Using Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus
|
|
- Abigail Wilkins
- 5 years ago
- Views:
Transcription
1 Microbiology MAR 20, 2009, 36(3): 345~ by Institute of Microbiology, CAS mini-tn10 1, ,2* ( ) ( ) :, mini-tn10 NK10.BAhjaWT 400, 90% 4, citbcitggpsa yvfb citb citg gpsa, yvfb mini-tn10, :,,mini-tn10 Using Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus GAO Wei-Hua 1,2 HAO Jian-An 1 XIA Si-Yuan 1 XU Hai-Jin 1 BAI Yan-Ling 1 ZHANG Xiu-Ming 1 QIAO Ming-Qiang 1,2* (1. Institute for Molecular Biology, College of Life Science, NanKai University, Tianjin , China) (2. Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, Tianjin , China) Abstract: Biofilm has great influence for bacteria to resist the harm from outer environment. Its forming and development are controlled by many different genes. In this research, an insertional mutagenesis library of a wide type Bacillus amyloliquefaciens NK10.BAhjaWT was built via mini-tn10 transposon system to find out genes involved in biofilm formation. Four such genes have been screened, in which, citb, citg, gpsa are all related to the energy metabolism. The function of another gene of yvfb is unknown. In a word, mini-tn10 transposon system was proved to be efficient and stable in Bacillus. Keywords: Biofilm, Bacillus amyloliquefaciens, Mini-Tn10 transposon system (bacterial biofilm), (exopo1ymeric matrix) (microcolony) [1,2] (No ) * Tel: ; : mingqiangqiao@yahoo.com.cn ;
2 , Vol.36, No.3,,, [3],,,,, [4,5] pic333, mini-tn10 [6], ColE1, 35 C ColE1, DNA, ColE1,,,, ( 1),, mini- Tn10,,, (Bacillus amyloliquefaciens)nk10.bahjawt DH5α pic T4 DNA DNA Marker () ; ;, Sigma ;, EP (0.625 mol/l, 1 mmol/l MgCl 2 ) M9-YE (Oxoid ) 3 g/l, (Sigma )10 g/l, l0 M9 10%, 200 g/l 1 Fig. 1 pic333 DNA Insertion of pic333 into chromosome 1%, 1 mo1/l MgSO 4 0.2%, 1 mol/l CaCl %LB (Oxoid ) 5 g/l, 10 g/l, NaCl 10 g/l LB 1 mmol/l MgSO 4 0.1%, LB (Ery)1 μg/ml, (Spc)100 μg/ml, 30 C, (Spc)100 μg/ml 100 μg/ml, 37 C 1.1.4, P15 -GCCGCGTTGGCCGATTC-3 P25 -GATATTCACGGTTTAC
3 : mini-tn ml 5 g/l M9-YE, 30 C200 r/min ; l:l00 25 ml 5 g/l M9-YE, 37 C220 r/min OD ; 4 C6000 r/min 10 min ; 1/3 EP, 4 C 6000 r/min 5 min ; 1/50 EP, l h 100 μl l μl pic333 ( 10 ng)(0.2 cm ), Micro pulser (Bio-Rad ) 2 kv, 1 ml 30 C M9-YE, 30 C120 r/min 1 h 100 μl LB, 30 C, 1.2.2, pic333, 70 C 5 ml LB 30 C 1:100 5 ml LB, 3 h, 42 C 4 h, 10 3, LB, 30 C 48 h,, [7], NK10.BAhjaWT, 1.2.3,, [8], OD , 1 μl 99 μl LB 96, 30 C 24 h 48 h,, 2, 150 μl 1%, 25 min 2, 150 μl DMSO, 570 nm LB 30 C, DNA Hind III DNA ( ), DNA, DH5α, LB, ml 100 μl, 156, pic333 = 156 CFU 10/10 ng= CFU/μg NK10.BAhjaWT, 4 1~4#, 2 1# 2#, 3# 4#,, 2 Fig. 2 Colony morphology of the mutants 2.2 NK10.BAhjaWT, 24 h 48 h, 3 NK10.BAhjaWT,, NK10.BAhjaWT 50%, 48 h 24 h, 2.3,,,
4 , Vol.36, No.3 1 Table 1 Transposon integration sites 3 Fig. 3 Comparison of biofilm formation ability between the wide type strain and the mutants 1 NCBI 95%, citb citg gpsa (EC ), (EC ) 3- (EC ),,,, ;, IRP-1(iron regulatory protein 1),,, RNA, (iron response elements, IREs), 2, 1#,, [9 12] 3-3-, [13] 3# yvfb,, EpsK, EpsK epsa-o epsk,, 2006 Branda eps, [14], 3# Strain Gene 1# citb 2# citg 3# yvfb 4# gpsa Function 3- Insertion site ACGTA-Tn10-TACTTTA TGAAG-Tn10-ATGCGTG CAAAG-Tn10-CATGCAA AAAGA-Tn10-GGCTGTT,,,,,, Mu Tn917 mini-tn10 3 Mu,, 10 2 CFU/μg, Tn917 mini-tn10, 5 kb [15], Tn917, pltv kb [16], Tn917,,, mini-tn10 pic333 7 kb, 10 5 mini-tn10,, [17], mini-tn10 pic333,,, 4
5 : mini-tn [1] O'Toole G, Kaplan HB, Kolter R. Biofilm formation as microbial development. Annu Rev Microbiol, 2000, 54: [2] Pratt LA, Kolter R. Genetic analyses of bacterial biofilm formation. Curr Opin Microbiol, 1999, 2 (6): [3] Stewart PS, Franklin MJ. Physiological heterogeneity in biofilms. Nat Rev Microbiol, 2008, 6 (3): [4] Morikawa M, Kagihiro S, Haruki M, et al. Biofilm formation by a Bacillus subtilis strain that produces gamma-polyglutamate. Microbiology, 2006, 152 (Pt 9): [5] Lemon KP, Earl AM, Vlamakis HC, et al. Biofilm development with an emphasis on Bacillus subtilis. Curr Top Microbiol Immunol, 2008, 322: [6] Steinmetz M, Richter R. Easy cloning of mini-tn10 insertions from the Bacillus subtilis chromosome. J Bacteriol, 1994, 176 (6): [7] Branda SS, Gonzalez-Pastor JE, Dervyn E, et al. Genes involved in formation of structured multicellular communities by Bacillus subtilis. J Bacteriol, 2004, 186 (12): [8] Lazarevic V, Soldo B, Medico N, et al. Bacillus subtilis alpha-phosphoglucomutase is required for normal cell morphology and biofilm formation. Appl Environ Microbiol, 2005, 71 (1): [9] Serio AW, Pechter KB, Sonenshein AL. Bacillus subtilis aconitase is required for efficient late-sporulation gene expression. J Bacteriol, 2006, 188 (17): [10] Craig JE, Ford MJ, Blaydon DC, et al. A null mutation in the Bacillus subtilis aconitase gene causes a block in Spo0A-phosphate-dependent gene expression. J Bacteriol, 1997, 179 (23): [11] Nakano MM, Zuber P, Sonenshein AL. Anaerobic regulation of Bacillus subtilis Krebs cycle genes. J Bacteriol, 1998, 180 (13): [12] Alen C, Sonenshein AL. Bacillus subtilis aconitase is an RNA-binding protein. Proc Natl Acad Sci USA, 1999, 96 (18): [13] Nishibori A, Kusaka J, Hara H, et al. Phosphatidylethanolamine domains and localization of phospholipid synthases in Bacillus subtilis membranes. J Bacteriol, 2005, 187 (6): [14] Branda SS, Chu F, Kearns DB, et al. A major protein component of the Bacillus subtilis biofilm matrix. Mol Microbiol, 2006, 59 (4): [15] Shaw JH, Clewell DB. Complete nucleotide sequence of macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis. J Bacteriol, 1985, 164 (2): [16] Camilli A, Portnoy A, Youngman P. Insertional mutagenesis of Listeria monocytogenes with a novel Tn917 derivative that allows direct cloning of DNA flanking transposon insertions. J Bacteriol, 1990, 172 (7): [17] Bender J, Kleckner N. IS10 transposase mutations that specifically alter target site recognition. Embo J, 1992, 11 (2): (210297) (100101) 1 3 Tel(010) tongbao@im.ac.cn; bjb@im.ac.cn; BM413
Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al.
Supplemental materials for Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al. 1. Table S1. Strains used in this study 2. Table S2. Plasmids used in this study
More informationMini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for
Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI
More informationSupporting Information
Supporting Information López et al. 10.1073/pnas.0810940106 1. Ivey DM, et al. (1993) Cloning and characterization of a putative Ca2 /H antiporter gene from Escherichia coli upon functional complementation
More informationGene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
More informationSalt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation
Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation Nils Widderich 1,, Christopher D.A. Rodrigues 2,, Fabian M. Commichau
More informationBiofilm Development with an Emphasis on Bacillus subtilis
Biofilm Development with an Emphasis on Bacillus subtilis K. P. Lemon, A. M. Earl, H. C. Vlamakis, C. Aguilar, and R. Kolter (*ü ) 1 How Do We Study Biofilms in the Laboratory?.................................
More informationHorizontal transfer and pathogenicity
Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT
More informationFura22. Ca 2 +, Study on Transmembrane Behaviors of Ca 2 + to Escherichia coli Cells with Fura22 Fluorescence Probe
2004 62 4, 445 448 ACTA CHIMICA SINICA Vol 62, 2004 No 4, 445 448 Fura22 Ca 2 + Ξ, a, b b b a Ξ ( a 430072) ( b 430072) Fura22/ AM, Ca 2 + HB101, CaCl 2, Ca 2 +, ; Ca 2 +, Ca 2 +, Ca 2 +, Fura22/ AM, Study
More informationHelical Macrofiber Formation in Bacillus subtilis: Inhibition by Penicillin G
JOURNAL OF BACTERIOLOGY, June 1984, p. 1182-1187 0021-9193/84/061182-06$02.00/0 Copyright C 1984, American Society for Microbiology Vol. 158, No. 3 Helical Macrofiber Formation in Bacillus subtilis: Inhibition
More informationThe Effect of Dynamic Magnetic Field on Microorganisms
3 4 Vol3 No4 29 8 Life Science Research Aug 29 29,2 *,,,,,,,, 772 2 2563 :,, ( ),,,,,,, ;,,,,, : ; ; ; ; : Q955 : A :7-7847(29)4-32-7 The Effect of Dynamic Magnetic Field on Microorganisms YIN Huan-cai,2
More informationThe Effect of Static Magnetic Field on E. coli, S. aureus and B. subtilis Viability
The Effect of Static Magnetic Field on E. coli, S. aureus and B. subtilis Viability Khaled A. Al-Khaza'leh 1* Abdullah T. Al-fawwaz 2 1. Department of Physics, Al-albayt University, PO box 130040, Mafraq,
More informationDEGREE (if applicable) AB MA PhD
NAME: David A. Dubnau OMB No. 0925-0001 and 0925-0002 (Rev. 09/17 Approved Through 03/31/2020) BIOGRAPHICAL SKETCH Provide the following information for the Senior/key personnel and other significant contributors.
More informationRole of CodY in Regulation of the Bacillus subtilis hut Operon
JOURNAL OF BACTERIOLOGY, July 1996, p. 3779 3784 Vol. 178, No. 13 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology Role of CodY in Regulation of the Bacillus subtilis hut Operon
More informationAP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationPlant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationCharacterizing the interplay between multiple levels of organization within bacterial sigma factor regulatory networks
Supplementary Information Characterizing the interplay between multiple levels of organization within bacterial sigma factor regulatory networks Yu Qiu 1, Harish Nagarajan 1, Mallory Embree 1, Wendy Shieu
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationMicrobial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
More informationGenomic Arrangement of Regulons in Bacterial Genomes
l Genomes Han Zhang 1,2., Yanbin Yin 1,3., Victor Olman 1, Ying Xu 1,3,4 * 1 Computational Systems Biology Laboratory, Department of Biochemistry and Molecular Biology and Institute of Bioinformatics,
More informationIntegration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome
J. Gen. Appl. Microbiol., 44, 107 111 (1998) Short Communication Integration and amplification of the Bacillus sp. 79-23 cellulase gene in the Bacillus subtilis 168 chromosome Kyung Hwa Jung, Dae-Hee Lee,
More informationGENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
More informationEvidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A
Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A Masaya Fujita and Richard Losick 1 Department of Molecular
More informationGenetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
More informationCodY Is Required for Nutritional Repression of Bacillus subtilis Genetic Competence
JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5910 5915 Vol. 178, No. 20 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology CodY Is Required for Nutritional Repression of Bacillus subtilis
More informationVital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
More informationSinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis
Leiman et al. BMC Microbiology 2014, 14:301 RESEARCH ARTICLE Open Access SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis Sara A Leiman 1,
More informationIsolation and identif ication of a phenol2degrading bacterial stra in
20 4 2000 7 ACTA SCIEN TIAE CIRCUMSTAN TIAE Vol. 20,No. 4 J uly,2000 :025322468 (2000)2042450206 :X172 :A 1,2,3, 3, 3, 3 3, 2, 1 (1., 100086 ; 2., 100094 ; 3., 100094) : PHEA22,, 394 nmol/ (mg min). Biolog,
More informationTranscription of the SsrAB Regulon Is Repressed by Alkaline ph and Is Independent of PhoPQ and Magnesium Concentration
JOURNAL OF BACTERIOLOGY, Mar. 2002, p. 1493 1497 Vol. 184, No. 5 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.5.1493 1497.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Transcription
More informationThe Major Role of Spo0A in Genetic Competence Is To Downregulate abrb, an Essential Competence Gene
JOURNAL OF BACTERIOLOGY, June 1995, p. 3601 3605 Vol. 177, No. 12 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology The Major Role of Spo0A in Genetic Competence Is To Downregulate
More informationThe Complete Genome Sequence of Bacillus thuringiensis subsp. chinensis strain CT-43
JB Accepts, published online ahead of print on 6 May 2011 J. Bacteriol. doi:10.1128/jb.05085-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationSurfaces of Spo0A and RNA Polymerase Sigma Factor A That Interact at the spoiig Promoter in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Jan. 2004, p. 200 206 Vol. 186, No. 1 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.1.200 206.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Surfaces
More informationC. elegans as an in vivo model to decipher microbial virulence. Centre d Immunologie de Marseille-Luminy
C. elegans as an in vivo model to decipher microbial virulence Centre d Immunologie de Marseille-Luminy C. elegans : a model organism Mechanisms of apoptosis, RNA interference Neuronal function and development
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationCommunication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing
Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing Ioan I. Ardelean Institute of Biology of the Romanian Academy Centre of Microbiology Splaiul Independentei
More informationBACTERIAL TOLERANCE TO HEAVY METALS UNDER THE INFLUENCE OF ph, TEMPERATURE AND SALINITY
BACTERIAL TOLERANCE TO HEAVY METALS UNDER THE INFLUENCE OF ph, TEMPERATURE AND SALINITY 1 J. JOONU, 2 KAVITHA.P, 3 SUGANYA.T 1, 2, 3 Department of Zoology, Bishop Heber College, Trichy 17, Tamilnadu. India
More informationBiology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
More informationThe Last Gene of the fla/che Operon in Bacillus subtilis, ylxl, Is Required for Maximal D Function
JOURNAL OF BACTERIOLOGY, June 2004, p. 4025 4029 Vol. 186, No. 12 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.12.4025 4029.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. The
More informationModulation of the ComA-Dependent Quorum Response in Bacillus subtilis by Multiple Rap Proteins and Phr Peptides
JOURNAL OF BACTERIOLOGY, July 2006, p. 5273 5285 Vol. 188, No. 14 0021-9193/06/$08.00 0 doi:10.1128/jb.00300-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Modulation of the
More informationNAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. 1.
Chapter 3 Study Guide Explain the 3 main characteristics that help differentiate prokaryotes from eukaryotes. What are the 7 structures/substances found in all bacterial cells? What are 8 specific structures
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationINTERNAL STRUCTURE Cytoplasmic membrane peripheral integral
INTERNAL STRUCTURE Cytoplasmic membrane Under the cell wall and generally same structure with bacteria It consists of two layers On the surface of periplasmic space and cytoplasm, protein and phospholipid
More informationSupporting Information
Supporting Information Wilson et al. 10.1073/pnas.0804276105 Fig. S1. Sites of oxazolidinone resistance mutations in bacteria and archaea. (a) Secondary structure of the peptidyltransferase ring of the
More informationMicrobial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
More informationCellular Organization
Cellular Organization part of Räumliche Organisation molekularbiologischer Prozesse Computational EvoDevo University Leipzig Leipzig, SS 2012 Class Schedule 10 60 minutes Cellular Organization and Cell
More informationEffect of varying temperature on growth, morphology and soluble protein content of div IV and div V mutant strains of Bacillus subtilis
African Journal of Biotechnology Vol. 7 (10), pp. 1505-1511, 16 May, 2008 Available online at http://www.academicjournals.org/ajb ISSN 1684 5315 2008 Academic Journals Full Length Research Paper Effect
More information2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
More informationkina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051
Microbiology (2008), 154, 54 63 DOI 10.1099/mic.0.2007/011783-0 kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051 Kazuo Kobayashi, 1 Ritsuko Kuwana 2 and Hiromu
More informationthe noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
More informationIntroduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
More informationphenomenon called cross resistance. As a consequence of cross resistance the entire class of aminoglycosides looses its therapeutic potential.
Experiment 25 Laboratory to Biology III Diversity of Microorganisms / Wintersemester / page 1 Mechanisms of aminoglycoside resistance in mycobacteria Advisor P.D. Dr. Peter Sander, psander@immv.unizh.ch,
More informationFEMS Microbiology Letters 173 (1999) 217^222
FEMS Microbiology Letters 173 (1999) 217^222 Expression of the genes for guanyl-speci c ribonucleases from Bacillus intermedius and Bacillus pumilus is regulated by the two component signal transduction
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationTitle: A novel mechanism of protein thermostability: a unique N-terminal domain confers
1 2 Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers heat resistance to Fe/Mn-SODs 3 4 Running Title: Thermostability-improving peptide for SODs 5 6 7 8 Authors Wei
More informationIntroduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
More information2. Yeast two-hybrid system
2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates
More informationDNA Technology, Bacteria, Virus and Meiosis Test REVIEW
Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by
More informationUNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More informationRegulation of Bacillus subtilis H (Spo0H) and AbrB in Response to Changes in External ph
JOURNAL OF BACTERIOLOGY, Nov. 1997, p. 6778 6787 Vol. 179, No. 21 0021-9193/97/$04.00 0 Copyright 1997, American Society for Microbiology Regulation of Bacillus subtilis H (Spo0H) and AbrB in Response
More informationCannibalism by Sporulating Bacteria
Cannibalism by Sporulating Bacteria José E. González-Pastor, Erret C. Hobbs, Richard Losick 2003. Science 301:510-513 Introduction Some bacteria form spores. Scientist are intrigued by them. Bacillus subtilis
More informationNIH Public Access Author Manuscript Trends Microbiol. Author manuscript; available in PMC 2010 February 10.
NIH Public Access Author Manuscript Published in final edited form as: Trends Microbiol. 2008 June ; 16(6): 269. doi:10.1016/j.tim.2008.03.004. Ecology and genomics of Bacillus subtilis Ashlee M. Earl
More informationEASTERN ARIZONA COLLEGE General Biology I
EASTERN ARIZONA COLLEGE General Biology I Course Design 2013-2014 Course Information Division Science Course Number BIO 181 (SUN# BIO 1181) Title General Biology I Credits 4 Developed by David J. Henson
More information(starvation). Description a. Predicted operon members b. Gene no. a. Relative change in expression (n-fold) mutant vs. wild type.
1 Table S1. Genes whose expression differ in the phyr mutant 8402 and/or in the ecfg mutant 8404 compared with the wild type when grown to the mid-exponential phase (OD600 0.5-0.7) in rich medium (PSY)
More information3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
More informationSupplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor
Supplementary information A proposal for a novel impact factor as an alternative to the JCR impact factor Zu-Guo Yang a and Chun-Ting Zhang b, * a Library, Tianjin University, Tianjin 300072, China b Department
More informationUse of the 3M Molecular Detection System for Salmonella and Listeria spp.
Use of the 3M Molecular Detection System for Salmonella and Listeria spp. March 11, 213 Prof Steve Forsythe Pathogen Research Centre, School of Science and Technology Nottingham Trent University Clifton
More informationTE content correlates positively with genome size
TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot
More informationSupporting Information
1 Supporting Information 5 6 7 8 9 10 11 1 1 1 15 16 17 Sequences: E. coli lysine riboswitch (ECRS): GTACTACCTGCGCTAGCGCAGGCCAGAAGAGGCGCGTTGCCCAAGTAACGGTGTTGGAGGAGCCAG TCCTGTGATAACACCTGAGGGGGTGCATCGCCGAGGTGATTGAACGGCTGGCCACGTTCATCATCGG
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationSupplementary Figure 1. The proportion S. aureus CFU of the total CFU (S. aureus + E. faecalis CFU) per host in worms
Supplementary Figure 1. The proportion S. aureus CFU of the total CFU (S. aureus + E. faecalis CFU) per host in worms alive or dead at 24 hours of exposure. Two sample t-test: t = 1.22, df = 10, P= 0.25.
More informationOutline. Collective behavior in bacteria. Know your horsemen. Importance. Cooperation and disease. Medical applications?
Collective behavior in bacteria Will Driscoll April 30 th, 2008 Outline Importance Our macrobial bias Quorum sensing Biofilms Physiology Development Prokaryotic stab at multicellularity? Discussion But
More informationQuorum sensing in plantassociated. S. Brook Peterson Parsek Lab UW Microbiology
Quorum sensing in plantassociated bacteria S. Brook Peterson Parsek Lab UW Microbiology Outline What is quorum sensing? QS in plant associated bacteria What traits are regulated by QS? What benefits does
More informationGalactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis
RESEARCH ARTICLE Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis Yunrong Chai, a Pascale B. Beauregard, b Hera Vlamakis, b Richard Losick, a and Roberto Kolter b Department
More informationPROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
More informationPoly-γ-glutamic Acid Production by Bacillus subtilis (natto) under High Salt Conditions
JARQ 52 (3), 249-253 (2018) https://www.jircas.go.jp γpga Synthesis Under High Salt Conditions by B. subtilis (natto) Poly-γ-glutamic Acid Production by Bacillus subtilis (natto) under High Salt Conditions
More informationTopic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
More informationMicrobes of many kinds enter complex pathways of development
Fruiting body formation by Bacillus subtilis Steven S. Branda*, José Eduardo González-Pastor, Sigal Ben-Yehuda, Richard Losick, and Roberto Kolter* *Department of Microbiology and Molecular Genetics, Harvard
More informationChapter 12. Genes: Expression and Regulation
Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein
More informationWarm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)
Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,
More informationMONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells
MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition
More informationEXTREMOPHILES Vol. III - Adaptation Processes in Alakaliphiles When Cell Wall Acidity is Elevated - Aono Rikizo
ADAPTATION PROCESSES IN ALKALIPHILES WHEN CELL WALL ACIDITY IS ELEVATED Aono Rikizo (deceased). Tokyo Institute of Technology, Japan Keywords: absolute alkaliphile, alkaline ph-sensitive mutant, alkaline
More informationSporulation Phenotype of a Bacillus subtilis Mutant Expressing an Unprocessable but Active E Transcription Factor
JOURNAL OF BACTERIOLOGY, Apr. 2004, p. 1999 2005 Vol. 186, No. 7 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.7.1999 2005.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Sporulation
More informationRole as adhesin of muramidase released protein of Streptococcus s uis type 2
2002, 25 (4) : 6771 Journal of Nanjing Agricultural University 2 1,2 1 3, (11, 210095 ; 21, 730070) : 2 (SS2) (MRP) : 11 HA9801 (MRP + ) SH006444 (MRP - ) HEp 2, MRP + MRP + ( P < 0105) 21 56 1 h ; DNase
More informationSesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity. from the Edible Mushroom Pleurotus citrinopileatus
Supporting Information Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus Qiao-Qiao Tao 1, 2*, Ke Ma 1*, Li Bao 1, Kai Wang 1, Jun-Jie Han
More informationControl of cell fate by the formation of an architecturally complex bacterial community
Control of cell fate by the formation of an architecturally complex bacterial community Hera Vlamakis, 1,3 Claudio Aguilar, 1,3 Richard Losick, 2 and Roberto Kolter 1,4 1 Department of Microbiology and
More informationPress Release BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION
Press Release 12 172 BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION Genomic analysis of E. coli shows multiple steps to evolve new trait View Video Postdoc researcher Zachary Blount discusses discovering
More informationAgrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis
Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis BOM-11: 10.9 Plasmids: General Principles (review) p. 274 10.11 Conjugation: Essential Features (review) p. 278 19.21 Agrobacterium
More informationGSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
More informationVirginia Western Community College BIO 101 General Biology I
BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental
More informationStrain or plasmid Relevant characteristics Reference
Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More informationA Widely Conserved Gene Cluster Required for Lactate Utilization in Bacillus subtilis and Its Involvement in Biofilm Formation
JOURNAL OF BACTERIOLOGY, Apr. 2009, p. 2423 2430 Vol. 191, No. 8 0021-9193/09/$08.00 0 doi:10.1128/jb.01464-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. A Widely Conserved
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationRok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk
Molecular Microbiology (2002) 43(1), 15 26 Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk Tran Thu Hoa, Pablo Tortosa, Mark Albano and David Dubnau* Public Health
More information2. Draw two water molecules. Using a dotted line, show a hydrogen bond that could form between them.
Biology Final Review Packet Directions: Answer the questions below. You may use any notes, worksheets, or your textbook to find the answers. The questions are divided up based on the different units we
More informationAP Biology. Read college-level text for understanding and be able to summarize main concepts
St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.
More information