GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
|
|
|
- Nathaniel Chase
- 5 years ago
- Views:
Transcription
1 1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
2 2 DNA Promoter Gene A Gene B Termination Signal Transcription Initiation Termination mrna Initiation Start Stop Start Stop Translation Protein Post-translational Processing
3 3 The production of functioning mrna is very different in prokaryotes and eukaryotes. In prokaryotes, the RNA transcript serves directly as the mrna and translation begins before transcription is completed; that is, transcription and translation are coupled. In eukaryotes, the primary RNA transcript must be modified in the cell nucleus to form mrna. Translation takes place only after the completed mrna is delivered to the cytoplasm.
4 4 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
5 5 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
6 6
7 7 The 3 RNA types Size (approximate) Function transfer-rna (trna) nucleotides Transfer of amino acids to the protein synthesis apparatus of the cell Ribosomal RNA (rrna) messenger-rna (mrna) 4 types (in eukaryotes) with each ca. 120, 150, 1700 and 3500 nucleotides Very different (from several 100 to more than nucleotides) Structural and functional elements of the ribosomes The mrna delivers a gene copy to the protein synthesis apparatus of the cell Taken from: R. Knippers, Molekulare Genetik, 9th Ed., Thieme
8 8
9 9 RNA is single stranded but is organized partly as ds RNA by internal base pairing Loop (secondary structure) formation in the E.coli mrna. The mrna has a length of several thousand nucleotides, only a short part is shown here. This part contains complementary nucleotide sequences that can combine to a double stranded region so that a loop is created at this site. Cytosine pairs with Guanine and Uracil with Adenine. Taken from: R. Knippers, Molekulare Genetik, 9th Ed., Thieme
10 10 Genome map of Bacillus subtilis Genes are transcribed from both strands
11 11 Transcription: Only one strand is transcribed 5 3 GGAGCTAATTATGCGTGGGCACATTCGT CCTCGATTAATACGCACCCGTGTAAGCA 3 5 DNA Codon sequence of encoded protein is reflected in complementary strand 5 GGAGCTAATTATGCGTGGGCACATTCGT GGAGCUAAUUAUGCGUGGGCACAUUCGU 3 RNA CCTCGATTAATACGCACCCGTGTAAGCA 5 Template for transcription
12 12 Transcription start mrna Taken from: R. Knippers, Molekulare Genetik, 9th Ed., Thieme
13 13 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
14 14 Fig : In addition to 70, E. coli has several sigma factors that are induced by particular environmental conditions. Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
15 15 Fig : E. coli sigma factors recognize promoters with different consensus sequences. Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
16 16 Effect of mutations on promoter function Spacing between -35 and -10 region Spacing between -10 region and transcription start
17 17 Fig. 19.7: Eubacterial RNA polymerases have five types of subunits. Fig. 19.5: During transcription, the bubble is maintained within bacterial RNA polymerase, which unwinds and rewinds DNA and synthesizes RNA. Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
18 18 Fig : DNA elements and RNA polymerase modules that contribute to promoter recognition by sigma factor. Fig : RNA polymerase initially contacts the region from 55 to +20. When sigma dissociates, the core enzyme contracts to -30; when the enzyme moves a few base pairs, it becomes more compactly organized into the general elongation complex. Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
19 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning 19 Fig : Sigma factor and core enzyme recycle at different points in transcription.
20 20 nascent RNA chains Scheme of transcription. Transcription starts with an open promoter complex. The holoenzyme causes the unwinding of the region close to the transcription start point (+1). After a few polymerisation steps, the sigma factor leaves the core enzyme which continues its way along the transcribed DNA strand. The released promoter is reoccupied. In parallel, several RNA polymerases are occupied with transcription Taken from: R. Knippers, Molekulare Genetik, 9th Ed., Thieme
21 21 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
22 22 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
23 23 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
24 24 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
25 25 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
26 26 Gene Expression in Eukaryotes -- Introns Taken from: B. Lewin, Essential Genes, Pearson Ed. International
27 27 kb kb Taken from: B. Alberts, Molecular Biology of the Cell, Garland Science
28 28 mrna Synthesis in Eukaryote is a complex Process Transcription Initiation Transcription Elongation 5 Transcript Processing (CAP) Transcription Termination 3 Transcript Processing Intron Splicing Transport into Cytoplasm
29 29 mrna Synthesis in Eukaryote is a complex Process Transcription Initiation Transcription Elongation 5 Transcript Processing (CAP) Transcription Termination 3 Transcript Processing Intron Splicing Transport into Cytoplasm Taken from: B. Lewin, Essential Genes, Pearson Ed. International
30 30 CAP structure at 5 end of mrna Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
31 31 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
32 32 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
33 33 hnrna: heterogeneous nuclear RNA hnrnp: heterogeneous nuclear Ribonucleoprotein
34 34 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
35 35 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
36 36 Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
37 37 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
38 38 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
39 39 snrna: small nuclear RNA snrnp: small nuclear Ribonucleoparticle snurps Taken from: J.E. Krebs, E.S. Goldstein, S.T. Kilpatrick; Lewin s Genes XI ; Jones&Bartlett Learning
40 40 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
41 41 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
42 42 3 -end processing
43 43 3 -end processing PAP: PolyA- Polymerase Taken from: B. Lewin, Essential Genes, Pearson Ed. International
44 44 Transcription in Eukayotes Pol III: Transfer RNA 5S rrna Small nuclear RNA U6 Repeated DNA sequ. (e.g. Alu) Pol I: Ribosomal RNAs Pol II: All coding genes Small nuclear RNAs Taken from: B. Lewin, Essential Genes, Pearson Ed. International
45 45 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
46 46 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
47 47
48 48
49 49
50 50 Pol II Promoters
51 51 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
52 52 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
53 53
54 54
55 55 Regulated Expression in Eukaryotes Complex Initiation System Enhancer Activators Repressing Systems
56 56
57 57
58 58 Taken from: B. Lewin, Essential Genes, Pearson Ed. International
59
GCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Chapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
BME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
From Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
From gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
Multiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
UNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
Molecular Biology - Translation of RNA to make Protein *
OpenStax-CNX module: m49485 1 Molecular Biology - Translation of RNA to make Protein * Jerey Mahr Based on Translation by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative
15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
RNA Processing: Eukaryotic mrnas
RNA Processing: Eukaryotic mrnas Eukaryotic mrnas have three main parts (Figure 13.8): 5! untranslated region (5! UTR), varies in length. The coding sequence specifies the amino acid sequence of the protein
Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
Types of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.
RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Translation and Operons
Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different
Molecular Biology of the Cell
Alberts Johnson Lewis Morgan Raff Roberts Walter Molecular Biology of the Cell Sixth Edition Chapter 6 (pp. 333-368) How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2015 Genetic
RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
9 The Process of Translation
9 The Process of Translation 9.1 Stages of Translation Process We are familiar with the genetic code, we can begin to study the mechanism by which amino acids are assembled into proteins. Because more
Eukaryotic vs. Prokaryotic genes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,
Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Types of RNA Messenger RNA (mrna) makes a copy of DNA, carries instructions for making proteins,
Translation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
Molecular Biology of the Cell
Alberts Johnson Lewis Raff Roberts Walter Molecular Biology of the Cell Fifth Edition Chapter 6 How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2008 Figure 6-1 Molecular Biology
Prokaryotic Regulation
Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory
PROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
Section 7. Junaid Malek, M.D.
Section 7 Junaid Malek, M.D. RNA Processing and Nomenclature For the purposes of this class, please do not refer to anything as mrna that has not been completely processed (spliced, capped, tailed) RNAs
Regulation of Transcription in Eukaryotes
Regulation of Transcription in Eukaryotes Leucine zipper and helix-loop-helix proteins contain DNA-binding domains formed by dimerization of two polypeptide chains. Different members of each family can
(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
Chapter 12. Genes: Expression and Regulation
Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein
Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps
Chapter
Chapter 17 17.4-17.6 Molecular Components of Translation A cell interprets a genetic message and builds a polypeptide The message is a series of codons on mrna The interpreter is called transfer (trna)
Controlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
Lesson Overview. Ribosomes and Protein Synthesis 13.2
13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic
Molecular Biology of the Cell
Alberts Johnson Lewis Raff Roberts Walter Molecular Biology of the Cell Fifth Edition Chapter 6 How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2008 Figure 6-1 Molecular Biology
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
Introduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
The Gene The gene; Genes Genes Allele;
Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh
The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
Old FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.
Old FINAL EXAM BIO409/509 NAME Please number your answers and write them on the attached, lined paper. Gene expression can be regulated at several steps. Describe one example for each of the following:
-14. -Abdulrahman Al-Hanbali. -Shahd Alqudah. -Dr Ma mon Ahram. 1 P a g e
-14 -Abdulrahman Al-Hanbali -Shahd Alqudah -Dr Ma mon Ahram 1 P a g e In this lecture we will talk about the last stage in the synthesis of proteins from DNA which is translation. Translation is the process
Flow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
GENE REGULATION AND PROBLEMS OF DEVELOPMENT
GENE REGULATION AND PROBLEMS OF DEVELOPMENT By Surinder Kaur DIET Ropar Surinder_1998@ yahoo.in Mob No 9988530775 GENE REGULATION Gene is a segment of DNA that codes for a unit of function (polypeptide,
Introduction to molecular biology. Mitesh Shrestha
Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of
Translation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
Molecular Biology (9)
Molecular Biology (9) Translation Mamoun Ahram, PhD Second semester, 2017-2018 1 Resources This lecture Cooper, Ch. 8 (297-319) 2 General information Protein synthesis involves interactions between three
Biology I Fall Semester Exam Review 2014
Biology I Fall Semester Exam Review 2014 Biomolecules and Enzymes (Chapter 2) 8 questions Macromolecules, Biomolecules, Organic Compunds Elements *From the Periodic Table of Elements Subunits Monomers,
Number of questions TEK (Learning Target) Biomolecules & Enzymes
Unit Biomolecules & Enzymes Number of questions TEK (Learning Target) on Exam 8 questions 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how
Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
ومن أحياها Translation 2. Translation 2. DONE BY :Nisreen Obeidat
Translation 2 DONE BY :Nisreen Obeidat Page 0 Prokaryotes - Shine-Dalgarno Sequence (2:18) What we're seeing here are different portions of sequences of mrna of different promoters from different bacterial
Three types of RNA polymerase in eukaryotic nuclei
Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive
Computational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
Translation. Genetic code
Translation Genetic code If genes are segments of DNA and if DNA is just a string of nucleotide pairs, then how does the sequence of nucleotide pairs dictate the sequence of amino acids in proteins? Simple
What is the central dogma of biology?
Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)
Molecular Biology of the Cell
Alberts Johnson Lewis Raff Roberts Walter Molecular Biology of the Cell Fifth Edition Chapter 6 How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2008 Figure 6-1 Molecular Biology
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
RNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
Quiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Quiz answers Kinase: An enzyme
Lecture 7: Simple genetic circuits I
Lecture 7: Simple genetic circuits I Paul C Bressloff (Fall 2018) 7.1 Transcription and translation In Fig. 20 we show the two main stages in the expression of a single gene according to the central dogma.
Introduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
Biology 2018 Final Review. Miller and Levine
Biology 2018 Final Review Miller and Levine bones blood cells elements All living things are made up of. cells If a cell of an organism contains a nucleus, the organism is a(n). eukaryote prokaryote plant
Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
From DNA to protein, i.e. the central dogma
From DNA to protein, i.e. the central dogma DNA RNA Protein Biochemistry, chapters1 5 and Chapters 29 31. Chapters 2 5 and 29 31 will be covered more in detail in other lectures. ph, chapter 1, will be
Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes
9 The Nucleus Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes Explain general structures of Nuclear Envelope, Nuclear Lamina, Nuclear Pore Complex Explain movement of proteins
Welcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
Gene Control Mechanisms at Transcription and Translation Levels
Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9
Genetics 304 Lecture 6
Genetics 304 Lecture 6 00/01/27 Assigned Readings Busby, S. and R.H. Ebright (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79:743-746. Reed, W.L. and
Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION
http://smtom.lecture.ub.ac.id/ Password: https://syukur16tom.wordpress.com/ Password: Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/translation2.gif
REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
Bio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
Chapter 9 DNA recognition by eukaryotic transcription factors
Chapter 9 DNA recognition by eukaryotic transcription factors TRANSCRIPTION 101 Eukaryotic RNA polymerases RNA polymerase RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV Function
CSEP 590A Summer Lecture 4 MLE, EM, RE, Expression
CSEP 590A Summer 2006 Lecture 4 MLE, EM, RE, Expression 1 FYI, re HW #2: Hemoglobin History Alberts et al., 3rd ed.,pg389 2 Tonight MLE: Maximum Likelihood Estimators EM: the Expectation Maximization Algorithm
Laith AL-Mustafa. Protein synthesis. Nabil Bashir 10\28\ First
Laith AL-Mustafa Protein synthesis Nabil Bashir 10\28\2015 http://1drv.ms/1gigdnv 01 First 0 Protein synthesis In previous lectures we started talking about DNA Replication (DNA synthesis) and we covered
CSEP 590A Summer Tonight MLE. FYI, re HW #2: Hemoglobin History. Lecture 4 MLE, EM, RE, Expression. Maximum Likelihood Estimators
CSEP 59A Summer 26 Lecture 4 MLE, EM, RE, Expression FYI, re HW #2: Hemoglobin History 1 Alberts et al., 3rd ed.,pg389 2 Tonight MLE: Maximum Likelihood Estimators EM: the Expectation Maximization Algorithm
UE Praktikum Bioinformatik
UE Praktikum Bioinformatik WS 08/09 University of Vienna 7SK snrna 7SK was discovered as an abundant small nuclear RNA in the mid 70s but a possible function has only recently been suggested. Two independent
GENETICS - CLUTCH CH.11 TRANSLATION.
!! www.clutchprep.com CONCEPT: GENETIC CODE Nucleotides and amino acids are translated in a 1 to 1 method The triplet code states that three nucleotides codes for one amino acid - A codon is a term for
Motifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1.
Motifs and Logos Six Discovering Genomics, Proteomics, and Bioinformatics by A. Malcolm Campbell and Laurie J. Heyer Chapter 2 Genome Sequence Acquisition and Analysis Sami Khuri Department of Computer
A Simple Protein Synthesis Model
A Simple Protein Synthesis Model James K. Peterson Department of Biological Sciences and Department of Mathematical Sciences Clemson University September 3, 213 Outline A Simple Protein Synthesis Model
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
CHAPTER 3. Cell Structure and Genetic Control. Chapter 3 Outline
CHAPTER 3 Cell Structure and Genetic Control Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell Nucleus and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division
Honors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
Bio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.
Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.
2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
Biophysics Lectures Three and Four
Biophysics Lectures Three and Four Kevin Cahill cahill@unm.edu http://dna.phys.unm.edu/ 1 The Atoms and Molecules of Life Cells are mostly made from the most abundant chemical elements, H, C, O, N, Ca,
AQA Biology A-level. relationships between organisms. Notes.
AQA Biology A-level Topic 4: Genetic information, variation and relationships between organisms Notes DNA, genes and chromosomes Both DNA and RNA carry information, for instance DNA holds genetic information
What Kind Of Molecules Carry Protein Assembly Instructions From The Nucleus To The Cytoplasm
What Kind Of Molecules Carry Protein Assembly Instructions From The Nucleus To The Cytoplasm What kind of reaction produces large molecules by linking small molecules? molecules carry protein assembly
Chapter 17 The Mechanism of Translation I: Initiation
Chapter 17 The Mechanism of Translation I: Initiation Focus only on experiments discussed in class. Completely skip Figure 17.36 Read pg 521-527 up to the sentence that begins "In 1969, Joan Steitz..."
MCB 110. "Molecular Biology: Macromolecular Synthesis and Cellular Function" Spring, 2018
MCB 110 "Molecular Biology: Macromolecular Synthesis and Cellular Function" Spring, 2018 Faculty Instructors: Prof. Jeremy Thorner Prof. Qiang Zhou Prof. Eva Nogales GSIs:!!!! Ms. Samantha Fernandez Mr.
Name Period The Control of Gene Expression in Prokaryotes Notes
Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression
Co-ordination occurs in multiple layers Intracellular regulation: self-regulation Intercellular regulation: coordinated cell signalling e.g.
Gene Expression- Overview Differentiating cells Achieved through changes in gene expression All cells contain the same whole genome A typical differentiated cell only expresses ~50% of its total gene Overview
Gene Expression: Translation. transmission of information from mrna to proteins Chapter 5 slide 1
Gene Expression: Translation transmission of information from mrna to proteins 601 20000 Chapter 5 slide 1 Fig. 6.1 General structural formula for an amino acid Peter J. Russell, igenetics: Copyright Pearson