Functional genomics. But in principle we already know the secret of life. The secret of life?

Transcription

1 Functional genomics Dr. Sydney Brenner: In late 1962, Francis Crick and I began a long series of conversations about the next steps to be taken in our research. Both of us felt very strongly that most of the classical problems of molecular biology had been solved and that the future lay in tackling more complex biological problems. I remember that we decided against working on animal viruses, on the structure of ribosomes, on membranes, and other similar trivial problems in molecular biology. I had come to believe that most of molecular biology had become inevitable and that, as I put it in a draft paper, "we must move on to other problems of biology which are new, mysterious and exciting. Broadly speaking, the fields which we should now enter are development and the nervous system." Jacques Monod (1970): The secret of life? But in principle we already know the secret of life. Horace Judson The Eighth Day of Creation The species with the smallest genome size in this class is Mycoplasma genitalium (580 kb), which was originally isolated from urethral specimens of patients with non-gonoccocal urethritis and has since been shown to exist in parasitic association with ciliated epithelial cells of primate genital and respiratory tracts. Mycoplasmas are of interest because they are believed to represent a minimal life form, having yielded to selective pressure to reduce genome size

2 The minimal gene complement of Mycoplasma genitalium. Fraser CM, Gocayne JD, White O, Adams MD, Clayton RA, Fleischmann RD, Bult CJ, Kerlavage AR, Sutton G, Kelley JM, et al. Institute for Genomic Research, Rockville, MD 20850, USA. The complete nucleotide sequence (580,070 base pairs) of the Mycoplasma genitalium genome, the smallest known genome of any freeliving organism, has been determined by whole-genome random sequencing and assembly. A total of only 470 predicted coding regions were identified that include genes required for DNA replication, transcription and translation, DNA repair, cellular transport, and energy metabolism. Science, Mysterious yeast How does life work? How does the genome work? Sequence of genome answer Problem: very many genes of unknown function: In human, at least 12,000 (30%). In mouse, < 5,000 have experimentally defined function. Brave new world Classical genetics gene-by-gene, circuitby-circuit. Functional genomics massively parallel (=many at once) analysis of gene function by a combination of reverse genetics and other things

3 Northern gene-by-gene measurement of mrna levels Massively parallel Northern: genome-wide expression profiling 1. Silicon chip (or glass slide) containing single-stranded probes complementary to each gene in the genome. 2. A method for extracting RNA from cells and making it fluorescent. 3. A hybridization chamber in which 2 will be hybridized to A laser that will scan the chip after the hybridization. Sudarsanam et al. (2000) PNAS 97:

4 13 14 Comprehensive identification of cell cycleregulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization How does transcription in yeast change as the cell cycle progresses? 1. Take asynchronous yeast 2. Synchronize them in G 1 by DIFFERENT METHODS 3. Release from arrest 4. Extract RNA at set timepoints post-arrest 5. Compare levels to that in asynchronous culture Spellman et al. (1998) Mol. Biol. Cell 9:

5 cell cycle control DNA replication DNA repair budding glycosylation nuclear division mitosis structure of the cytoskeleton mating we identified are: The major functions of the cell cycle regulated genes 800 genes phenomenon what caused it

6 The transcriptional program in the response of human fibroblasts to serum Take human fibroblasts arrested in G 0. Add serum (they start dividing) Extract RNA at defined timepoints and do Affy. Iyer et al. (2000) Science 285: ,356 individual measurements Primary cultured fibroblasts from human neonatal foreskin were induced to enter a quiescent state by serum deprivation for 48 hours and then stimulated by addition of medium containing 10% FBS. DNA microarray hybridization was used to measure the temporal changes in mrna levels of 8613 human genes at 12 times, ranging from 15 min to 24 hours after serum stimulation. Iyer et al. (2000) Science 285:

7 Wound healing Problem On the one hand, it is incredibly gratifying that the cell s response to the stimulus makes biological sense (a human skin fibroblast normally enounters serum i.e., blood in the context of a wound). On the other hand, knowing that all these genes respond to serum tells us very little about why they do that. If we were doing this in yeast, we d do a screen. Or, alternatively, we could test a strain with a deletion for the gene(s) that regulate this response. Which gene is that? Well, let s delete each gene, one by one, and see which defect the strains get!! Screen of each gene for each defect SATURATION The central challenge in experimental biology How to convert data into knowledge 26 28

8 An additional, extremely cool, trick What this means The deletion cassette contains a molecular bar code a tag region. The tag is a sandwich (2 actually) on either side of the tag are sequences that are the same in all deletion cassettes, but the filling is unique to each gene: Within each deleted gene lies a unique, identifiable sequence. This represents a tag that can be used as a unique identifier for that strain and that strain only. More on this very soon Functional Characterization of the S. cerevisiae Genome by Gene Deletion and Parallel Analysis The seven phenotypic categories of deletion mutant morphologies What about essential genes? use heterozygous diploids! 1. When spores from the 2026 heterozygous strains were germinated on YPD media at 30 C haploid deletants could not be recovered for 356 ORFs (17%) 2. In total, we deleted 5,916 genes (96.5% of total attempted). Some 18.7% (1,105) of the genes proved essential for growth on rich glucose medium. 1. Winzeler et al. (1999) 285:

9 Now what? Eighty two percent of yeast genes are nonessential in rich medium. What do all these yeast genes do? fitness profiling: measure how the deletion of gene X affects the cell s ability to react to, or live in, condition Y. Ah, the good old days This is what one could do Take 5,100 vials, into each inoculate a different strain. Label the vial with the name of the gene deleted in the strain. Do this in duplicate. To one vial, add something (I don t know, a toxin or Diet Coke or something). See, which strains have a defect in growing in the presence of aspartame Screen for gal cells H. Douglas, D. Hawthorne (1964): 1. Take wt haploid yeast. 2. Zap them with UV light. 3. Replica-plate to find those that are gal. 4. 1:1000 are mutant. Douglas HC, Hawthorne D (1964) Enzymatic expression and genetic linkage of genes controlling lactose utilization in Saccharomyces. Genetics 49: 837. The way this was actually done (are you ready for this?!) Whole-genome parallel analysis The unique sequence tags linked to each gene deletion allow the strains to be analysed in parallel. In each experiment, a mixed culture containing every deletion mutant is grown, samples are collected at several times during growth, and the molecular bar-code tags are amplified from genomic DNA. The abundance of each deletion strain is then determined by quantifying the associated molecular bar codes by hybridization to an oligonucleotide array of the complementary barcode sequences

10 Amazing but true 1. They did not want to have 5,000 vials of anything. Instead, they put all the deletions in the same vial two vials, actually, one control (+ glucose) and one experimental (+ aspartame), and started growing this strange family. 2. Those strains that have a growth deficiency on aspartame will grow more slowly than those that do not. 3. At defined timepoints, they took aliquots, isolated genomic DNA, and Yes, and what? This means they can directly measure, how many cells of which strain were present in the mix at any time by hybridizing this pool to a custom microarray please understand, not the yeast genome array this was an array they made especially for this experiment it contained 5,100 tag sequences, each one annotated: GTCAAGATGCTACCGTTCAG = GAL1 GGTAGTATGTTTGGGACAG = GAL Oooh, mama! did PCR with the primers flanking the tag. This will amplify every tag in the mix that is, from every strain in the vial. BUT! the tag itself is unique that is, their PCR product is a POOL the number of times a given tag is represented in that pool is directly proportional to how abundant that strain was at that moment in time! One question How cool is that, I ask you? Answer: cooler than Keanu Reeves, Lawrence Fishburne, and Carrie-Anne Moss COMBINED

11 First About 15% of all viable homozygous deletion strains exhibit a slow growth phenotype in rich medium at 30 C ~ 620 genes are not essential, but in their absence yeast wish they were dead Stress response Yeast (and us) has evolved to respond to stress (change in environment) temperature, salinity, nutrient composition, ph, UV damage, etc etc. Take those strains that are alive and do not have a death wish (~4,700 genes) and profile them with respect to their ability to respond to such stress. = identify genes required for stress response Gene Average Ratio Gene Description SRV kDa adenylyl cyclase-associated protein, cytoskeleton organization and biogenesis*, cytoskeletal protein binding protein*, actin cortical patch (sensu Saccharomyces) RNR ribonucleotide reductase, DNA replication, ribonucleoside-diphosphate reductase, cytosol VAC Integral vacuolar membrane protein,molecular_function unknown, FYV biological_process unknown, molecular_function unknown, cellular_component unknown BEM contains two SH3 domains ARV similar to Nup120p and C.elegans R05H5.5 protein and Nup120p, biological_process unknown, molecular_function unknown, YDJ yeast dnaj homolog (nuclear envelope protein); heat shock protein BUD bud site selection, biological_process unknown, molecular_function unknown, cellular_component unknown VPS phosphatidylinositol 3-kinase, protein phosphorylation*, protein kinase*, membrane fraction SWI transcription factor, chromatin modeling, non-specific RNA polymerase II transcription factor, nucleosome remodeling complex TPS Trehalose-6-phosphate phosphatase, stress response*, trehalose phosphatase, alpha,alpha-trehalose-phosphate synthase (UDP-forming) CUP vacuolar ATPase V0 domain subunit c (17 kda), endocytosis*, hydrogen-transporting two-sector ATPase, hydrogen-transporting ATPase V0 domain BUD biological_process unknown, molecular_function unknown, cellular_component unknown RPL27 Ribosomal protein L27A, protein biosynthesis, structural protein of MCB ribosome, 140 cytosolic 17.1 Giaever et al. A (2002) Nature 418, large 387. ribosomal (60S)-subunit 42 Which stress stimuli to pick first? They picked: 1. Change of carbon source (galactose or 1.5M sorbitol) 2. Change in osmolarity (1M NaCl) 3. ph 8 4. DNA damage 44

12 Surprise # PGM2 Phosphoglucomutase, glycogen metabolism*, phosphoglucomutase, cytoplasm* GAL7 galactose-1-phosphate uridyl transferase, galactose metabolism, UTP--hexose-1-phosphate uridylyltran GAL10 UDP-glucose 4-epimerase, galactose metabolism, UDP-glucose 4-epimerase, cytoplasm SNF4 associates with Snf1p IRA2 encodes a GTPase activating protein, highly homologous to Ira1p, homologue of neurofibromin GAL3 involved in galactose induction of GAL genes, galactose metabolism*, molecular_function unknown, nu GAL4 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type, galactose metabolism* NBP2 interacts with Nap1, which is involved in histone assembly, biological_process unknown, SRB8 RNA polymerase II mediator subunit, repression of transcription from Pol II promoter, RNA polymerase CYS3 cystathionine gamma-lyase,cystathionine-gamma-lyase, biological_process unknown, molecular_function unknown, GEF1 putative transport protein involved in intracellular iron metabolism, transport, SMI1 57 kda nuclear protein biological_process unknown, molecular_function unknown, GAL2 galactose permease, galactose metabolism*, galactose transporter, plasma membrane RML2 mitochondrial ribosomal protein L2 of the large subunit, protein biosynthesis*, structural protein of ribos SEC22 Synaptobrevin (v-snare) homolog, non-selective vesicle fusion*, v-snare, inter-golgi transport vesic MDM12 Mdm12p is a mitochondrial outer membrane protein. An Mdm12p homolog exists in S. Pombe which c BMH1 Homolog of mammalian proteins, pseudohyphal growth*, molecular_function unknown, FTR1 Iron permease, transport, RAV1 Regulator of (H+)-ATPase in vacuolar membrane,molecular_function unknown, DIA4 Seryl-tRNA synthetase, pseudohyphal growth*, serine--trna ligase, cellular_component unknown FET3 multicopper oxidase, high affinity iron transport, multicopper ferroxidase iron transport mediator, plasma GAL1 galactokinase, galactose metabolism, galactokinase, plasma membrane* biological_process unknown, molecular_function unknown, 47 Surprise #1 The use of galactose is one of the beststudied pathways in yeast, yet we identified ten genes not previously known to be required for optimal growth on this carbon source: MSN2, FTR1, FET3, YDR290W, ATX1, YNL077W, YDR269C, GEF1, YML090w, YKL037W. Thus, fitness profiling can discover genes involved even in previously well-studied pathways

13 Message This was the first real saturation screen ever done for anything. Saturation screens have been done in the past, but the claim of saturation ( we ve made a mutation in every gene ) has always been a statistical, not an empirical one. It s amazing how much more one can find when one does a true saturation screen! Let s think about this for a second If a stimulus activates (or represses) a gene, this must be for a reason! For example, when you add lactose to E. coli, one gene that is induced is, of course, b-galactosidase. Prediction: If a gene is induced by the stimulus, it must have something to do with responding to the stimulus! Expression profiling vs. genetics? The stimuli (galactose, 1M NaCl, DNA damage, etc.) picked were not chosen randomly. They chose the ones for which the expression profiling had already been done. Compare two lists: 1. Genes activated (repressed) by stimulus. 2. Genes that are required for growth following that stimulus. Buckle your seatbelts and return your tray tables to an upright and fully locked position 50 52

14 Holy cow Our hypothesis was this: if a gene exhibits a significant increase in expression in a given condition, then it should also be required for optimal growth in that condition. We found that in galactose, less than 7% of the genes that exhibited a significant increase in mrna expression also exhibited a significant decrease in fitness. In the case of ph 8, 1 M NaCl and 1.5 M sorbitol, 3.0%, 0.88% and 0.34%, respectively, of the genes that exhibited a significant increase in mrna expression also exhibited a significant decrease in fitness. Seventeen thousand three hundred and eighteen Expression profiling = 17,318 papers. Take cell, do something to it, observe change in gene expression and change in cell. What is the relationship between changes in gene expression and what happened to the cell? Assumption: a causal one. That is, gene expression changed because of what we did to the cell, and, furthermore, how the cell responded to what we did is due to the gene expression change Hmmmmmmmmmmmmm We observed little overlap of genes identified both as significant by fitness profiling and as significantly upregulated by gene expression profiling in conditions of 1 M NaCl, 1.5 M sorbitol, ph 8 and galactose. It is easy to imagine why some genes required for growth under a particular condition do not exhibit a change in expression in that condition, because the response to the change in condition may operate post-transcriptionally. The converse situation a gene that exhibits a significant increase in expression but is not required for growth is quite surprising, and more difficult to comprehend. It is possible that under stress conditions, multiple gene products are expressed, only a small fraction of which are essential for adaptation to the specific condition in question. Coincidental correlation Post hoc, ergo propter hoc. After something, therefore because of something

15 Transcriptional response of S. cerevisiae to DNA-damaging agents does not identify the genes that protect against these agents The recent completion of the deletion of all of the nonessential genes in budding yeast has provided a powerful new way of determining those genes that affect the sensitivity of this organism to cytotoxic agents. We have used this system to test the hypothesis that genes whose transcription is increased after DNA damage are important for the survival to that damage. We used a pool of 4,627 diploid strains each with homozygous deletion of a nonessential gene to identify those genes that are important for the survival of yeast to four DNA-damaging agents: ionizing radiation, UV radiation, and exposure to cisplatin or to hydrogen peroxide. In addition we measured the transcriptional response of the wild-type parental strain to the same DNAdamaging agents. We found no relationship between the genes necessary for survival to the DNA-damaging agents and those genes whose transcription is increased after exposure. These data show that few, if any, of the genes involved in repairing the DNA lesions produced in this study, including double-strand breaks, pyrimidine dimers, single-strand breaks, base damage, and DNA cross-links, are induced in response to toxic doses of the agents that produce these lesions. This finding suggests that the enzymes necessary for the repair of these lesions are at sufficient levels within the cell. The data also suggest that the nature of the lesions produced by DNA-damaging agents cannot easily be deduced from gene expression profiling. Birrell et al. (2002) PNAS 99: Next time Use of functional genomics to understand cancer cell biology Please understand This does not mean that genes that respond to stimuli are irrelevant to that response. This only means that you cannot take a list of genes that have responded and make a sweeping claim as to the relevance of all the genes that responded to the actual functional pathway of the response. For some pathways (DNA damage in yeast) the Venn diagram has near-zero overlap! 58