Initiation of DNA Replication Lecture 3! Linda Bloom! Office: ARB R3-165! phone: !
|
|
|
- Rosanna Stevenson
- 6 years ago
- Views:
Transcription
1 Initiation of DNA Replication Lecture 3! Linda Bloom! Office: ARB R3-165! phone: ! 1!
2 Lecture 3 Outline! Students will learn! Basic techniques for visualizing replicating DNA! What a replication origin is.! How replication is initiated at origins.! Regulation of initiation.! Students should know! Basics of DNA structure! Basic replication mechanisms (previous 2 lectures0! Reading Assignment! Lodish - Chp pp ! Voet & Voet Chp. 30.3Ca & b, pp ; 30.4A, pp ; 30.4Bb, c, d, pp ! 2!
3 The Replicon Hypothesis! Two basic elements required to initiate DNA replication! François Jacob, Sydney Brenner & Jacques Cuzin (1963)! replicator = a cis-acting factor! a genetic element required or sufficient to direct initiation of replication! origin of replication - specific sites at which DNA unwinding and replication begin! E. coli = OriC! S. cerevisiae = ARS! initiator = a trans-acting factor! a protein that specifically recognizes DNA element(s) in the replicator! binds origin and recruits other replication proteins! E. coli = DnaA! eukaryotes = ORC! replicon! unit of DNA that is replicated under the control of a replicator/initiator! 3!
4 Replication of the E. coli Genome! OriC! bidirection synthesis! fork movement! nt/s! 5 x 10 6 bp! the E. coli genome contains! a single replicon! theta (θ) structure! 4!
5 Replication of Eukaryotic Genomes! multiple origins! human genome estimated 30,000 replicons,! average size around 100 kb! bidirectional synthesis! fork progression typically! 10X slower than bacteria! nt/s! 5!
6 Drosophila Replication Bubble with 2 Forks!
![Autoradiogram of E. coli Chromosome! Bacteria were grown in medium containing [ 3 H]thymidine!](/docs-images/73/69470423/images/7-0.jpg "Radiolabeled thymidine was incorporated into DNA!")
7 Autoradiogram of E. coli Chromosome! Bacteria were grown in medium containing [ 3 H]thymidine! Radiolabeled thymidine was incorporated into DNA! DNA isolated, stretched on a slide, and exposed to film!
8 Visualization of Origin-dependent DNA Replication A Classic Method, DNA Fiber Autoradiography! Synchronize cells (later days)! Deplete dttp by treating with 5-FUdR! Pulse with 3 H-thymidine and chase with cold! Vary pulse and chase times in different expts! Isolate DNA by filter binding! Expose to film! 8!
9 . DNA Fiber Autoradiography Real Data!.( * I.. loop., :. loop.! * ) i i *. :. ; 1 l. I. *.. l I. ; i.: #?j.. f.. CHO Cells! t.? (4 (b) J.A. Huberman & A.D. Riggs (1968) On the mechanism of replication in mammalian chromosomes. J. Mol. Biol. 32, ! 9!
10 DNA Fiber Fluorography Uses bromo-, chloro-, and iododeoxyuridine (BrdU, CldU, and IdU) visualized by immunofluorescence Also other dntp s biotin-labeled, digoxigenin-labeled Can synchronize cells, or use two colors with asynchronous cells DNA stretched onto glass surface such as slide coverslips Coupled to FISH (fluorescence in situ hybridization) to identify specific DNA regions or sequence 10!
11 Two color Pulse-labeling in Asynchronous Cells Cells are not synchronized Pulse with IdU for a specified period of time Followed by a pulse with CldU for a defined period of time C. Conti, J.A. Seiler, and Y. Pommier, Cell Cycle 6, (2007)! 11!
12 Identification of Origins of Replication! In prokaryotes, some viruses, and yeasts, replicators (origins) were identified by their ability to support replication of extrachromasomal DNA (a plasmid)! 1) insert a segment of genomic DNA into a plasmid with a selectable marker! 2) Put plasmids in cells! 3) Grow cells! 4) Isolate cells that can grow on selection media! 12!
13 E. coli Origin of Replication, OriC! W. Messer, FEMS Microbiology Reviews 26, (2002)! oric = 245 bp! 5 DnaA boxes = strong boxes! 9mer sequence elements! 5 TT(A/T)TNCACA! AT-rich sequences! 3 x 13mer! 5' G A T C T n T T n T T T T 3'! 11 GATC sites! recognition! DNA unwinding element! (DUE)! 13!
14 Structures of Yeast Origins! from D. M. Gilbert (2001) Science 294, ! 14!
15 But, Initiation of Replication in Eukaryotes is More Complicated than in Bacteria! Although the replicon model was presumed for eukaryotes and initially seemed valid because of identification of origins in yeast, it quickly became clear that initiation of replication was much more complicated! Many origins on a single chromosome! Different origins used a different stages of development! Origin usage different under different growth conditions & tissues! Origins fire at different times during S-phase! Many origins never fire! The replicator is unlikely to be defined by a specific consensussequence! Even in S. cerevisiae that has consensus ARS sequences not all are active origins! 15!
16 E. coli Origin of Replication, OriC!
17 Initiation of Replication in E. coli!
18 Identification of the Eukaryotic Initiator! ORC = Origin Recognition Complex! S.P. Bell and B. Stillman (1992) ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357, ! Used the S. cerevisiae ARS1 to purify a DNA binding complex from yeast nuclear extracts! Fractionated extracts using different procedures including column chromatography! Assayed fractions for ORC binding activity! Optimized purification included S-sepharose, Q-sepharose, and DNA (A sequence from ARS1) affinity chromatography! ARS1 binding was ATP-dependent! Used DNA footprinting to characterize binding! 18!
19 ORC is the initiator in eukaryotes! a six-subunit complex = Orc1-6! Orc1- Orc5 are members of the AAA + family of ATPases! replicator identified in yeast & used to find initiator! in higher eukaryotes, initiator identified by homology! 19!
20 Initiation of DNA Replication is Tightly Regulated In Eukaryotes! Goal to replicate each chromosome once and only once per cell cycle! Don t want to enter mitosis with too many or too few chromosomes, or incompletely replicated chromosomes! Initiation occurs in two phases! Replicator selection! occurs in G1 phase! formation of pre-rc s! pre-rc = pre-replicative complex! Origin activation! occurs in S phase! requires activity of cell-cycle-dependent kinases! Cdk = cyclin dependent kinases! formation of pre-initiation complexes! 20!
21 Cell Cycle Regulation of Pre-RC Formation! Cdc7 & Cdk2! Fig Molecular Biology of the Gene, 5th Ed., Watson, J.D. et al.! 21!
22 Eukayrotic Origins are Replicated Only Once! Fig Molecular Biology of the Gene, 5th Ed., Watson, J.D. et al.! 22!
23 Regulation of Initiation by Cyclin-dependent Kinases! Fig Molecular Biology of the Gene, 5th Ed., Watson, J.D. et al.! 23!
24 Cell Cycle Regulation of Pre-RC Formation! Cdc7 & Cdk2! Fig Molecular Biology of the Gene, 5th Ed., Watson, J.D. et al.! 24!
Three types of RNA polymerase in eukaryotic nuclei
Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive
RNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed
3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed replication Initiation of Replication http://www.orst.edu/instruction/bb492/figletters/figh3.gif
16 The Cell Cycle. Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization
The Cell Cycle 16 The Cell Cycle Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization Introduction Self-reproduction is perhaps
Plant Molecular and Cellular Biology Lecture 8: Mechanisms of Cell Cycle Control and DNA Synthesis Gary Peter
Plant Molecular and Cellular Biology Lecture 8: Mechanisms of Cell Cycle Control and DNA Synthesis Gary Peter 9/10/2008 1 Learning Objectives Explain why a cell cycle was selected for during evolution
Topic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.
Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
Lecture 10: Cyclins, cyclin kinases and cell division
Chem*3560 Lecture 10: Cyclins, cyclin kinases and cell division The eukaryotic cell cycle Actively growing mammalian cells divide roughly every 24 hours, and follow a precise sequence of events know as
Chapter 20. Initiation of transcription. Eukaryotic transcription initiation
Chapter 20. Initiation of transcription Eukaryotic transcription initiation 2003. 5.22 Prokaryotic vs eukaryotic Bacteria = one RNA polymerase Eukaryotes have three RNA polymerases (I, II, and III) in
Biology: Life on Earth
Biology: Life on Earth Eighth Edition Lecture for Chapter 11 The Continuity of Life: Cellular Reproduction Cellular Reproduction Intracellular activity between one cell division to the next is the cell
Transport between cytosol and nucleus
of 60 3 Gated trans Lectures 9-15 MBLG 2071 The n GATED TRANSPORT transport between cytoplasm and nucleus (bidirectional) controlled by the nuclear pore complex active transport for macro molecules e.g.
Three different fusions led to three basic ideas: 1) If one fuses a cell in mitosis with a cell in any other stage of the cell cycle, the chromosomes
Section Notes The cell division cycle presents an interesting system to study because growth and division must be carefully coordinated. For many cells it is important that it reaches the correct size
Cell Division. OpenStax College. 1 Genomic DNA
OpenStax-CNX module: m44459 1 Cell Division OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be
The activities of eukaryotic replication origins in chromatin
Biochimica et Biophysica Acta 1677 (2004) 142 157 Review The activities of eukaryotic replication origins in chromatin Michael Weinreich a, *, Madeleine A. Palacios DeBeer b, Catherine A. Fox b, * a Laboratory
Quiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Quiz answers Kinase: An enzyme
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
Chapter 12: The Cell Cycle. 2. What is the meaning of genome? Compare your genome to that of a prokaryotic cell.
Name: AP Bio Chapter 12: The Cell Cycle 12.1 Cell division results in genetically identical daughter cells 1. What is meant by the cell cycle? 2. What is the meaning of genome? Compare your genome to that
CELL CYCLE AND DIFFERENTIATION
CELL CYCLE AND DIFFERENTIATION Dewajani Purnomosari Department of Histology and Cell Biology Faculty of Medicine Universitas Gadjah Mada d.purnomosari@ugm.ac.id WHAT IS CELL CYCLE? 09/12/14 d.purnomosari@ugm.ac.id
Welcome to BIOL 572: Recombinant DNA techniques
Lecture 1: 1 Welcome to BIOL 572: Recombinant DNA techniques Agenda 1: Introduce yourselves Agenda 2: Course introduction Agenda 3: Some logistics for BIOL 572 Agenda 4: Q&A section Agenda 1: Introduce
Slide 1 / 7. Free Response
Slide 1 / 7 Free Response Slide 2 / 7 Slide 3 / 7 1 The above diagrams illustrate the experiments carried out by Griffith and Hershey and Chaserespectively. Describe the hypothesis or conclusion that each
Last time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
Investigation 7 Part 1: CELL DIVISION: MITOSIS
Investigation 7 Part 1: CELL DIVISION: MITOSIS How do eukaryotic cells divide to produce genetically identical cells? BACKGROUND One of the characteristics of living things is the ability to replicate
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi
Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids Prepared by Woojoo Choi Dead or alive? 1) In this chapter we will explore the twilight zone of biology and the gene creature who live there.
A simple model for the eukaryotic cell cycle. Andrea Ciliberto
A simple model for the eukaryotic cell cycle Andrea Ciliberto The cell division cycle G1 cell division Start S (DNA Replication) Finish M (mitosis) G2/M G2 Kohn, Mol. Biol. Cell., 1999 How did we get to
Multiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
Chapter 12: The Cell Cycle
Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Example 2. What is meant by the cell cycle? Concept 12.1
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
Exam 1 ID#: October 4, 2007
Biology 4361 Name: KEY Exam 1 ID#: October 4, 2007 Multiple choice (one point each) (1-25) 1. The process of cells forming tissues and organs is called a. morphogenesis. b. differentiation. c. allometry.
Biology I Fall Semester Exam Review 2014
Biology I Fall Semester Exam Review 2014 Biomolecules and Enzymes (Chapter 2) 8 questions Macromolecules, Biomolecules, Organic Compunds Elements *From the Periodic Table of Elements Subunits Monomers,
Translation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
Number of questions TEK (Learning Target) Biomolecules & Enzymes
Unit Biomolecules & Enzymes Number of questions TEK (Learning Target) on Exam 8 questions 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how
Flow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
Grade Level: AP Biology may be taken in grades 11 or 12.
ADVANCEMENT PLACEMENT BIOLOGY COURSE SYLLABUS MRS. ANGELA FARRONATO Grade Level: AP Biology may be taken in grades 11 or 12. Course Overview: This course is designed to cover all of the material included
15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
Macromolecular assemblies in DNAassociated
Macromolecular assemblies in DNAassociated functions DNA structures: Chromatin (nucleosome) Replication complexes: Initiation, progression Transcription complexes: Initiation, splicing, progression Voet
Plant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
A DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
The Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea
Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling
Introduction: The Cell Cycle and Mitosis
Contents 1 Introduction: The Cell Cycle and Mitosis 2 Mitosis Review Introduction: The Cell Cycle and Mitosis The cell cycle refers to the a series of events that describe the metabolic processes of growth
The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA
The nature of genomes Genomics: study of structure and function of genomes Genome size variable, by orders of magnitude number of genes roughly proportional to genome size Plasmids symbiotic DNA molecules,
MCB 110. "Molecular Biology: Macromolecular Synthesis and Cellular Function" Spring, 2018
MCB 110 "Molecular Biology: Macromolecular Synthesis and Cellular Function" Spring, 2018 Faculty Instructors: Prof. Jeremy Thorner Prof. Qiang Zhou Prof. Eva Nogales GSIs:!!!! Ms. Samantha Fernandez Mr.
Cell Review. 1. The diagram below represents levels of organization in living things.
Cell Review 1. The diagram below represents levels of organization in living things. Which term would best represent X? 1) human 2) tissue 3) stomach 4) chloroplast 2. Which statement is not a part of
Chapter 9 Active Reading Guide The Cell Cycle
Name: AP Biology Mr. Croft Chapter 9 Active Reading Guide The Cell Cycle 1. Give an example of the three key roles of cell division. Key Role Reproduction Example Growth and Development Tissue Renewal
Reminders about Eukaryotes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 16: Eukaryotes at last! http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Reminders about Eukaryotes Eukaryotes arose around
GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
Honors Biology-CW/HW Cell Biology 2018
Class: Date: Honors Biology-CW/HW Cell Biology 2018 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Hooke s discovery of cells was made observing a. living
UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
Bacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
Eukaryotic vs. Prokaryotic genes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,
10.1 Growth and Cell Reproduction
10.1 Growth and Cell Reproduction Growth is a characteristic of all living things. You started out as a single cell. That cell quickly divided into two cells. Two cells became four and four became eight.
Bi Lecture 9 Genetic Screens (cont.) Chromosomes
Bi190-2013 Lecture 9 Genetic Screens (cont.) Chromosomes C. elegans EGF-receptor signaling: a branched signaling pathway LET-23 EGF-R [IP2] PLCγ [IP3] [PIP2] ITR-1 IP3 Receptor SEM-5 Grb2 LET-341 SOS LET-60
Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction
Unit 2: Cellular Chemistry, Structure, and Physiology Module 5: Cellular Reproduction NC Essential Standard: 1.2.2 Analyze how cells grow and reproduce in terms of interphase, mitosis, and cytokinesis
Cell Growth and Reproduction Module B, Anchor 1
Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients
Answer Key. Cell Growth and Division
Cell Growth and Division Answer Key SECTION 1. THE CELL CYCLE Cell Cycle: (1) Gap1 (G 1): cells grow, carry out normal functions, and copy their organelles. (2) Synthesis (S): cells replicate DNA. (3)
Welcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
Biology 1 Curriculum Aligned State Standard Teacher Resources Performance Indicator
Theme District Curriculum Heading District Curriculum Heading 1 Curriculum Aligned State Standard Teacher Resources Performance Indicator The Science of Students will learn the characteristics of life
UE Praktikum Bioinformatik
UE Praktikum Bioinformatik WS 08/09 University of Vienna 7SK snrna 7SK was discovered as an abundant small nuclear RNA in the mid 70s but a possible function has only recently been suggested. Two independent
Translational Initiation
Translational Initiation Lecture Outline 1. Process of Initiation. Alternative mechanisms of Initiation 3. Key Experiments on Initiation 4. Regulation of Initiation Translation is a process with three
Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1
Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus
AP Biology Unit 6 Practice Test 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8
AP Biology Unit 6 Practice Test Name: 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8 picograms of DNA per nucleus. How many picograms
Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
Life Sciences For NET & SLET Exams Of UGC-CSIR. Section B and C. Volume-05. Contents 1. DNA REPLICATION 1 2. DNA RECOMBINATION 30
Section B and C Volume-05 Contents 3. FUNDAMENTAL PROCESSES A. REPLICATION, REPAIR AND RECOMBINATION 1. REPLICATION 1 2. RECOMBINATION 30 3. DAMAGE AND REPAIR MECHANISMS 35 B. RNA SYNTHESIS AND PROCESSING
REVIEW 2: CELLS & CELL DIVISION UNIT. A. Top 10 If you learned anything from this unit, you should have learned:
Period Date REVIEW 2: CELLS & CELL DIVISION UNIT A. Top 10 If you learned anything from this unit, you should have learned: 1. Prokaryotes vs. eukaryotes No internal membranes vs. membrane-bound organelles
Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
AP BIOLOGY SUMMER ASSIGNMENT
AP BIOLOGY SUMMER ASSIGNMENT Welcome to EDHS Advanced Placement Biology! The attached summer assignment is required for all AP Biology students for the 2011-2012 school year. The assignment consists of
Modesto Junior College Course Outline of Record BIO 101
Modesto Junior College Course Outline of Record BIO 101 I. OVERVIEW The following information will appear in the 2010-2011 catalog BIO 101 Biological Principles 5 Units Prerequisite: Satisfactory completion
CELL BIOLOGY, BIOINFORMATICS AND SYSTEMS BIOLOGY BIO160 (GU); UMF012 (Chalmers) schedule 2010
CELL BIOLOGY, BIOINFORMATICS AND SYSTEMS BIOLOGY BIO160 (GU); UMF012 (Chalmers) schedule 2010 Head of course: Markus Tamas (MT) Cell and Molecular Biology-Microbiology Medicinaregatan 9C Lundberg Laboratory
KnowIT Questions AQA GCSE Cell Biology
A. Cell structure part 1 Eukaryotes, prokaryotes and animal and plant cells 1. Where is the genetic material in a prokaryotic cell? 2. Where is the genetic material in a eukaryotic cell? 3. Complete the
Prof. Fahd M. Nasr. Lebanese university Faculty of sciences I Department of Natural Sciences.
Prof. Fahd M. Nasr Lebanese university Faculty of sciences I Department of Natural Sciences fnasr@ul.edu.lb B3206 Microbial Genetics Eukaryotic M. G. The yeast Saccharomyces cerevisiae as a genetic model
BIO Lab 5: Paired Chromosomes
Paired Chromosomes Of clean animals and of animals that are not clean.two and two, male and female, went into the ark with Noah as God had commanded Noah. Genesis 7:8-9 Introduction A chromosome is a DNA
2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
Genetic transcription and regulation
Genetic transcription and regulation Central dogma of biology DNA codes for DNA DNA codes for RNA RNA codes for proteins not surprisingly, many points for regulation of the process DNA codes for DNA replication
Study Guide A. Answer Key. Cell Growth and Division. SECTION 1. THE CELL CYCLE 1. a; d; b; c 2. gaps 3. c and d 4. c 5. b and d 6.
Cell Growth and Division Answer Key SECTION 1. THE CELL CYCLE 1. a; d; b; c 2. gaps 3. c and d 4. c 5. b and d 6. G 1 7. G 0 8. c 9. faster; too large 10. volume 11. a and b 12. repeating pattern or repetition
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
Introduction to Cells
Life Science Introduction to Cells All life forms on our planet are made up of cells. In ALL organisms, cells have the same basic structure. The scientist Robert Hooke was the first to see cells under
CHAPTER 12 - THE CELL CYCLE (pgs )
CHAPTER 12 - THE CELL CYCLE (pgs. 228-245) CHAPTER SEVEN TARGETS I. Describe the importance of mitosis in single-celled and multi-cellular organisms. II. Explain the organization of DNA molecules and their
Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
Initiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5
Frequently Asked Questions (FAQs)
Frequently Asked Questions (FAQs) Q1. What is meant by Satellite and Repetitive DNA? Ans: Satellite and repetitive DNA generally refers to DNA whose base sequence is repeated many times throughout the
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
Introduction to Cells
Life Science Introduction to Cells All life forms on our planet are made up of cells. In ALL organisms, cells have the same basic structure. The scientist Robert Hooke was the first to see cells under
Introduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
Computational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
STUDY UNIT 1 MITOSIS AND MEIOSIS. Klug, Cummings & Spencer Chapter 2. Morphology of eukaryotic metaphase chromosomes. Chromatids
STUDY UNIT 1 MITOSIS AND MEIOSIS Klug, Cummings & Spencer Chapter 2 Life depends on cell division and reproduction of organisms. Process involves transfer of genetic material. New somatic (body) cells
Principles of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
Lassen Community College Course Outline
Lassen Community College Course Outline BIOL-1 Principles of Molecular and Cellular Biology 4.0 Units I. Catalog Description A course in principles of biology, with special emphasis given to molecular
AP Biology. Read college-level text for understanding and be able to summarize main concepts
St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.
Biology 1 Notebook. Review Answers Pages 17 -?
Biology 1 Notebook Review Answers Pages 17 -? The History of Cell Studies 1. Robert Hook (1665) used a microscope to examine a thin slice of cork. The little boxes he observed reminded him of the small
Reading Assignments. A. Systems of Cell Division. Lecture Series 5 Cell Cycle & Cell Division
Lecture Series 5 Cell Cycle & Cell Division Reading Assignments Read Chapter 18 Cell Cycle & Cell Death Read Chapter 19 Cell Division Read Chapter 20 pages 659-672 672 only (Benefits of Sex & Meiosis sections)
Lecture Series 5 Cell Cycle & Cell Division
Lecture Series 5 Cell Cycle & Cell Division Reading Assignments Read Chapter 18 Cell Cycle & Cell Death Read Chapter 19 Cell Division Read Chapter 20 pages 659-672 672 only (Benefits of Sex & Meiosis sections)
Biology Unit 3 Exam DO NOT WRITE ON THIS EXAM. Multiple Choice Identify the choice that best completes the statement or answers the question.
Biology Unit 3 Exam Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Water moves into a cell placed in a(n) solution. a. osmotic c. hypotonic b. hypertonic
MOLECULAR BIOLOGY BIOL 021 SEMESTER 2 (2015) COURSE OUTLINE
COURSE OUTLINE 1 COURSE GENERAL INFORMATION 1 Course Title & Course Code Molecular Biology: 2 Credit (Contact hour) 3 (2+1+0) 3 Title(s) of program(s) within which the subject is taught. Preparatory Program
BIO 181 GENERAL BIOLOGY I (MAJORS) with Lab (Title change ONLY Oct. 2013) Course Package
GENERAL BIOLOGY I (MAJORS) with Lab (Title change ONLY Oct. 2013) Course Package COURSE INFORMATION Is this a new course or a proposed modification to an existing course? Please check the appropriate box.
Cell day 1.notebook September 01, Study the picture of a prokaryotic cell on page 162 in a textbook and the two eukaryotic cells on page 163.
BellRinger: Log into a clicker! Study the picture of a prokaryotic cell on page 162 in a textbook and the two eukaryotic cells on page 163. Compare them and list similarities and differences. Sep 11 11:00