandinavia have not been perfect - not enough rain and high temperatures after drilling. As Scandinavia and Baltics was the area where there was
Questions for Biology IIB (SS 2006) Wilhelm Gruissem
Questions for Biology IIB (SS 2006) Plant biology Wilhelm Gruissem The questions for my part of Biology IIB, Plant Biology, are provided for self-study and as material for the exam. Please note that the
BIG IDEA 4: BIOLOGICAL SYSTEMS INTERACT, AND THESE SYSTEMS AND THEIR INTERACTIONS POSSESS COMPLEX PROPERTIES.
Enduring Understanding 4.C Independent Study Assignment Assignment Instructions Both components of this assignment (Part I and Part II) should be completed on the pages provided. Each numbered component
PHYSIOLOGY AND MAINTENANCE Vol. V - Phenology of Trees and Other Plants in the Boreal Zone Under Climatic Warming - Heikki Hänninen
PHENOLOGY OF TREES AND OTHER PLANTS IN THE BOREAL ZONE UNDER CLIMATIC WARMING Heikki Hänninen Department of Ecology and Systematics, University of Helsinki, Finland Keywords: Bud burst, boreal zone, climatic
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
MOLECULAR BIOLOGY BIOL 021 SEMESTER 2 (2015) COURSE OUTLINE
COURSE OUTLINE 1 COURSE GENERAL INFORMATION 1 Course Title & Course Code Molecular Biology: 2 Credit (Contact hour) 3 (2+1+0) 3 Title(s) of program(s) within which the subject is taught. Preparatory Program