Using Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus

Size: px
Start display at page:

Download "Using Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus"

Transcription

1 Microbiology MAR 20, 2009, 36(3): 345~ by Institute of Microbiology, CAS mini-tn10 1, ,2* ( ) ( ) :, mini-tn10 NK10.BAhjaWT 400, 90% 4, citbcitggpsa yvfb citb citg gpsa, yvfb mini-tn10, :,,mini-tn10 Using Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus GAO Wei-Hua 1,2 HAO Jian-An 1 XIA Si-Yuan 1 XU Hai-Jin 1 BAI Yan-Ling 1 ZHANG Xiu-Ming 1 QIAO Ming-Qiang 1,2* (1. Institute for Molecular Biology, College of Life Science, NanKai University, Tianjin , China) (2. Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, Tianjin , China) Abstract: Biofilm has great influence for bacteria to resist the harm from outer environment. Its forming and development are controlled by many different genes. In this research, an insertional mutagenesis library of a wide type Bacillus amyloliquefaciens NK10.BAhjaWT was built via mini-tn10 transposon system to find out genes involved in biofilm formation. Four such genes have been screened, in which, citb, citg, gpsa are all related to the energy metabolism. The function of another gene of yvfb is unknown. In a word, mini-tn10 transposon system was proved to be efficient and stable in Bacillus. Keywords: Biofilm, Bacillus amyloliquefaciens, Mini-Tn10 transposon system (bacterial biofilm), (exopo1ymeric matrix) (microcolony) [1,2] (No ) * Tel: ; : mingqiangqiao@yahoo.com.cn ;

2 , Vol.36, No.3,,, [3],,,,, [4,5] pic333, mini-tn10 [6], ColE1, 35 C ColE1, DNA, ColE1,,,, ( 1),, mini- Tn10,,, (Bacillus amyloliquefaciens)nk10.bahjawt DH5α pic T4 DNA DNA Marker () ; ;, Sigma ;, EP (0.625 mol/l, 1 mmol/l MgCl 2 ) M9-YE (Oxoid ) 3 g/l, (Sigma )10 g/l, l0 M9 10%, 200 g/l 1 Fig. 1 pic333 DNA Insertion of pic333 into chromosome 1%, 1 mo1/l MgSO 4 0.2%, 1 mol/l CaCl %LB (Oxoid ) 5 g/l, 10 g/l, NaCl 10 g/l LB 1 mmol/l MgSO 4 0.1%, LB (Ery)1 μg/ml, (Spc)100 μg/ml, 30 C, (Spc)100 μg/ml 100 μg/ml, 37 C 1.1.4, P15 -GCCGCGTTGGCCGATTC-3 P25 -GATATTCACGGTTTAC

3 : mini-tn ml 5 g/l M9-YE, 30 C200 r/min ; l:l00 25 ml 5 g/l M9-YE, 37 C220 r/min OD ; 4 C6000 r/min 10 min ; 1/3 EP, 4 C 6000 r/min 5 min ; 1/50 EP, l h 100 μl l μl pic333 ( 10 ng)(0.2 cm ), Micro pulser (Bio-Rad ) 2 kv, 1 ml 30 C M9-YE, 30 C120 r/min 1 h 100 μl LB, 30 C, 1.2.2, pic333, 70 C 5 ml LB 30 C 1:100 5 ml LB, 3 h, 42 C 4 h, 10 3, LB, 30 C 48 h,, [7], NK10.BAhjaWT, 1.2.3,, [8], OD , 1 μl 99 μl LB 96, 30 C 24 h 48 h,, 2, 150 μl 1%, 25 min 2, 150 μl DMSO, 570 nm LB 30 C, DNA Hind III DNA ( ), DNA, DH5α, LB, ml 100 μl, 156, pic333 = 156 CFU 10/10 ng= CFU/μg NK10.BAhjaWT, 4 1~4#, 2 1# 2#, 3# 4#,, 2 Fig. 2 Colony morphology of the mutants 2.2 NK10.BAhjaWT, 24 h 48 h, 3 NK10.BAhjaWT,, NK10.BAhjaWT 50%, 48 h 24 h, 2.3,,,

4 , Vol.36, No.3 1 Table 1 Transposon integration sites 3 Fig. 3 Comparison of biofilm formation ability between the wide type strain and the mutants 1 NCBI 95%, citb citg gpsa (EC ), (EC ) 3- (EC ),,,, ;, IRP-1(iron regulatory protein 1),,, RNA, (iron response elements, IREs), 2, 1#,, [9 12] 3-3-, [13] 3# yvfb,, EpsK, EpsK epsa-o epsk,, 2006 Branda eps, [14], 3# Strain Gene 1# citb 2# citg 3# yvfb 4# gpsa Function 3- Insertion site ACGTA-Tn10-TACTTTA TGAAG-Tn10-ATGCGTG CAAAG-Tn10-CATGCAA AAAGA-Tn10-GGCTGTT,,,,,, Mu Tn917 mini-tn10 3 Mu,, 10 2 CFU/μg, Tn917 mini-tn10, 5 kb [15], Tn917, pltv kb [16], Tn917,,, mini-tn10 pic333 7 kb, 10 5 mini-tn10,, [17], mini-tn10 pic333,,, 4

5 : mini-tn [1] O'Toole G, Kaplan HB, Kolter R. Biofilm formation as microbial development. Annu Rev Microbiol, 2000, 54: [2] Pratt LA, Kolter R. Genetic analyses of bacterial biofilm formation. Curr Opin Microbiol, 1999, 2 (6): [3] Stewart PS, Franklin MJ. Physiological heterogeneity in biofilms. Nat Rev Microbiol, 2008, 6 (3): [4] Morikawa M, Kagihiro S, Haruki M, et al. Biofilm formation by a Bacillus subtilis strain that produces gamma-polyglutamate. Microbiology, 2006, 152 (Pt 9): [5] Lemon KP, Earl AM, Vlamakis HC, et al. Biofilm development with an emphasis on Bacillus subtilis. Curr Top Microbiol Immunol, 2008, 322: [6] Steinmetz M, Richter R. Easy cloning of mini-tn10 insertions from the Bacillus subtilis chromosome. J Bacteriol, 1994, 176 (6): [7] Branda SS, Gonzalez-Pastor JE, Dervyn E, et al. Genes involved in formation of structured multicellular communities by Bacillus subtilis. J Bacteriol, 2004, 186 (12): [8] Lazarevic V, Soldo B, Medico N, et al. Bacillus subtilis alpha-phosphoglucomutase is required for normal cell morphology and biofilm formation. Appl Environ Microbiol, 2005, 71 (1): [9] Serio AW, Pechter KB, Sonenshein AL. Bacillus subtilis aconitase is required for efficient late-sporulation gene expression. J Bacteriol, 2006, 188 (17): [10] Craig JE, Ford MJ, Blaydon DC, et al. A null mutation in the Bacillus subtilis aconitase gene causes a block in Spo0A-phosphate-dependent gene expression. J Bacteriol, 1997, 179 (23): [11] Nakano MM, Zuber P, Sonenshein AL. Anaerobic regulation of Bacillus subtilis Krebs cycle genes. J Bacteriol, 1998, 180 (13): [12] Alen C, Sonenshein AL. Bacillus subtilis aconitase is an RNA-binding protein. Proc Natl Acad Sci USA, 1999, 96 (18): [13] Nishibori A, Kusaka J, Hara H, et al. Phosphatidylethanolamine domains and localization of phospholipid synthases in Bacillus subtilis membranes. J Bacteriol, 2005, 187 (6): [14] Branda SS, Chu F, Kearns DB, et al. A major protein component of the Bacillus subtilis biofilm matrix. Mol Microbiol, 2006, 59 (4): [15] Shaw JH, Clewell DB. Complete nucleotide sequence of macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis. J Bacteriol, 1985, 164 (2): [16] Camilli A, Portnoy A, Youngman P. Insertional mutagenesis of Listeria monocytogenes with a novel Tn917 derivative that allows direct cloning of DNA flanking transposon insertions. J Bacteriol, 1990, 172 (7): [17] Bender J, Kleckner N. IS10 transposase mutations that specifically alter target site recognition. Embo J, 1992, 11 (2): (210297) (100101) 1 3 Tel(010) tongbao@im.ac.cn; bjb@im.ac.cn; BM413

Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al.

Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al. Supplemental materials for Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al. 1. Table S1. Strains used in this study 2. Table S2. Plasmids used in this study

More information

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI

More information

Supporting Information

Supporting Information Supporting Information López et al. 10.1073/pnas.0810940106 1. Ivey DM, et al. (1993) Cloning and characterization of a putative Ca2 /H antiporter gene from Escherichia coli upon functional complementation

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation

Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation Nils Widderich 1,, Christopher D.A. Rodrigues 2,, Fabian M. Commichau

More information

Biofilm Development with an Emphasis on Bacillus subtilis

Biofilm Development with an Emphasis on Bacillus subtilis Biofilm Development with an Emphasis on Bacillus subtilis K. P. Lemon, A. M. Earl, H. C. Vlamakis, C. Aguilar, and R. Kolter (*ü ) 1 How Do We Study Biofilms in the Laboratory?.................................

More information

Horizontal transfer and pathogenicity

Horizontal transfer and pathogenicity Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT

More information

Fura22. Ca 2 +, Study on Transmembrane Behaviors of Ca 2 + to Escherichia coli Cells with Fura22 Fluorescence Probe

Fura22. Ca 2 +, Study on Transmembrane Behaviors of Ca 2 + to Escherichia coli Cells with Fura22 Fluorescence Probe 2004 62 4, 445 448 ACTA CHIMICA SINICA Vol 62, 2004 No 4, 445 448 Fura22 Ca 2 + Ξ, a, b b b a Ξ ( a 430072) ( b 430072) Fura22/ AM, Ca 2 + HB101, CaCl 2, Ca 2 +, ; Ca 2 +, Ca 2 +, Ca 2 +, Fura22/ AM, Study

More information

Helical Macrofiber Formation in Bacillus subtilis: Inhibition by Penicillin G

Helical Macrofiber Formation in Bacillus subtilis: Inhibition by Penicillin G JOURNAL OF BACTERIOLOGY, June 1984, p. 1182-1187 0021-9193/84/061182-06$02.00/0 Copyright C 1984, American Society for Microbiology Vol. 158, No. 3 Helical Macrofiber Formation in Bacillus subtilis: Inhibition

More information

The Effect of Dynamic Magnetic Field on Microorganisms

The Effect of Dynamic Magnetic Field on Microorganisms 3 4 Vol3 No4 29 8 Life Science Research Aug 29 29,2 *,,,,,,,, 772 2 2563 :,, ( ),,,,,,, ;,,,,, : ; ; ; ; : Q955 : A :7-7847(29)4-32-7 The Effect of Dynamic Magnetic Field on Microorganisms YIN Huan-cai,2

More information

The Effect of Static Magnetic Field on E. coli, S. aureus and B. subtilis Viability

The Effect of Static Magnetic Field on E. coli, S. aureus and B. subtilis Viability The Effect of Static Magnetic Field on E. coli, S. aureus and B. subtilis Viability Khaled A. Al-Khaza'leh 1* Abdullah T. Al-fawwaz 2 1. Department of Physics, Al-albayt University, PO box 130040, Mafraq,

More information

DEGREE (if applicable) AB MA PhD

DEGREE (if applicable) AB MA PhD NAME: David A. Dubnau OMB No. 0925-0001 and 0925-0002 (Rev. 09/17 Approved Through 03/31/2020) BIOGRAPHICAL SKETCH Provide the following information for the Senior/key personnel and other significant contributors.

More information

Role of CodY in Regulation of the Bacillus subtilis hut Operon

Role of CodY in Regulation of the Bacillus subtilis hut Operon JOURNAL OF BACTERIOLOGY, July 1996, p. 3779 3784 Vol. 178, No. 13 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology Role of CodY in Regulation of the Bacillus subtilis hut Operon

More information

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

CHAPTER : Prokaryotic Genetics

CHAPTER : Prokaryotic Genetics CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering

More information

Plant transformation

Plant transformation Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Characterizing the interplay between multiple levels of organization within bacterial sigma factor regulatory networks

Characterizing the interplay between multiple levels of organization within bacterial sigma factor regulatory networks Supplementary Information Characterizing the interplay between multiple levels of organization within bacterial sigma factor regulatory networks Yu Qiu 1, Harish Nagarajan 1, Mallory Embree 1, Wendy Shieu

More information

Biology 112 Practice Midterm Questions

Biology 112 Practice Midterm Questions Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,

More information

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination. Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial

More information

Genomic Arrangement of Regulons in Bacterial Genomes

Genomic Arrangement of Regulons in Bacterial Genomes l Genomes Han Zhang 1,2., Yanbin Yin 1,3., Victor Olman 1, Ying Xu 1,3,4 * 1 Computational Systems Biology Laboratory, Department of Biochemistry and Molecular Biology and Institute of Bioinformatics,

More information

Integration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome

Integration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome J. Gen. Appl. Microbiol., 44, 107 111 (1998) Short Communication Integration and amplification of the Bacillus sp. 79-23 cellulase gene in the Bacillus subtilis 168 chromosome Kyung Hwa Jung, Dae-Hee Lee,

More information

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription

More information

Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A

Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A Masaya Fujita and Richard Losick 1 Department of Molecular

More information

Genetic Basis of Variation in Bacteria

Genetic Basis of Variation in Bacteria Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material

More information

CodY Is Required for Nutritional Repression of Bacillus subtilis Genetic Competence

CodY Is Required for Nutritional Repression of Bacillus subtilis Genetic Competence JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5910 5915 Vol. 178, No. 20 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology CodY Is Required for Nutritional Repression of Bacillus subtilis

More information

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)

Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655) We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of

More information

SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis

SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis Leiman et al. BMC Microbiology 2014, 14:301 RESEARCH ARTICLE Open Access SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis Sara A Leiman 1,

More information

Isolation and identif ication of a phenol2degrading bacterial stra in

Isolation and identif ication of a phenol2degrading bacterial stra in 20 4 2000 7 ACTA SCIEN TIAE CIRCUMSTAN TIAE Vol. 20,No. 4 J uly,2000 :025322468 (2000)2042450206 :X172 :A 1,2,3, 3, 3, 3 3, 2, 1 (1., 100086 ; 2., 100094 ; 3., 100094) : PHEA22,, 394 nmol/ (mg min). Biolog,

More information

Transcription of the SsrAB Regulon Is Repressed by Alkaline ph and Is Independent of PhoPQ and Magnesium Concentration

Transcription of the SsrAB Regulon Is Repressed by Alkaline ph and Is Independent of PhoPQ and Magnesium Concentration JOURNAL OF BACTERIOLOGY, Mar. 2002, p. 1493 1497 Vol. 184, No. 5 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.5.1493 1497.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Transcription

More information

The Major Role of Spo0A in Genetic Competence Is To Downregulate abrb, an Essential Competence Gene

The Major Role of Spo0A in Genetic Competence Is To Downregulate abrb, an Essential Competence Gene JOURNAL OF BACTERIOLOGY, June 1995, p. 3601 3605 Vol. 177, No. 12 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology The Major Role of Spo0A in Genetic Competence Is To Downregulate

More information

The Complete Genome Sequence of Bacillus thuringiensis subsp. chinensis strain CT-43

The Complete Genome Sequence of Bacillus thuringiensis subsp. chinensis strain CT-43 JB Accepts, published online ahead of print on 6 May 2011 J. Bacteriol. doi:10.1128/jb.05085-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Surfaces of Spo0A and RNA Polymerase Sigma Factor A That Interact at the spoiig Promoter in Bacillus subtilis

Surfaces of Spo0A and RNA Polymerase Sigma Factor A That Interact at the spoiig Promoter in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Jan. 2004, p. 200 206 Vol. 186, No. 1 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.1.200 206.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Surfaces

More information

C. elegans as an in vivo model to decipher microbial virulence. Centre d Immunologie de Marseille-Luminy

C. elegans as an in vivo model to decipher microbial virulence. Centre d Immunologie de Marseille-Luminy C. elegans as an in vivo model to decipher microbial virulence Centre d Immunologie de Marseille-Luminy C. elegans : a model organism Mechanisms of apoptosis, RNA interference Neuronal function and development

More information

Bacterial Genetics & Operons

Bacterial Genetics & Operons Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the

More information

Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing

Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing Ioan I. Ardelean Institute of Biology of the Romanian Academy Centre of Microbiology Splaiul Independentei

More information

BACTERIAL TOLERANCE TO HEAVY METALS UNDER THE INFLUENCE OF ph, TEMPERATURE AND SALINITY

BACTERIAL TOLERANCE TO HEAVY METALS UNDER THE INFLUENCE OF ph, TEMPERATURE AND SALINITY BACTERIAL TOLERANCE TO HEAVY METALS UNDER THE INFLUENCE OF ph, TEMPERATURE AND SALINITY 1 J. JOONU, 2 KAVITHA.P, 3 SUGANYA.T 1, 2, 3 Department of Zoology, Bishop Heber College, Trichy 17, Tamilnadu. India

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

The Last Gene of the fla/che Operon in Bacillus subtilis, ylxl, Is Required for Maximal D Function

The Last Gene of the fla/che Operon in Bacillus subtilis, ylxl, Is Required for Maximal D Function JOURNAL OF BACTERIOLOGY, June 2004, p. 4025 4029 Vol. 186, No. 12 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.12.4025 4029.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. The

More information

Modulation of the ComA-Dependent Quorum Response in Bacillus subtilis by Multiple Rap Proteins and Phr Peptides

Modulation of the ComA-Dependent Quorum Response in Bacillus subtilis by Multiple Rap Proteins and Phr Peptides JOURNAL OF BACTERIOLOGY, July 2006, p. 5273 5285 Vol. 188, No. 14 0021-9193/06/$08.00 0 doi:10.1128/jb.00300-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Modulation of the

More information

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. 1.

NAME: Microbiology BI234 MUST be written and will not be accepted as a typed document. 1. Chapter 3 Study Guide Explain the 3 main characteristics that help differentiate prokaryotes from eukaryotes. What are the 7 structures/substances found in all bacterial cells? What are 8 specific structures

More information

Fitness constraints on horizontal gene transfer

Fitness constraints on horizontal gene transfer Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:

More information

INTERNAL STRUCTURE Cytoplasmic membrane peripheral integral

INTERNAL STRUCTURE Cytoplasmic membrane peripheral integral INTERNAL STRUCTURE Cytoplasmic membrane Under the cell wall and generally same structure with bacteria It consists of two layers On the surface of periplasmic space and cytoplasm, protein and phospholipid

More information

Supporting Information

Supporting Information Supporting Information Wilson et al. 10.1073/pnas.0804276105 Fig. S1. Sites of oxazolidinone resistance mutations in bacteria and archaea. (a) Secondary structure of the peptidyltransferase ring of the

More information

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,

More information

Cellular Organization

Cellular Organization Cellular Organization part of Räumliche Organisation molekularbiologischer Prozesse Computational EvoDevo University Leipzig Leipzig, SS 2012 Class Schedule 10 60 minutes Cellular Organization and Cell

More information

Effect of varying temperature on growth, morphology and soluble protein content of div IV and div V mutant strains of Bacillus subtilis

Effect of varying temperature on growth, morphology and soluble protein content of div IV and div V mutant strains of Bacillus subtilis African Journal of Biotechnology Vol. 7 (10), pp. 1505-1511, 16 May, 2008 Available online at http://www.academicjournals.org/ajb ISSN 1684 5315 2008 Academic Journals Full Length Research Paper Effect

More information

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant? Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was

More information

kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051

kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051 Microbiology (2008), 154, 54 63 DOI 10.1099/mic.0.2007/011783-0 kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051 Kazuo Kobayashi, 1 Ritsuko Kuwana 2 and Hiromu

More information

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic

More information

Introduction. Gene expression is the combined process of :

Introduction. Gene expression is the combined process of : 1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression

More information

phenomenon called cross resistance. As a consequence of cross resistance the entire class of aminoglycosides looses its therapeutic potential.

phenomenon called cross resistance. As a consequence of cross resistance the entire class of aminoglycosides looses its therapeutic potential. Experiment 25 Laboratory to Biology III Diversity of Microorganisms / Wintersemester / page 1 Mechanisms of aminoglycoside resistance in mycobacteria Advisor P.D. Dr. Peter Sander, psander@immv.unizh.ch,

More information

FEMS Microbiology Letters 173 (1999) 217^222

FEMS Microbiology Letters 173 (1999) 217^222 FEMS Microbiology Letters 173 (1999) 217^222 Expression of the genes for guanyl-speci c ribonucleases from Bacillus intermedius and Bacillus pumilus is regulated by the two component signal transduction

More information

Genomes and Their Evolution

Genomes and Their Evolution Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers

Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers 1 2 Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers heat resistance to Fe/Mn-SODs 3 4 Running Title: Thermostability-improving peptide for SODs 5 6 7 8 Authors Wei

More information

Introduction to Bioinformatics Integrated Science, 11/9/05

Introduction to Bioinformatics Integrated Science, 11/9/05 1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction

More information

2. Yeast two-hybrid system

2. Yeast two-hybrid system 2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates

More information

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW

DNA Technology, Bacteria, Virus and Meiosis Test REVIEW Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by

More information

UNIT 5. Protein Synthesis 11/22/16

UNIT 5. Protein Synthesis 11/22/16 UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

Last time: Obtaining information from a cloned gene

Last time: Obtaining information from a cloned gene Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?

More information

Regulation of Bacillus subtilis H (Spo0H) and AbrB in Response to Changes in External ph

Regulation of Bacillus subtilis H (Spo0H) and AbrB in Response to Changes in External ph JOURNAL OF BACTERIOLOGY, Nov. 1997, p. 6778 6787 Vol. 179, No. 21 0021-9193/97/$04.00 0 Copyright 1997, American Society for Microbiology Regulation of Bacillus subtilis H (Spo0H) and AbrB in Response

More information

Cannibalism by Sporulating Bacteria

Cannibalism by Sporulating Bacteria Cannibalism by Sporulating Bacteria José E. González-Pastor, Erret C. Hobbs, Richard Losick 2003. Science 301:510-513 Introduction Some bacteria form spores. Scientist are intrigued by them. Bacillus subtilis

More information

NIH Public Access Author Manuscript Trends Microbiol. Author manuscript; available in PMC 2010 February 10.

NIH Public Access Author Manuscript Trends Microbiol. Author manuscript; available in PMC 2010 February 10. NIH Public Access Author Manuscript Published in final edited form as: Trends Microbiol. 2008 June ; 16(6): 269. doi:10.1016/j.tim.2008.03.004. Ecology and genomics of Bacillus subtilis Ashlee M. Earl

More information

EASTERN ARIZONA COLLEGE General Biology I

EASTERN ARIZONA COLLEGE General Biology I EASTERN ARIZONA COLLEGE General Biology I Course Design 2013-2014 Course Information Division Science Course Number BIO 181 (SUN# BIO 1181) Title General Biology I Credits 4 Developed by David J. Henson

More information

(starvation). Description a. Predicted operon members b. Gene no. a. Relative change in expression (n-fold) mutant vs. wild type.

(starvation). Description a. Predicted operon members b. Gene no. a. Relative change in expression (n-fold) mutant vs. wild type. 1 Table S1. Genes whose expression differ in the phyr mutant 8402 and/or in the ecfg mutant 8404 compared with the wild type when grown to the mid-exponential phase (OD600 0.5-0.7) in rich medium (PSY)

More information

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.

3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization. 3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of

More information

Supplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor

Supplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor Supplementary information A proposal for a novel impact factor as an alternative to the JCR impact factor Zu-Guo Yang a and Chun-Ting Zhang b, * a Library, Tianjin University, Tianjin 300072, China b Department

More information

Use of the 3M Molecular Detection System for Salmonella and Listeria spp.

Use of the 3M Molecular Detection System for Salmonella and Listeria spp. Use of the 3M Molecular Detection System for Salmonella and Listeria spp. March 11, 213 Prof Steve Forsythe Pathogen Research Centre, School of Science and Technology Nottingham Trent University Clifton

More information

TE content correlates positively with genome size

TE content correlates positively with genome size TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot

More information

Supporting Information

Supporting Information 1 Supporting Information 5 6 7 8 9 10 11 1 1 1 15 16 17 Sequences: E. coli lysine riboswitch (ECRS): GTACTACCTGCGCTAGCGCAGGCCAGAAGAGGCGCGTTGCCCAAGTAACGGTGTTGGAGGAGCCAG TCCTGTGATAACACCTGAGGGGGTGCATCGCCGAGGTGATTGAACGGCTGGCCACGTTCATCATCGG

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Supplementary Figure 1. The proportion S. aureus CFU of the total CFU (S. aureus + E. faecalis CFU) per host in worms

Supplementary Figure 1. The proportion S. aureus CFU of the total CFU (S. aureus + E. faecalis CFU) per host in worms Supplementary Figure 1. The proportion S. aureus CFU of the total CFU (S. aureus + E. faecalis CFU) per host in worms alive or dead at 24 hours of exposure. Two sample t-test: t = 1.22, df = 10, P= 0.25.

More information

Outline. Collective behavior in bacteria. Know your horsemen. Importance. Cooperation and disease. Medical applications?

Outline. Collective behavior in bacteria. Know your horsemen. Importance. Cooperation and disease. Medical applications? Collective behavior in bacteria Will Driscoll April 30 th, 2008 Outline Importance Our macrobial bias Quorum sensing Biofilms Physiology Development Prokaryotic stab at multicellularity? Discussion But

More information

Quorum sensing in plantassociated. S. Brook Peterson Parsek Lab UW Microbiology

Quorum sensing in plantassociated. S. Brook Peterson Parsek Lab UW Microbiology Quorum sensing in plantassociated bacteria S. Brook Peterson Parsek Lab UW Microbiology Outline What is quorum sensing? QS in plant associated bacteria What traits are regulated by QS? What benefits does

More information

Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis

Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis RESEARCH ARTICLE Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis Yunrong Chai, a Pascale B. Beauregard, b Hera Vlamakis, b Richard Losick, a and Roberto Kolter b Department

More information

PROTEIN SYNTHESIS INTRO

PROTEIN SYNTHESIS INTRO MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen

More information

Poly-γ-glutamic Acid Production by Bacillus subtilis (natto) under High Salt Conditions

Poly-γ-glutamic Acid Production by Bacillus subtilis (natto) under High Salt Conditions JARQ 52 (3), 249-253 (2018) https://www.jircas.go.jp γpga Synthesis Under High Salt Conditions by B. subtilis (natto) Poly-γ-glutamic Acid Production by Bacillus subtilis (natto) under High Salt Conditions

More information

Topic 4 - #14 The Lactose Operon

Topic 4 - #14 The Lactose Operon Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic

More information

Microbes of many kinds enter complex pathways of development

Microbes of many kinds enter complex pathways of development Fruiting body formation by Bacillus subtilis Steven S. Branda*, José Eduardo González-Pastor, Sigal Ben-Yehuda, Richard Losick, and Roberto Kolter* *Department of Microbiology and Molecular Genetics, Harvard

More information

Chapter 12. Genes: Expression and Regulation

Chapter 12. Genes: Expression and Regulation Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein

More information

Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)

Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,

More information

MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells

MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition

More information

EXTREMOPHILES Vol. III - Adaptation Processes in Alakaliphiles When Cell Wall Acidity is Elevated - Aono Rikizo

EXTREMOPHILES Vol. III - Adaptation Processes in Alakaliphiles When Cell Wall Acidity is Elevated - Aono Rikizo ADAPTATION PROCESSES IN ALKALIPHILES WHEN CELL WALL ACIDITY IS ELEVATED Aono Rikizo (deceased). Tokyo Institute of Technology, Japan Keywords: absolute alkaliphile, alkaline ph-sensitive mutant, alkaline

More information

Sporulation Phenotype of a Bacillus subtilis Mutant Expressing an Unprocessable but Active E Transcription Factor

Sporulation Phenotype of a Bacillus subtilis Mutant Expressing an Unprocessable but Active E Transcription Factor JOURNAL OF BACTERIOLOGY, Apr. 2004, p. 1999 2005 Vol. 186, No. 7 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.7.1999 2005.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Sporulation

More information

Role as adhesin of muramidase released protein of Streptococcus s uis type 2

Role as adhesin of muramidase released protein of Streptococcus s uis type 2 2002, 25 (4) : 6771 Journal of Nanjing Agricultural University 2 1,2 1 3, (11, 210095 ; 21, 730070) : 2 (SS2) (MRP) : 11 HA9801 (MRP + ) SH006444 (MRP - ) HEp 2, MRP + MRP + ( P < 0105) 21 56 1 h ; DNase

More information

Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity. from the Edible Mushroom Pleurotus citrinopileatus

Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity. from the Edible Mushroom Pleurotus citrinopileatus Supporting Information Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus Qiao-Qiao Tao 1, 2*, Ke Ma 1*, Li Bao 1, Kai Wang 1, Jun-Jie Han

More information

Control of cell fate by the formation of an architecturally complex bacterial community

Control of cell fate by the formation of an architecturally complex bacterial community Control of cell fate by the formation of an architecturally complex bacterial community Hera Vlamakis, 1,3 Claudio Aguilar, 1,3 Richard Losick, 2 and Roberto Kolter 1,4 1 Department of Microbiology and

More information

Press Release BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION

Press Release BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION Press Release 12 172 BACTERIA'S KEY INNOVATION HELPS UNDERSTAND EVOLUTION Genomic analysis of E. coli shows multiple steps to evolve new trait View Video Postdoc researcher Zachary Blount discusses discovering

More information

Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis

Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis BOM-11: 10.9 Plasmids: General Principles (review) p. 274 10.11 Conjugation: Essential Features (review) p. 278 19.21 Agrobacterium

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

Virginia Western Community College BIO 101 General Biology I

Virginia Western Community College BIO 101 General Biology I BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental

More information

Strain or plasmid Relevant characteristics Reference

Strain or plasmid Relevant characteristics Reference Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688

More information

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking

More information

A Widely Conserved Gene Cluster Required for Lactate Utilization in Bacillus subtilis and Its Involvement in Biofilm Formation

A Widely Conserved Gene Cluster Required for Lactate Utilization in Bacillus subtilis and Its Involvement in Biofilm Formation JOURNAL OF BACTERIOLOGY, Apr. 2009, p. 2423 2430 Vol. 191, No. 8 0021-9193/09/$08.00 0 doi:10.1128/jb.01464-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. A Widely Conserved

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk

Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk Molecular Microbiology (2002) 43(1), 15 26 Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk Tran Thu Hoa, Pablo Tortosa, Mark Albano and David Dubnau* Public Health

More information

2. Draw two water molecules. Using a dotted line, show a hydrogen bond that could form between them.

2. Draw two water molecules. Using a dotted line, show a hydrogen bond that could form between them. Biology Final Review Packet Directions: Answer the questions below. You may use any notes, worksheets, or your textbook to find the answers. The questions are divided up based on the different units we

More information

AP Biology. Read college-level text for understanding and be able to summarize main concepts

AP Biology. Read college-level text for understanding and be able to summarize main concepts St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.

More information