Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers
|
|
- Allan Harmon
- 5 years ago
- Views:
Transcription
1 1 2 Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers heat resistance to Fe/Mn-SODs 3 4 Running Title: Thermostability-improving peptide for SODs Authors Wei Wang a,c,1,#, Ting Ma a,d,1, Baoliang Zhang a, Nana Yao a, Mingchang Li a, Lianlei Cui a, Guoqiang Li a,d, Zhenping Ma b, Jiansong Cheng b,# Affiliations a Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, TEDA Institute of Biological Sciences and Biotechnology, Nankai University, 23 Hongda Street, TEDA, Tianjin , PR China b State Key Laboratory of Medicinal Chemical Biology and College of Pharmacy, Nankai University, Tianjin , PR China c Tianjin Key Laboratory of Microbial Functional Genomics, TEDA, Tianjin , PR China d College of Life Sciences, Nankai University, Tianjin , PR China # Correspondence and requests for materials should be addressed to W.W. (nkweiwang@nankai.edu.cn), or J.C. (jiansongcheng@nankai.edu.cn) 1 W.W. and T.M. contributed equally to this work. 1
2 23 Supplementary Figures and Tables Figure S1. Alignment of N-terminal fragments of SOD NG2215 -like proteins from 13 Geobacillus strains. 2
3 Figure S2. Phylogenetic neighbor-joining tree of identified thermophilic Mn-, Fe- or Mn/Fe- SODs derived from various microorganisms. Three putative SODs from G. thermodenitrificans NG80-2 were included in the dataset, among which the distantly related Cu/Zn-SOD from NG80-2 was used as an outgroup. Sequences are labeled with species, ion preference and the protein size. Accession numbers for SODs used in this analysis are: WP_ , AAD , ADM , AAP , P , YP_ , NP_ , NP_ , ABB , Q , NP_ , ABO , NP_ , AGI , AAS , CAJ , YP_ , YP_ , YP_
4 Figure S3. Thermostability of metal-reconstituted SOD NG2215 (a) and SODA NG2215 (b). The enzymes of Mn 2+ or Fe 2+ reconstituted SOD NG2215 and SODA NG2215 were respectively pre-incubated at 70 C, and aliquots were withdrawn every 10 minutes to test the residual activities at optimum temperature and ph by using the standard assay described in the Methods section. The activity of non-heated SOD was defined as 100%. Each point represents the mean (n = 3) ± standard deviation. 48 4
5 Figure S4. Temperature dependant CD spectra of SOD NG2215 (a) and SOD r (b). 5
6 Figure S5. The 3D plots of SOD NG2215 (a), SODA NG2215 (b), SOD BSn5 (c), SODA BSn5 (d) and SOD r (e). These plots were derived from the Equilibrium Model and generated by using A Matlab version of Equation
7 58 Table S1. Primers used for construction of five recombinant clones in this study. 59 Gene Forward primer/reverse primer (5'-3') Length of PCR fragment (bp) sod NG2215 GGAATTCCATATGGACGACCAAACGTTGTTTGC 1350 CCCAAGCTTTTAAAATGGTTGCCAACGCA soda NG2215 GGAATTCCATATG CCTGGCAAGCATGTGCTGCC 618 CCCAAGCTT TTAAAATGGTTGCCAACGCA sod BSn5 GGAATTCATGAAACGTGAATCTTATCAAACG 846 CCGCTCGAGTTAATAGAGCTTCCAAACGACTTC soda BSn5 GGAATTCCATATG AAACACGTGCTGCCAAAGCT 612 CGCGGATCCTTAATAGAGCTTCCAAACGACTTC sod_n-gtng_2215 GGAATTCCATATGGACGACCAAACGTTGTTTGC 732 GCACATGTTTCGAAACCGCC sod_c-bsn5 GGCGGTTTCGAAACATGTGC 612 CGCGGATCCTTAATAGAGTTTCCAAACGACTTC sod r GGAATTCCATATG GACGACCAAACGTTGTTTGC 1344 CGCGGATCCTTAATAGAGcTTCCAAACGACTTC 60 7
8 Table S2. Metal contents and activities of native, apo, and metal-reconstituted SODs. Proteins Fe atoms per monomer Mn atoms per monomer Activity b (U/mg) a Native SOD NG ± ± ± 10.9 Apo- SOD NG Fe-reconstituted SOD NG ± ± 17.2 Mn-reconstituted SOD NG ± ± 29.3 a Native SODA NG ± ± ± 13.5 Apo- SODA NG Fe-reconstituted SODA NG ± ± 19.2 Mn-reconstituted SODA NG ± ± 25.5 a The purified protein expressed in the normal E. coli system without metal enrichment and metal reconstitution process, was used as a control. b SOD activity was measured at 25 C by using the standard assay described in the Methods section. The values are given as means (n = 3) ± standard deviation. 8
9 68 69 Table S3. Thermodynamic parameters of purified SOD NG2215, SODA NG2215, SOD Bsn5, SODA Bsn5 and SOD r at different temperatures. Enzymes T ( ) a k d 10-3 (min -1 ) b D (min) c t 1/2 (min) d E d (kjmol -1 ) SOD NG SODA NG SOD BSn SODA BSn SOD r a k d is the deactivation rate constant (1/min) 2. b Decimal reduction time (D) is defined by Belitz and Gosch 3, as determination of the holding time required to reduce the enzyme activity by one power of ten. c t 1/2 is the half-life time. d Ed is the deactivation energy required to inactive the enzyme during thermal inactivation process 4. 9
10 76 Table S4. Effects of inhibitors, detergents and denaturants on SOD activity. Inhibitors, detergents, and Relative activity (%) concentration denaturants SOD NG2215 SODA NG2215 SOD Bsn5 SODA Bsn5 SOD r control ± ± ± ± ± 7.3 EDTA 1mM 58.7 ± ± ± ± ± mM 53.7 ± ± ± ± ± 2.8 β-me 1mM 80.0 ± ± ± ± ± mM 69.3 ± ± ± ± ± 6.0 SDS 0.1% 63.2 ± ± ± ± ± 8.9 1% 45.8 ± 0.8 NA a NA NA 50.8 ± 6.2 Urea 2.5M 93.3 ± ± ± ± ± 6.6 Guanidine hydrochloride 2.5M 86.5 ± ± ± ± ± a NA stands for no activity. 78 The enzyme was incubated with each inhibitor, detergent and denaturant with different final 79 concentrations in 50mM sodium phosphate buffer (ph 7.8) at 25 C for 30 min, individually. 80 Reaction mixture without inhibitor, detergent, and denaturant was used as a control. The 81 values are given as means (n = 3) ± standard deviation
11 83 84 Table S5. The Equilibrium Model parameters 5 SODA BSn5 and SOD r for SOD NG2215, SODA NG2215, SOD BSn5, a G cat b G inact c H eq d T eq Enzyme (KJ mol -1 ) (KJ mol -1 ) (KJ mol -1 ) ( ) SOD NG SODA NG SOD BSn SODA BSn SOD r a Gibbs free energy of activation for an enzyme-catalysed reaction. b Gibbs free energy of activation for the irreversible thermal inactivation of an enzyme. c Change in enthalpy for the E act to E inact transition. d The temperature at which the E act -E inact equilibrium is at its mid-point
12 Supplementary References 1. Daniel, R. M., Danson, M. J., Eisenthal, R., Lee, C. K. & Peterson, M. E. New parameters controlling the effect of temperature on enzyme activity. Biochemical Society transactions 35, (2007). 2. Whitaker, J.R. Principles of Enzymology for the Food Sciences. Marcel Dekker (1994). 3. Belitz, H.D & Gosch, W. Enzymes In Food Chemistry (2nd edn), Springer-Verlag (1999). 4. James P. Henley et al. Categorization of enzyme deactivations using a series-type mechanism. Enzyme and Microbial Technology. 7, (1985). 5. Daniel, R. M. & Danson, M. J. A new understanding of how temperature affects the catalytic activity of enzymes. Trends in biochemical sciences 35, (2010). 12
Pathway of FeEDTA transformation and its impact on performance of NO x removal in a chemical absorption-biological reduction integrated process
Appendix A. Supplementary Information: Pathway of FeEDTA transformation and its impact on performance of NO x removal in a chemical absorption-biological reduction integrated process Wei Li 1,2, Jingkai
More informationCHAPTER 6 ENZYME KINETICS AND THERMAL INACTIVATION OF POLYPHENOL OXIDASE
CHAPTER 6 ENZYME KINETICS AND THERMAL INACTIVATION OF POLYPHENOL OXIDASE OVERVIEW OF CHAPTER Here we report the substrate specificity and enzyme kinetics of Polyphenol oxidase enzyme of A. paeoniifolius.
More informationEXTREMOPHILES Vol. I - Thermostability and Thermoactivity of Extremozymes - Michael J. Danson and David W. Hough
THERMOSTABILITY AND THERMOACTIVITY OF EXTREMOZYMES Michael J. Danson and David W. Hough University of Bath, UK Keywords: archaea, catalysis, citrate synthase, compatible solutes, conformational flexibility
More informationFull-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
More informationGenomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography,
1 2 3 Genomic insights into the taxonomic status of the Bacillus cereus group Yang Liu 1, Qiliang Lai 1, Markus Göker 2, Jan P. Meier-Kolthoff 2, Meng Wang 3, Yamin Sun 3, Lei Wang 3 and Zongze Shao 1*
More informationChapter 1. Topic: Overview of basic principles
Chapter 1 Topic: Overview of basic principles Four major themes of biochemistry I. What are living organism made from? II. How do organism acquire and use energy? III. How does an organism maintain its
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes
More informationNew sesquiterpenoids from the rhizomes of Acorus tatarinowii
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 214 New sesquiterpenoids from the rhizomes of Acorus tatarinowii Xiao-Lin Feng, a Yang Yu, *a Hao
More informationGeNei TM Enzyme Kinetics Teaching Kit Manual
Teaching Kit Manual Cat No. New Cat No. KT89 106209 Revision No.: 00140806 CONTENTS Page No. Objective 3 Principle 3 Kit Description 4 Materials Provided 5 Procedure 6 Result 12 Interpretation 17 ORDERING
More informationSupporting Information. Time-Resolved Botulinum Neurotoxin A Activity Monitored using. Peptide-Functionalized Au Nanoparticle Energy Transfer Sensors
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2014 Supporting Information Time-Resolved Botulinum Neurotoxin A Activity Monitored using Peptide-Functionalized
More informationFree Energy. because H is negative doesn't mean that G will be negative and just because S is positive doesn't mean that G will be negative.
Biochemistry 462a Bioenergetics Reading - Lehninger Principles, Chapter 14, pp. 485-512 Practice problems - Chapter 14: 2-8, 10, 12, 13; Physical Chemistry extra problems, free energy problems Free Energy
More informationChapter 6- An Introduction to Metabolism*
Chapter 6- An Introduction to Metabolism* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. The Energy of Life
More informationRate Law Summary. Rate Laws vary as a function of time
Rate Law Summary Measure the instantaneous rate of a reaction: this is a number with units of M/s! Measure the rate of loss of a reactant r... the rate of appearance of a product Repeat the experiment
More informationAwanish Kumar, Anjeeta Rani and Pannuru Venkatesu* Department of Chemistry, University of Delhi, Delhi
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2014 Supplimentary Informations
More informationA Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and. Disfavors Mn Binding.
Supporting information for A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and Disfavors Mn Binding. Anne-Frances Miller* and Ting Wang Department of Chemistry, University
More informationEnzymes. Dr.Anupam Porwal Assistant Professor Dept. Of Biotechnology
1 Enzymes Dr.Anupam Porwal Assistant Professor Dept. Of Biotechnology 2 What Are Enzymes? Most enzymes are Proteins (tertiary and quaternary structures) except for a class of RNA modifying catalysts known
More informationA catalase-peroxidase from a newly isolated thermoalkaliphilic Bacillus sp. with potential for the treatment of textile bleaching effluents
A catalase-peroxidase from a newly isolated thermoalkaliphilic Bacillus sp. with potential for the treatment of textile bleaching effluents Marinka Gudelj, Gilbert Otto Fruhwirth, Andreas Paar, Fritz Lottspeich,
More informationA novel laminin β gene BmLanB1-w regulates wing-specific cell adhesion in silkworm, Bombyx mori
Supplementary information A novel laminin β gene BmLanB1-w regulates wing-specific cell adhesion in silkworm, Bombyx mori Xiaoling Tong*, Songzhen He *, Jun Chen, Hai Hu, Zhonghuai Xiang, Cheng Lu and
More informationEfficient removal of heavy metal ions with EDTA. functionalized chitosan/polyacrylamide double network
Supporting Information Efficient removal of heavy metal ions with EDTA functionalized chitosan/polyacrylamide double network hydrogel Jianhong Ma a,b, Guiyin Zhou c, Lin Chu c, Yutang Liu a,b, *, Chengbin
More informationBIOLOGY 12: CHAPTER 6 - REVIEW WORKSHEET ENZYMES. 4. Define the First Law of Thermodynamics. Can energy be converted from one form to another form?
BIOLOGY 12: CHAPTER 6 - REVIEW WORKSHEET ENZYMES PART A: CHAPTER REVIEW 1. List the 2 cellular organelles that transform one form of energy into another form. 2. Name the 2 processes that permit a flow
More informationProtocol for 2D-E. Protein Extraction
Protocol for 2D-E Protein Extraction Reagent 1 inside the ReadyPrep TM Sequential Extraction kit (in powder form) 50ml of deionized water is used to dissolve all the Reagent 1. The solution is known as
More informationSupplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Directed self-assembly of genomic sequences into monomeric and polymeric branched DNA structures
More informationSupplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor
Supplementary information A proposal for a novel impact factor as an alternative to the JCR impact factor Zu-Guo Yang a and Chun-Ting Zhang b, * a Library, Tianjin University, Tianjin 300072, China b Department
More informationBiotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015
Biotechnology of Proteins The Source of Stability in Proteins (III) Fall 2015 Conformational Entropy of Unfolding It is The factor that makes the greatest contribution to stabilization of the unfolded
More informationSigma Xi Undergraduate Research Grant Proposal Analysis of the Oligomerization of Ɣ-Glutamylcysteine Ligase
Project Summary Sigma Xi Undergraduate Research Grant Proposal Analysis of the Oligomerization of Ɣ-Glutamylcysteine Ligase Gamma-glutamylcysteine ligase (Ɣ-GCL) catalyzes the rate limiting step in the
More informationThree Dimensional Nano-assemblies of Noble Metal. Nanoparticles-Infinite Coordination Polymers as a Specific
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Three Dimensional Nano-assemblies of Noble Metal Nanoparticles-Infinite
More informationChapter 2 - Water 9/8/2014. Water exists as a H-bonded network with an average of 4 H-bonds per molecule in ice and 3.4 in liquid. 104.
Chapter 2 - Water Water exists as a -bonded network with an average of 4 -bonds per molecule in ice and 3.4 in liquid. 104.5 o -bond: An electrostatic attraction between polarized molecules containing
More informationSupporting Information
Supporting Information Das et al. 10.1073/pnas.1302500110 < SP >< LRRNT > < LRR1 > < LRRV1 > < LRRV2 Pm-VLRC M G F V V A L L V L G A W C G S C S A Q - R Q R A C V E A G K S D V C I C S S A T D S S P E
More informationSupramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei
Supporting Information Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei Said Jebors a, Yannick Tauran a, Nushin Aghajari b, Samira Boudebbouze
More informationAnalysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase
SUPPLEMENTARY INFORMATION Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase Louise C Briggs, Geoff S Baldwin, Non Miyata, Hisao Kondo, Xiaodong Zhang, Paul S
More informationBSc and MSc Degree Examinations
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking
More informationPhylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes
www.bioinformation.net Hypothesis Volume 10(7) Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes Tayyaba Huma 1 *, Arooma Maryam
More information1 st European Union Science Olympiad in Dublin, Ireland. task B
1 st European Union Science Olympiad in Dublin, Ireland task B Task B The Properties of Proteins Introduction In this task you will investigate some of the properties of proteins. Proteins consist of a
More informationState Key Laboratory of Coordination Chemistry, School of Chemistry and Chemical
Electronic Supplementary Information Evidence for inhibition of HIF-1α Prolyl hydroxylase 3 activity by four biological active tetraazamacrocycles Jing Cao, Zhirong Geng, Xiaoyan Ma, Jinghan Wen, Yuxin
More informationFlow of Energy. Flow of Energy. Energy and Metabolism. Chapter 6
Energy and Metabolism Chapter 6 Flow of Energy Energy: the capacity to do work -kinetic energy: the energy of motion -potential energy: stored energy Energy can take many forms: mechanical electric current
More informationChemistry 1506: Allied Health Chemistry 2. Section 10: Enzymes. Biochemical Catalysts. Outline
Chemistry 1506 Dr. Hunter s Class Section 10 Notes - Page 1/14 Chemistry 1506: Allied Health Chemistry 2 Section 10: Enzymes Biochemical Catalysts. Outline SECTION 10.1 INTRODUCTION...2 SECTION SECTION
More informationWhy is there so much microbial diversity in NJ and Beyond? Rutgers University, Lee Kerkhof
Institute of Marine and Coastal Sciences Why is there so much microbial diversity in NJ and Beyond? Rutgers University, Lee Kerkhof Overview of the seminar Background on how we do oceanography and a small
More informationHighly Specific near-infrared Fluorescent probe for the Real-Time Detection of β-glucuronidase in Various Living Cells and Animals
Supplementary information Highly Specific near-infrared Fluorescent probe for the Real-Time Detection of β-glucuronidase in Various Living Cells and Animals Yinzhu Jin,, Xiangge Tian,, Lingling Jin, Yonglei
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationData Sheet. Azide Cy5 RNA T7 Transcription Kit
Cat. No. Size 1. Description PP-501-Cy5 10 reactions à 40 µl For in vitro use only Quality guaranteed for 12 months Store all components at -20 C. Avoid freeze and thaw cycles. DBCO-Sulfo-Cy5 must be stored
More informationDetermination of the protein-ligand binding volume by high-pressure spectrofluorimetry
Determination of the protein-ligand binding volume by high-pressure spectrofluorimetry Vytautas Petrauskas Department of Biothermodynamics and Drug Design Institute of Biotechnology, Vilnius University
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationit is assumed that only EH and ESH are catalytically active Michaelis-Menten equation for this model is:
initial rates for many enzymatic reactions exhibit bell-shaped curves as a function of ph curves reflect the ionizations of certain amino acid residues that must be in a specific ionization state for enzyme
More informationChemical Kinetics. Topic 7
Chemical Kinetics Topic 7 Corrosion of Titanic wrec Casón shipwrec 2Fe(s) + 3/2O 2 (g) + H 2 O --> Fe 2 O 3.H 2 O(s) 2Na(s) + 2H 2 O --> 2NaOH(aq) + H 2 (g) Two examples of the time needed for a chemical
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More informationBioreactor Engineering Laboratory
Bioreactor Engineering Laboratory Determination of kinetics parameters of enzymatic hydrolysis of lactose catalyzed by β-galactosidase. Supervisor: Karolina Labus, PhD 1. THEROETICAL PART Enzymes are macromolecular,
More information*The entropy of a system may decrease, but the entropy of the system plus its surroundings must always increase
AP biology Notes: Metabolism Metabolism = totality of an organism's chemical process concerned with managing cellular resources. Metabolic reactions are organized into pathways that are orderly series
More informationChapter 6: Energy and Metabolism
Chapter 6: Energy and Metabolism Student: 1. Oxidation and reduction reactions are chemical processes that result in a gain or loss in A) atoms. B) neutrons. C) electrons. D) molecules. E) protons. 2.
More informationEnzymes: Basic Principles
Enzymes: Basic Principles BIO161 Basic Biochemistry Dr John Puddefoot J.R.Puddefoot@qmul.ac.uk Objectives: To introduce the basic concepts and definitions of enzymology You should be able to able to define
More informationOxidase-like Mimic of 3 PO 4 Microcubes as A Smart Probe for Ultrasensitive and Selective Hg 2+ Detection
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2016 Supporting Information Oxidase-like Mimic of Ag@Ag 3 PO 4 Microcubes as A Smart Probe
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10244 a O07391_MYCAV/127-243 NLPC_HAEIN/80-181 SPR_SHIFL/79-183 P74160_SYNY3/112-245 O24914_HELPY/301-437 Q51835_PORGI/68-178 DPP6_BACSH/163-263 YKFC_BACSU/185-292 YDHO_ECOLI/153-263
More informationNon-Interfering Protein Assay Kit Cat. No
Visit our interactive pathways at /pathways User Protocol 488250 Rev. 5 January 2006 RFH Page 1 of 1 Non-Interfering Protein Assay Kit Cat. No. 488250 Note that this user protocol is not lot-specific and
More informationElectronic Supplementary Information for. A Redox-Nucleophilic Dual-Reactable Probe for Highly Selective
Electronic Supplementary Information for A Redox-Nucleophilic Dual-Reactable Probe for Highly Selective and Sensitive Detection of H 2 S: Synthesis, Spectra and Bioimaging Changyu Zhang, 1 Runyu Wang,
More informationSupporting Information. for
Supporting Information for Near-Infrared Fluorescent Turn-On Probe with a Remarkable Large Stokes Shift for Imaging Selenocysteine in Living Cells and Animals Weiyong Feng, Meixing Li, Yao Sun, and Guoqiang
More informationSupplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
More informationUnit 1: Chemistry of Life Guided Reading Questions (80 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 1 Exploring Life Unit 1: Chemistry of Life Guided Reading Questions
More informationLONG-TERM BIOCATALYST PERFORMANCE VIA HEURISTIC AND RIGOROUS MODELING APPROACHES
LONG-TERM BIOCATALYST PERFORMANCE VIA HEURISTIC AND RIGOROUS MODELING APPROACHES A Dissertation Presented to The Academic Faculty by Thomas A. Rogers In Partial Fulfillment of the Requirements for the
More informationOptimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli
Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4
More informationBasic Principles of Kinetics and Thermodynamics Arthur L. Haas, Ph.D. Department of Biochemistry and Molecular Biology
Basic Principles of Kinetics and Thermodynamics Arthur L. Haas, Ph.D. Department of Biochemistry and Molecular Biology Review: Garrett and Grisham, Enzyme Kinetics (Chapt. 13), in Biochemistry, Third Edition,
More informationATPase/GTPase ELIPA BIOCHEM KIT
ATPase/GTPase ELIPA BIOCHEM KIT Cat # BK051/BK052 ORDERING INFORMATION To order by phone: (303) - 322-2254 To order by Fax: (303) - 322-2257 Customer Service cserve@cytoskeleton.com Technical assistance:
More information5.111 Lecture Summary #17 Friday, October 17, 2014
5.111 Lecture Summary #17 Friday, ctober 17, 2014 Reading for today: Sections 8.8, 8.12, 8.13, 8.15, and 8.16 (same sections but in hapter 7 in 4 th ed): Entropy and Gibbs Free Energy, and Free-Energy
More informationChapter 8: An Introduction to Metabolism. 1. Energy & Chemical Reactions 2. ATP 3. Enzymes & Metabolic Pathways
Chapter 8: An Introduction to Metabolism 1. Energy & Chemical Reactions 2. ATP 3. Enzymes & Metabolic Pathways 1. Energy & Chemical Reactions 2 Basic Forms of Energy Kinetic Energy (KE) energy in motion
More informationChapter 6 # METABOLISM PowerPoint Image Slideshow
COLLEGE BIOLOGY PHYSICS Chapter 6 # METABOLISM Chapter Title PowerPoint Image Slideshow Figure 8.1 Metabolism Figure 6.2 Energy from the sun. Plants photosynthesis Herbivores eat those plants Carnivores
More informationA) at equilibrium B) endergonic C) endothermic D) exergonic E) exothermic.
CHEM 2770: Elements of Biochemistry Mid Term EXAMINATION VERSION A Date: October 29, 2014 Instructor: H. Perreault Location: 172 Schultz Time: 4 or 6 pm. Duration: 1 hour Instructions Please mark the Answer
More informationfor Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet
SUPPLEMENTARY INFORMATION TO Structural basis for enzymatic excision of N -methyladenine and N 3 -methylcytosine from DNA Ingar Leiros,5, Marivi P. Nabong 2,3,5, Kristin Grøsvik 3, Jeanette Ringvoll 2,
More information-log [H+][OH-] = - log [1 x ] Left hand side ( log H + ) + ( log OH - ) = ph + poh Right hand side = ( log 1) + ( log ) = 14 ph + poh = 14
Autoionization of Water H 2 O H + + OH - K = [H + ][OH - ]/[H 2 O] = 1.802 x 10-16 Concentration of [H 2 O] is so HIGH autoionization is just a drop in the bucket, so [H 2 O] stays constant at 55.5 M,
More informationBIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL. Qing-Xi Chen ~, and Hai-Meng Zhou*
Vol. 46, No. 2, October 1998 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL Pages 225-231 An Essential Lysine Residue of Green Crab (Scylla Serrata) Alkaline Phosphatase Qing-Xi Chen ~, and Hai-Meng Zhou*
More informationObjectives. Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain 1,2 Mentor Dr.
Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae Emily Germain 1,2 Mentor Dr. Hugh Nicholas 3 1 Bioengineering & Bioinformatics Summer Institute, Department of Computational
More informationChem 212. Unit 2 Jeopardy
Chem 212 Unit 2 Jeopardy Activity 200 400 600 800 1000 Activity - 200 Write the solubility product for La(IO3)3 activity coefficients. K=[La3+]γLa+[IO3-]^3γIO3- Activity - 400 What is the equation to solve
More informationSupporting Information. Chemo-enzymatic Synthesis of Isotopically Labeled Nicotinamide Ribose
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Chemo-enzymatic Synthesis of Isotopically Labeled
More informationMicrocalorimetric techniques
Microcalorimetric techniques Isothermal titration calorimetry (ITC) Differential scanning calorimetry (DSC) Filip Šupljika Filip.Supljika@irb.hr Laboratory for the study of interactions of biomacromolecules
More informationSupplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
More informationQubit RNA IQ Assay Kits
USER GUIDE Qubit RNA IQ s Catalog No. Q33221, Q33222 Pub. No. MAN0017405 Rev. B.0 Product information The Qubit RNA IQ provides a fast, simple method to check whether an RNA sample has degraded using the
More informationCharacterization of Reversible Kinase Inhibitors using Microfluidic Mobility-Shift Assays
Application Note 211 Characterization of Reversible Kinase Inhibitors using Microfluidic Mobility-Shift Assays Introduction Current drug discovery efforts typically focus on developing small molecule inhibitors
More informationPhenol-Chloroform reagents. Selection guide. OH ; MW : High quality reagents for use in nucleic acid purification.
Phenol-Chloroform reagents Extraction with phenol and phenol/chloroform mixtures is a universal method for purification of DNA and RNA. Proteins and restriction enzymes are removed by phenol and chloroform
More informationSupporting Information
Supporting Information Self-Assembly of Glutathione S-transferases into Nanowires Wei Zhang, a Quan Luo,* a Lu Miao, a Yushi Bai, a Zeyuan Dong, a Jiayun Xu, a and Junqiu Liu* a a State Key Laboratory
More informationLecture 26: More on Gel Filtration Chromatography and the Trypsin Resurrection Experiment
Biological Chemistry Laboratory Biology 3515/Chemistry 3515 Spring 2018 Lecture 26: More on Gel Filtration Chromatography and the Trypsin Resurrection Experiment 12 April 2018 c David P. Goldenberg University
More informationSerine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
More informationLecture # 3, 4 Selecting a Catalyst (Non-Kinetic Parameters), Review of Enzyme Kinetics, Selectivity, ph and Temperature Effects
1.492 - Integrated Chemical Engineering (ICE Topics: Biocatalysis MIT Chemical Engineering Department Instructor: Professor Kristala Prather Fall 24 Lecture # 3, 4 Selecting a Catalyst (Non-Kinetic Parameters,
More informationDisinfection. Disinfection is used to treat both domestic water and wastewater.
Disinfection Disinfection is the selective destruction of disease causing organisms (viruses, bacteria, protozoans). It destroys most recognized pathogenic microorganisms, but not necessarily all microbial
More informationAdjustment and Matching of Energy band of TiO 2 -based Photocatalysts by Metal Ions (Pd, Cu, Mn) for Photoreduction of CO 2 into CH 4.
Supplementary Information Adjustment and Matching of Energy band of -based Photocatalysts by Metal Ions (Pd, Cu, Mn) for Photoreduction of CO 2 into CH 4. Yabin Yan a, Yanlong Yu c, Shaolong Huang d, Yajun
More information11. What are the four most abundant elements in a human body? A) C, N, O, H, P B) C, N, O, P C) C, S, O, H D) C, Na, O, H E) C, H, O, Fe
48017 omework#1 on VVP Chapter 1: and in the provided answer template on Monday 4/10/17 @ 1:00pm; Answers on this document will not be graded! Matching A) Phylogenetic B) negative C) 2 D) Δ E) TS F) halobacteria
More informationMethods for the study of the conformation of folding intermediates
7.88 Lecture Notes - 9 7.24/7.88J/5.48J The Protein Folding and Human Disease Fluorescence spectroscopy Denaturation and Denaturing agents Denatured State as a random coil (First Approx.) Renaturation/Refolding
More informationEST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
More informationSupplementary Information. Characteristics of Long Non-coding RNAs in the Brown Norway Rat and. Alterations in the Dahl Salt-Sensitive Rat
Supplementary Information Characteristics of Long Non-coding RNAs in the Brown Norway Rat and Alterations in the Dahl Salt-Sensitive Rat Feng Wang 1,2,3,*, Liping Li 5,*, Haiming Xu 5, Yong Liu 2,3, Chun
More informationNOVABEADS FOOD 1 DNA KIT
NOVABEADS FOOD 1 DNA KIT NOVABEADS FOOD DNA KIT is the new generation tool in molecular biology techniques and allows DNA isolations from highly processed food products. The method is based on the use
More informationStability Study of an Exothermic Biocatalytic Reaction and its Application in Bioprocess Systems
Pertanika J. Sci. & Technol. 17 (1): 95 115 (2009) ISSN: 0128-7680 Universiti Putra Malaysia Press Stability Study of an Exothermic Biocatalytic Reaction and its Application in Bioprocess Systems M.R.
More informationEnergy, Enzymes, and Metabolism. Energy, Enzymes, and Metabolism. A. Energy and Energy Conversions. A. Energy and Energy Conversions
Energy, Enzymes, and Metabolism Lecture Series 6 Energy, Enzymes, and Metabolism B. ATP: Transferring Energy in Cells D. Molecular Structure Determines Enzyme Fxn Energy is the capacity to do work (cause
More informationF. 2.6 mm a-ketoglutaric Acid Solution (KG) (Prepare 1 ml in Reagent A using a-ketoglutaric Acid, Disodium Salt.)
Enzymatic Assay of L-GLUTAMATE OXIDASE PRINCIPLE: L-Glutamate + O 2 + H 2 O L-Glutamate Oxidase > a-ketoglutaric Acid + NH 3 + H 2 O 2 2 H 2 O 2 + H 2 O Catalase > 2 H 2 O + O 2 CONDITIONS: T = 30 C, ph
More informationa) s -1 b) 0.10 s -1 c) s -1 d) 0.50 s -1 e) 0.50 M -1 s -1 ** Google Sheets Used to plot and calculate
1. The reactant concentration in a first-order reaction was 1.70 M after 35.0 sec and 0.01 M after 85.0 sec. What is the rate constant for this reaction? a) -0.10 s -1 b) 0.10 s -1 c) -0.50 s -1 d) 0.50
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure
More informationSupplementary Information for
Supplementary Information for Structural basis for the inhibition of Mycobacterium tuberculosis L,D-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains Hyoun Sook Kim
More informationBIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total)
BIMS 503 Exam I September 24, 2007 _ /email: Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) Questions 1-6 refer to this situation: You are able to partially purify an enzyme activity
More informationAn Introduction to Metabolism
An Introduction to Metabolism Chapter 8 Objectives Distinguish between the following pairs of terms: catabolic and anabolic pathways; kinetic and potential energy; open and closed systems; exergonic and
More informationMBLG lecture 5. The EGG! Visualising Molecules. Dr. Dale Hancock Lab 715
MBLG lecture 5 Dr. Dale Hancock D.Hancock@mmb.usyd.edu.au Lab 715 The EGG! Visualising Molecules In molecular biology and biochemistry it is better to view molecules as killer pythons rather than smarties.
More informationSynthesis of Multi-responsive and Dynamic Chitosanbased. Molecules
This information is available free of charge via the internet at http://pubs.acs.org/. Supporting Information Synthesis of Multi-responsive and Dynamic Chitosanbased Hydrogels for Controlled Release of
More informationSupplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1
S1 of S8 Supplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1 Katsiaryna Tarasava, Jens Loebus and Eva Freisinger Figure S1. Deconvoluted
More informationComparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain, Rensselaer Polytechnic Institute
Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae Emily Germain, Rensselaer Polytechnic Institute Mentor: Dr. Hugh Nicholas, Biomedical Initiative, Pittsburgh Supercomputing
More informationSDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis):
SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis): Aim: SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis) is one of the common methods used in the molecular biology
More information1 Electronic Supporting Information. 2 The transformation and fate of silver nanoparticles in a paddy soil:
Electronic Supplementary Material (ESI) for Environmental Science: Nano. This journal is The Royal Society of Chemistry 2017 1 Electronic Supporting Information 2 The transformation and fate of silver
More information