Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers

Size: px
Start display at page:

Download "Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers"

Transcription

1 1 2 Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers heat resistance to Fe/Mn-SODs 3 4 Running Title: Thermostability-improving peptide for SODs Authors Wei Wang a,c,1,#, Ting Ma a,d,1, Baoliang Zhang a, Nana Yao a, Mingchang Li a, Lianlei Cui a, Guoqiang Li a,d, Zhenping Ma b, Jiansong Cheng b,# Affiliations a Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, TEDA Institute of Biological Sciences and Biotechnology, Nankai University, 23 Hongda Street, TEDA, Tianjin , PR China b State Key Laboratory of Medicinal Chemical Biology and College of Pharmacy, Nankai University, Tianjin , PR China c Tianjin Key Laboratory of Microbial Functional Genomics, TEDA, Tianjin , PR China d College of Life Sciences, Nankai University, Tianjin , PR China # Correspondence and requests for materials should be addressed to W.W. (nkweiwang@nankai.edu.cn), or J.C. (jiansongcheng@nankai.edu.cn) 1 W.W. and T.M. contributed equally to this work. 1

2 23 Supplementary Figures and Tables Figure S1. Alignment of N-terminal fragments of SOD NG2215 -like proteins from 13 Geobacillus strains. 2

3 Figure S2. Phylogenetic neighbor-joining tree of identified thermophilic Mn-, Fe- or Mn/Fe- SODs derived from various microorganisms. Three putative SODs from G. thermodenitrificans NG80-2 were included in the dataset, among which the distantly related Cu/Zn-SOD from NG80-2 was used as an outgroup. Sequences are labeled with species, ion preference and the protein size. Accession numbers for SODs used in this analysis are: WP_ , AAD , ADM , AAP , P , YP_ , NP_ , NP_ , ABB , Q , NP_ , ABO , NP_ , AGI , AAS , CAJ , YP_ , YP_ , YP_

4 Figure S3. Thermostability of metal-reconstituted SOD NG2215 (a) and SODA NG2215 (b). The enzymes of Mn 2+ or Fe 2+ reconstituted SOD NG2215 and SODA NG2215 were respectively pre-incubated at 70 C, and aliquots were withdrawn every 10 minutes to test the residual activities at optimum temperature and ph by using the standard assay described in the Methods section. The activity of non-heated SOD was defined as 100%. Each point represents the mean (n = 3) ± standard deviation. 48 4

5 Figure S4. Temperature dependant CD spectra of SOD NG2215 (a) and SOD r (b). 5

6 Figure S5. The 3D plots of SOD NG2215 (a), SODA NG2215 (b), SOD BSn5 (c), SODA BSn5 (d) and SOD r (e). These plots were derived from the Equilibrium Model and generated by using A Matlab version of Equation

7 58 Table S1. Primers used for construction of five recombinant clones in this study. 59 Gene Forward primer/reverse primer (5'-3') Length of PCR fragment (bp) sod NG2215 GGAATTCCATATGGACGACCAAACGTTGTTTGC 1350 CCCAAGCTTTTAAAATGGTTGCCAACGCA soda NG2215 GGAATTCCATATG CCTGGCAAGCATGTGCTGCC 618 CCCAAGCTT TTAAAATGGTTGCCAACGCA sod BSn5 GGAATTCATGAAACGTGAATCTTATCAAACG 846 CCGCTCGAGTTAATAGAGCTTCCAAACGACTTC soda BSn5 GGAATTCCATATG AAACACGTGCTGCCAAAGCT 612 CGCGGATCCTTAATAGAGCTTCCAAACGACTTC sod_n-gtng_2215 GGAATTCCATATGGACGACCAAACGTTGTTTGC 732 GCACATGTTTCGAAACCGCC sod_c-bsn5 GGCGGTTTCGAAACATGTGC 612 CGCGGATCCTTAATAGAGTTTCCAAACGACTTC sod r GGAATTCCATATG GACGACCAAACGTTGTTTGC 1344 CGCGGATCCTTAATAGAGcTTCCAAACGACTTC 60 7

8 Table S2. Metal contents and activities of native, apo, and metal-reconstituted SODs. Proteins Fe atoms per monomer Mn atoms per monomer Activity b (U/mg) a Native SOD NG ± ± ± 10.9 Apo- SOD NG Fe-reconstituted SOD NG ± ± 17.2 Mn-reconstituted SOD NG ± ± 29.3 a Native SODA NG ± ± ± 13.5 Apo- SODA NG Fe-reconstituted SODA NG ± ± 19.2 Mn-reconstituted SODA NG ± ± 25.5 a The purified protein expressed in the normal E. coli system without metal enrichment and metal reconstitution process, was used as a control. b SOD activity was measured at 25 C by using the standard assay described in the Methods section. The values are given as means (n = 3) ± standard deviation. 8

9 68 69 Table S3. Thermodynamic parameters of purified SOD NG2215, SODA NG2215, SOD Bsn5, SODA Bsn5 and SOD r at different temperatures. Enzymes T ( ) a k d 10-3 (min -1 ) b D (min) c t 1/2 (min) d E d (kjmol -1 ) SOD NG SODA NG SOD BSn SODA BSn SOD r a k d is the deactivation rate constant (1/min) 2. b Decimal reduction time (D) is defined by Belitz and Gosch 3, as determination of the holding time required to reduce the enzyme activity by one power of ten. c t 1/2 is the half-life time. d Ed is the deactivation energy required to inactive the enzyme during thermal inactivation process 4. 9

10 76 Table S4. Effects of inhibitors, detergents and denaturants on SOD activity. Inhibitors, detergents, and Relative activity (%) concentration denaturants SOD NG2215 SODA NG2215 SOD Bsn5 SODA Bsn5 SOD r control ± ± ± ± ± 7.3 EDTA 1mM 58.7 ± ± ± ± ± mM 53.7 ± ± ± ± ± 2.8 β-me 1mM 80.0 ± ± ± ± ± mM 69.3 ± ± ± ± ± 6.0 SDS 0.1% 63.2 ± ± ± ± ± 8.9 1% 45.8 ± 0.8 NA a NA NA 50.8 ± 6.2 Urea 2.5M 93.3 ± ± ± ± ± 6.6 Guanidine hydrochloride 2.5M 86.5 ± ± ± ± ± a NA stands for no activity. 78 The enzyme was incubated with each inhibitor, detergent and denaturant with different final 79 concentrations in 50mM sodium phosphate buffer (ph 7.8) at 25 C for 30 min, individually. 80 Reaction mixture without inhibitor, detergent, and denaturant was used as a control. The 81 values are given as means (n = 3) ± standard deviation

11 83 84 Table S5. The Equilibrium Model parameters 5 SODA BSn5 and SOD r for SOD NG2215, SODA NG2215, SOD BSn5, a G cat b G inact c H eq d T eq Enzyme (KJ mol -1 ) (KJ mol -1 ) (KJ mol -1 ) ( ) SOD NG SODA NG SOD BSn SODA BSn SOD r a Gibbs free energy of activation for an enzyme-catalysed reaction. b Gibbs free energy of activation for the irreversible thermal inactivation of an enzyme. c Change in enthalpy for the E act to E inact transition. d The temperature at which the E act -E inact equilibrium is at its mid-point

12 Supplementary References 1. Daniel, R. M., Danson, M. J., Eisenthal, R., Lee, C. K. & Peterson, M. E. New parameters controlling the effect of temperature on enzyme activity. Biochemical Society transactions 35, (2007). 2. Whitaker, J.R. Principles of Enzymology for the Food Sciences. Marcel Dekker (1994). 3. Belitz, H.D & Gosch, W. Enzymes In Food Chemistry (2nd edn), Springer-Verlag (1999). 4. James P. Henley et al. Categorization of enzyme deactivations using a series-type mechanism. Enzyme and Microbial Technology. 7, (1985). 5. Daniel, R. M. & Danson, M. J. A new understanding of how temperature affects the catalytic activity of enzymes. Trends in biochemical sciences 35, (2010). 12

Pathway of FeEDTA transformation and its impact on performance of NO x removal in a chemical absorption-biological reduction integrated process

Pathway of FeEDTA transformation and its impact on performance of NO x removal in a chemical absorption-biological reduction integrated process Appendix A. Supplementary Information: Pathway of FeEDTA transformation and its impact on performance of NO x removal in a chemical absorption-biological reduction integrated process Wei Li 1,2, Jingkai

More information

CHAPTER 6 ENZYME KINETICS AND THERMAL INACTIVATION OF POLYPHENOL OXIDASE

CHAPTER 6 ENZYME KINETICS AND THERMAL INACTIVATION OF POLYPHENOL OXIDASE CHAPTER 6 ENZYME KINETICS AND THERMAL INACTIVATION OF POLYPHENOL OXIDASE OVERVIEW OF CHAPTER Here we report the substrate specificity and enzyme kinetics of Polyphenol oxidase enzyme of A. paeoniifolius.

More information

EXTREMOPHILES Vol. I - Thermostability and Thermoactivity of Extremozymes - Michael J. Danson and David W. Hough

EXTREMOPHILES Vol. I - Thermostability and Thermoactivity of Extremozymes - Michael J. Danson and David W. Hough THERMOSTABILITY AND THERMOACTIVITY OF EXTREMOZYMES Michael J. Danson and David W. Hough University of Bath, UK Keywords: archaea, catalysis, citrate synthase, compatible solutes, conformational flexibility

More information

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166), Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

More information

Genomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography,

Genomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography, 1 2 3 Genomic insights into the taxonomic status of the Bacillus cereus group Yang Liu 1, Qiliang Lai 1, Markus Göker 2, Jan P. Meier-Kolthoff 2, Meng Wang 3, Yamin Sun 3, Lei Wang 3 and Zongze Shao 1*

More information

Chapter 1. Topic: Overview of basic principles

Chapter 1. Topic: Overview of basic principles Chapter 1 Topic: Overview of basic principles Four major themes of biochemistry I. What are living organism made from? II. How do organism acquire and use energy? III. How does an organism maintain its

More information

BA, BSc, and MSc Degree Examinations

BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes

More information

New sesquiterpenoids from the rhizomes of Acorus tatarinowii

New sesquiterpenoids from the rhizomes of Acorus tatarinowii Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 214 New sesquiterpenoids from the rhizomes of Acorus tatarinowii Xiao-Lin Feng, a Yang Yu, *a Hao

More information

GeNei TM Enzyme Kinetics Teaching Kit Manual

GeNei TM Enzyme Kinetics Teaching Kit Manual Teaching Kit Manual Cat No. New Cat No. KT89 106209 Revision No.: 00140806 CONTENTS Page No. Objective 3 Principle 3 Kit Description 4 Materials Provided 5 Procedure 6 Result 12 Interpretation 17 ORDERING

More information

Supporting Information. Time-Resolved Botulinum Neurotoxin A Activity Monitored using. Peptide-Functionalized Au Nanoparticle Energy Transfer Sensors

Supporting Information. Time-Resolved Botulinum Neurotoxin A Activity Monitored using. Peptide-Functionalized Au Nanoparticle Energy Transfer Sensors Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2014 Supporting Information Time-Resolved Botulinum Neurotoxin A Activity Monitored using Peptide-Functionalized

More information

Free Energy. because H is negative doesn't mean that G will be negative and just because S is positive doesn't mean that G will be negative.

Free Energy. because H is negative doesn't mean that G will be negative and just because S is positive doesn't mean that G will be negative. Biochemistry 462a Bioenergetics Reading - Lehninger Principles, Chapter 14, pp. 485-512 Practice problems - Chapter 14: 2-8, 10, 12, 13; Physical Chemistry extra problems, free energy problems Free Energy

More information

Chapter 6- An Introduction to Metabolism*

Chapter 6- An Introduction to Metabolism* Chapter 6- An Introduction to Metabolism* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. The Energy of Life

More information

Rate Law Summary. Rate Laws vary as a function of time

Rate Law Summary. Rate Laws vary as a function of time Rate Law Summary Measure the instantaneous rate of a reaction: this is a number with units of M/s! Measure the rate of loss of a reactant r... the rate of appearance of a product Repeat the experiment

More information

Awanish Kumar, Anjeeta Rani and Pannuru Venkatesu* Department of Chemistry, University of Delhi, Delhi

Awanish Kumar, Anjeeta Rani and Pannuru Venkatesu* Department of Chemistry, University of Delhi, Delhi Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2014 Supplimentary Informations

More information

A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and. Disfavors Mn Binding.

A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and. Disfavors Mn Binding. Supporting information for A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and Disfavors Mn Binding. Anne-Frances Miller* and Ting Wang Department of Chemistry, University

More information

Enzymes. Dr.Anupam Porwal Assistant Professor Dept. Of Biotechnology

Enzymes. Dr.Anupam Porwal Assistant Professor Dept. Of Biotechnology 1 Enzymes Dr.Anupam Porwal Assistant Professor Dept. Of Biotechnology 2 What Are Enzymes? Most enzymes are Proteins (tertiary and quaternary structures) except for a class of RNA modifying catalysts known

More information

A catalase-peroxidase from a newly isolated thermoalkaliphilic Bacillus sp. with potential for the treatment of textile bleaching effluents

A catalase-peroxidase from a newly isolated thermoalkaliphilic Bacillus sp. with potential for the treatment of textile bleaching effluents A catalase-peroxidase from a newly isolated thermoalkaliphilic Bacillus sp. with potential for the treatment of textile bleaching effluents Marinka Gudelj, Gilbert Otto Fruhwirth, Andreas Paar, Fritz Lottspeich,

More information

A novel laminin β gene BmLanB1-w regulates wing-specific cell adhesion in silkworm, Bombyx mori

A novel laminin β gene BmLanB1-w regulates wing-specific cell adhesion in silkworm, Bombyx mori Supplementary information A novel laminin β gene BmLanB1-w regulates wing-specific cell adhesion in silkworm, Bombyx mori Xiaoling Tong*, Songzhen He *, Jun Chen, Hai Hu, Zhonghuai Xiang, Cheng Lu and

More information

Efficient removal of heavy metal ions with EDTA. functionalized chitosan/polyacrylamide double network

Efficient removal of heavy metal ions with EDTA. functionalized chitosan/polyacrylamide double network Supporting Information Efficient removal of heavy metal ions with EDTA functionalized chitosan/polyacrylamide double network hydrogel Jianhong Ma a,b, Guiyin Zhou c, Lin Chu c, Yutang Liu a,b, *, Chengbin

More information

BIOLOGY 12: CHAPTER 6 - REVIEW WORKSHEET ENZYMES. 4. Define the First Law of Thermodynamics. Can energy be converted from one form to another form?

BIOLOGY 12: CHAPTER 6 - REVIEW WORKSHEET ENZYMES. 4. Define the First Law of Thermodynamics. Can energy be converted from one form to another form? BIOLOGY 12: CHAPTER 6 - REVIEW WORKSHEET ENZYMES PART A: CHAPTER REVIEW 1. List the 2 cellular organelles that transform one form of energy into another form. 2. Name the 2 processes that permit a flow

More information

Protocol for 2D-E. Protein Extraction

Protocol for 2D-E. Protein Extraction Protocol for 2D-E Protein Extraction Reagent 1 inside the ReadyPrep TM Sequential Extraction kit (in powder form) 50ml of deionized water is used to dissolve all the Reagent 1. The solution is known as

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Directed self-assembly of genomic sequences into monomeric and polymeric branched DNA structures

More information

Supplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor

Supplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor Supplementary information A proposal for a novel impact factor as an alternative to the JCR impact factor Zu-Guo Yang a and Chun-Ting Zhang b, * a Library, Tianjin University, Tianjin 300072, China b Department

More information

Biotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015

Biotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015 Biotechnology of Proteins The Source of Stability in Proteins (III) Fall 2015 Conformational Entropy of Unfolding It is The factor that makes the greatest contribution to stabilization of the unfolded

More information

Sigma Xi Undergraduate Research Grant Proposal Analysis of the Oligomerization of Ɣ-Glutamylcysteine Ligase

Sigma Xi Undergraduate Research Grant Proposal Analysis of the Oligomerization of Ɣ-Glutamylcysteine Ligase Project Summary Sigma Xi Undergraduate Research Grant Proposal Analysis of the Oligomerization of Ɣ-Glutamylcysteine Ligase Gamma-glutamylcysteine ligase (Ɣ-GCL) catalyzes the rate limiting step in the

More information

Three Dimensional Nano-assemblies of Noble Metal. Nanoparticles-Infinite Coordination Polymers as a Specific

Three Dimensional Nano-assemblies of Noble Metal. Nanoparticles-Infinite Coordination Polymers as a Specific Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Three Dimensional Nano-assemblies of Noble Metal Nanoparticles-Infinite

More information

Chapter 2 - Water 9/8/2014. Water exists as a H-bonded network with an average of 4 H-bonds per molecule in ice and 3.4 in liquid. 104.

Chapter 2 - Water 9/8/2014. Water exists as a H-bonded network with an average of 4 H-bonds per molecule in ice and 3.4 in liquid. 104. Chapter 2 - Water Water exists as a -bonded network with an average of 4 -bonds per molecule in ice and 3.4 in liquid. 104.5 o -bond: An electrostatic attraction between polarized molecules containing

More information

Supporting Information

Supporting Information Supporting Information Das et al. 10.1073/pnas.1302500110 < SP >< LRRNT > < LRR1 > < LRRV1 > < LRRV2 Pm-VLRC M G F V V A L L V L G A W C G S C S A Q - R Q R A C V E A G K S D V C I C S S A T D S S P E

More information

Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei

Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei Supporting Information Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei Said Jebors a, Yannick Tauran a, Nushin Aghajari b, Samira Boudebbouze

More information

Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase

Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase SUPPLEMENTARY INFORMATION Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase Louise C Briggs, Geoff S Baldwin, Non Miyata, Hisao Kondo, Xiaodong Zhang, Paul S

More information

BSc and MSc Degree Examinations

BSc and MSc Degree Examinations Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking

More information

Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes

Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes www.bioinformation.net Hypothesis Volume 10(7) Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes Tayyaba Huma 1 *, Arooma Maryam

More information

1 st European Union Science Olympiad in Dublin, Ireland. task B

1 st European Union Science Olympiad in Dublin, Ireland. task B 1 st European Union Science Olympiad in Dublin, Ireland task B Task B The Properties of Proteins Introduction In this task you will investigate some of the properties of proteins. Proteins consist of a

More information

State Key Laboratory of Coordination Chemistry, School of Chemistry and Chemical

State Key Laboratory of Coordination Chemistry, School of Chemistry and Chemical Electronic Supplementary Information Evidence for inhibition of HIF-1α Prolyl hydroxylase 3 activity by four biological active tetraazamacrocycles Jing Cao, Zhirong Geng, Xiaoyan Ma, Jinghan Wen, Yuxin

More information

Flow of Energy. Flow of Energy. Energy and Metabolism. Chapter 6

Flow of Energy. Flow of Energy. Energy and Metabolism. Chapter 6 Energy and Metabolism Chapter 6 Flow of Energy Energy: the capacity to do work -kinetic energy: the energy of motion -potential energy: stored energy Energy can take many forms: mechanical electric current

More information

Chemistry 1506: Allied Health Chemistry 2. Section 10: Enzymes. Biochemical Catalysts. Outline

Chemistry 1506: Allied Health Chemistry 2. Section 10: Enzymes. Biochemical Catalysts. Outline Chemistry 1506 Dr. Hunter s Class Section 10 Notes - Page 1/14 Chemistry 1506: Allied Health Chemistry 2 Section 10: Enzymes Biochemical Catalysts. Outline SECTION 10.1 INTRODUCTION...2 SECTION SECTION

More information

Why is there so much microbial diversity in NJ and Beyond? Rutgers University, Lee Kerkhof

Why is there so much microbial diversity in NJ and Beyond? Rutgers University, Lee Kerkhof Institute of Marine and Coastal Sciences Why is there so much microbial diversity in NJ and Beyond? Rutgers University, Lee Kerkhof Overview of the seminar Background on how we do oceanography and a small

More information

Highly Specific near-infrared Fluorescent probe for the Real-Time Detection of β-glucuronidase in Various Living Cells and Animals

Highly Specific near-infrared Fluorescent probe for the Real-Time Detection of β-glucuronidase in Various Living Cells and Animals Supplementary information Highly Specific near-infrared Fluorescent probe for the Real-Time Detection of β-glucuronidase in Various Living Cells and Animals Yinzhu Jin,, Xiangge Tian,, Lingling Jin, Yonglei

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

More information

Data Sheet. Azide Cy5 RNA T7 Transcription Kit

Data Sheet. Azide Cy5 RNA T7 Transcription Kit Cat. No. Size 1. Description PP-501-Cy5 10 reactions à 40 µl For in vitro use only Quality guaranteed for 12 months Store all components at -20 C. Avoid freeze and thaw cycles. DBCO-Sulfo-Cy5 must be stored

More information

Determination of the protein-ligand binding volume by high-pressure spectrofluorimetry

Determination of the protein-ligand binding volume by high-pressure spectrofluorimetry Determination of the protein-ligand binding volume by high-pressure spectrofluorimetry Vytautas Petrauskas Department of Biothermodynamics and Drug Design Institute of Biotechnology, Vilnius University

More information

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain

More information

it is assumed that only EH and ESH are catalytically active Michaelis-Menten equation for this model is:

it is assumed that only EH and ESH are catalytically active Michaelis-Menten equation for this model is: initial rates for many enzymatic reactions exhibit bell-shaped curves as a function of ph curves reflect the ionizations of certain amino acid residues that must be in a specific ionization state for enzyme

More information

Chemical Kinetics. Topic 7

Chemical Kinetics. Topic 7 Chemical Kinetics Topic 7 Corrosion of Titanic wrec Casón shipwrec 2Fe(s) + 3/2O 2 (g) + H 2 O --> Fe 2 O 3.H 2 O(s) 2Na(s) + 2H 2 O --> 2NaOH(aq) + H 2 (g) Two examples of the time needed for a chemical

More information

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking

More information

Bioreactor Engineering Laboratory

Bioreactor Engineering Laboratory Bioreactor Engineering Laboratory Determination of kinetics parameters of enzymatic hydrolysis of lactose catalyzed by β-galactosidase. Supervisor: Karolina Labus, PhD 1. THEROETICAL PART Enzymes are macromolecular,

More information

*The entropy of a system may decrease, but the entropy of the system plus its surroundings must always increase

*The entropy of a system may decrease, but the entropy of the system plus its surroundings must always increase AP biology Notes: Metabolism Metabolism = totality of an organism's chemical process concerned with managing cellular resources. Metabolic reactions are organized into pathways that are orderly series

More information

Chapter 6: Energy and Metabolism

Chapter 6: Energy and Metabolism Chapter 6: Energy and Metabolism Student: 1. Oxidation and reduction reactions are chemical processes that result in a gain or loss in A) atoms. B) neutrons. C) electrons. D) molecules. E) protons. 2.

More information

Enzymes: Basic Principles

Enzymes: Basic Principles Enzymes: Basic Principles BIO161 Basic Biochemistry Dr John Puddefoot J.R.Puddefoot@qmul.ac.uk Objectives: To introduce the basic concepts and definitions of enzymology You should be able to able to define

More information

Oxidase-like Mimic of 3 PO 4 Microcubes as A Smart Probe for Ultrasensitive and Selective Hg 2+ Detection

Oxidase-like Mimic of 3 PO 4 Microcubes as A Smart Probe for Ultrasensitive and Selective Hg 2+ Detection Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2016 Supporting Information Oxidase-like Mimic of Ag@Ag 3 PO 4 Microcubes as A Smart Probe

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10244 a O07391_MYCAV/127-243 NLPC_HAEIN/80-181 SPR_SHIFL/79-183 P74160_SYNY3/112-245 O24914_HELPY/301-437 Q51835_PORGI/68-178 DPP6_BACSH/163-263 YKFC_BACSU/185-292 YDHO_ECOLI/153-263

More information

Non-Interfering Protein Assay Kit Cat. No

Non-Interfering Protein Assay Kit Cat. No Visit our interactive pathways at /pathways User Protocol 488250 Rev. 5 January 2006 RFH Page 1 of 1 Non-Interfering Protein Assay Kit Cat. No. 488250 Note that this user protocol is not lot-specific and

More information

Electronic Supplementary Information for. A Redox-Nucleophilic Dual-Reactable Probe for Highly Selective

Electronic Supplementary Information for. A Redox-Nucleophilic Dual-Reactable Probe for Highly Selective Electronic Supplementary Information for A Redox-Nucleophilic Dual-Reactable Probe for Highly Selective and Sensitive Detection of H 2 S: Synthesis, Spectra and Bioimaging Changyu Zhang, 1 Runyu Wang,

More information

Supporting Information. for

Supporting Information. for Supporting Information for Near-Infrared Fluorescent Turn-On Probe with a Remarkable Large Stokes Shift for Imaging Selenocysteine in Living Cells and Animals Weiyong Feng, Meixing Li, Yao Sun, and Guoqiang

More information

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*

More information

Unit 1: Chemistry of Life Guided Reading Questions (80 pts total)

Unit 1: Chemistry of Life Guided Reading Questions (80 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 1 Exploring Life Unit 1: Chemistry of Life Guided Reading Questions

More information

LONG-TERM BIOCATALYST PERFORMANCE VIA HEURISTIC AND RIGOROUS MODELING APPROACHES

LONG-TERM BIOCATALYST PERFORMANCE VIA HEURISTIC AND RIGOROUS MODELING APPROACHES LONG-TERM BIOCATALYST PERFORMANCE VIA HEURISTIC AND RIGOROUS MODELING APPROACHES A Dissertation Presented to The Academic Faculty by Thomas A. Rogers In Partial Fulfillment of the Requirements for the

More information

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4

More information

Basic Principles of Kinetics and Thermodynamics Arthur L. Haas, Ph.D. Department of Biochemistry and Molecular Biology

Basic Principles of Kinetics and Thermodynamics Arthur L. Haas, Ph.D. Department of Biochemistry and Molecular Biology Basic Principles of Kinetics and Thermodynamics Arthur L. Haas, Ph.D. Department of Biochemistry and Molecular Biology Review: Garrett and Grisham, Enzyme Kinetics (Chapt. 13), in Biochemistry, Third Edition,

More information

ATPase/GTPase ELIPA BIOCHEM KIT

ATPase/GTPase ELIPA BIOCHEM KIT ATPase/GTPase ELIPA BIOCHEM KIT Cat # BK051/BK052 ORDERING INFORMATION To order by phone: (303) - 322-2254 To order by Fax: (303) - 322-2257 Customer Service cserve@cytoskeleton.com Technical assistance:

More information

5.111 Lecture Summary #17 Friday, October 17, 2014

5.111 Lecture Summary #17 Friday, October 17, 2014 5.111 Lecture Summary #17 Friday, ctober 17, 2014 Reading for today: Sections 8.8, 8.12, 8.13, 8.15, and 8.16 (same sections but in hapter 7 in 4 th ed): Entropy and Gibbs Free Energy, and Free-Energy

More information

Chapter 8: An Introduction to Metabolism. 1. Energy & Chemical Reactions 2. ATP 3. Enzymes & Metabolic Pathways

Chapter 8: An Introduction to Metabolism. 1. Energy & Chemical Reactions 2. ATP 3. Enzymes & Metabolic Pathways Chapter 8: An Introduction to Metabolism 1. Energy & Chemical Reactions 2. ATP 3. Enzymes & Metabolic Pathways 1. Energy & Chemical Reactions 2 Basic Forms of Energy Kinetic Energy (KE) energy in motion

More information

Chapter 6 # METABOLISM PowerPoint Image Slideshow

Chapter 6 # METABOLISM PowerPoint Image Slideshow COLLEGE BIOLOGY PHYSICS Chapter 6 # METABOLISM Chapter Title PowerPoint Image Slideshow Figure 8.1 Metabolism Figure 6.2 Energy from the sun. Plants photosynthesis Herbivores eat those plants Carnivores

More information

A) at equilibrium B) endergonic C) endothermic D) exergonic E) exothermic.

A) at equilibrium B) endergonic C) endothermic D) exergonic E) exothermic. CHEM 2770: Elements of Biochemistry Mid Term EXAMINATION VERSION A Date: October 29, 2014 Instructor: H. Perreault Location: 172 Schultz Time: 4 or 6 pm. Duration: 1 hour Instructions Please mark the Answer

More information

for Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet

for Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet SUPPLEMENTARY INFORMATION TO Structural basis for enzymatic excision of N -methyladenine and N 3 -methylcytosine from DNA Ingar Leiros,5, Marivi P. Nabong 2,3,5, Kristin Grøsvik 3, Jeanette Ringvoll 2,

More information

-log [H+][OH-] = - log [1 x ] Left hand side ( log H + ) + ( log OH - ) = ph + poh Right hand side = ( log 1) + ( log ) = 14 ph + poh = 14

-log [H+][OH-] = - log [1 x ] Left hand side ( log H + ) + ( log OH - ) = ph + poh Right hand side = ( log 1) + ( log ) = 14 ph + poh = 14 Autoionization of Water H 2 O H + + OH - K = [H + ][OH - ]/[H 2 O] = 1.802 x 10-16 Concentration of [H 2 O] is so HIGH autoionization is just a drop in the bucket, so [H 2 O] stays constant at 55.5 M,

More information

BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL. Qing-Xi Chen ~, and Hai-Meng Zhou*

BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL. Qing-Xi Chen ~, and Hai-Meng Zhou* Vol. 46, No. 2, October 1998 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL Pages 225-231 An Essential Lysine Residue of Green Crab (Scylla Serrata) Alkaline Phosphatase Qing-Xi Chen ~, and Hai-Meng Zhou*

More information

Objectives. Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain 1,2 Mentor Dr.

Objectives. Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain 1,2 Mentor Dr. Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae Emily Germain 1,2 Mentor Dr. Hugh Nicholas 3 1 Bioengineering & Bioinformatics Summer Institute, Department of Computational

More information

Chem 212. Unit 2 Jeopardy

Chem 212. Unit 2 Jeopardy Chem 212 Unit 2 Jeopardy Activity 200 400 600 800 1000 Activity - 200 Write the solubility product for La(IO3)3 activity coefficients. K=[La3+]γLa+[IO3-]^3γIO3- Activity - 400 What is the equation to solve

More information

Supporting Information. Chemo-enzymatic Synthesis of Isotopically Labeled Nicotinamide Ribose

Supporting Information. Chemo-enzymatic Synthesis of Isotopically Labeled Nicotinamide Ribose Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Chemo-enzymatic Synthesis of Isotopically Labeled

More information

Microcalorimetric techniques

Microcalorimetric techniques Microcalorimetric techniques Isothermal titration calorimetry (ITC) Differential scanning calorimetry (DSC) Filip Šupljika Filip.Supljika@irb.hr Laboratory for the study of interactions of biomacromolecules

More information

Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences

Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia

More information

Qubit RNA IQ Assay Kits

Qubit RNA IQ Assay Kits USER GUIDE Qubit RNA IQ s Catalog No. Q33221, Q33222 Pub. No. MAN0017405 Rev. B.0 Product information The Qubit RNA IQ provides a fast, simple method to check whether an RNA sample has degraded using the

More information

Characterization of Reversible Kinase Inhibitors using Microfluidic Mobility-Shift Assays

Characterization of Reversible Kinase Inhibitors using Microfluidic Mobility-Shift Assays Application Note 211 Characterization of Reversible Kinase Inhibitors using Microfluidic Mobility-Shift Assays Introduction Current drug discovery efforts typically focus on developing small molecule inhibitors

More information

Phenol-Chloroform reagents. Selection guide. OH ; MW : High quality reagents for use in nucleic acid purification.

Phenol-Chloroform reagents. Selection guide. OH ; MW : High quality reagents for use in nucleic acid purification. Phenol-Chloroform reagents Extraction with phenol and phenol/chloroform mixtures is a universal method for purification of DNA and RNA. Proteins and restriction enzymes are removed by phenol and chloroform

More information

Supporting Information

Supporting Information Supporting Information Self-Assembly of Glutathione S-transferases into Nanowires Wei Zhang, a Quan Luo,* a Lu Miao, a Yushi Bai, a Zeyuan Dong, a Jiayun Xu, a and Junqiu Liu* a a State Key Laboratory

More information

Lecture 26: More on Gel Filtration Chromatography and the Trypsin Resurrection Experiment

Lecture 26: More on Gel Filtration Chromatography and the Trypsin Resurrection Experiment Biological Chemistry Laboratory Biology 3515/Chemistry 3515 Spring 2018 Lecture 26: More on Gel Filtration Chromatography and the Trypsin Resurrection Experiment 12 April 2018 c David P. Goldenberg University

More information

Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition

Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut

More information

Lecture # 3, 4 Selecting a Catalyst (Non-Kinetic Parameters), Review of Enzyme Kinetics, Selectivity, ph and Temperature Effects

Lecture # 3, 4 Selecting a Catalyst (Non-Kinetic Parameters), Review of Enzyme Kinetics, Selectivity, ph and Temperature Effects 1.492 - Integrated Chemical Engineering (ICE Topics: Biocatalysis MIT Chemical Engineering Department Instructor: Professor Kristala Prather Fall 24 Lecture # 3, 4 Selecting a Catalyst (Non-Kinetic Parameters,

More information

Disinfection. Disinfection is used to treat both domestic water and wastewater.

Disinfection. Disinfection is used to treat both domestic water and wastewater. Disinfection Disinfection is the selective destruction of disease causing organisms (viruses, bacteria, protozoans). It destroys most recognized pathogenic microorganisms, but not necessarily all microbial

More information

Adjustment and Matching of Energy band of TiO 2 -based Photocatalysts by Metal Ions (Pd, Cu, Mn) for Photoreduction of CO 2 into CH 4.

Adjustment and Matching of Energy band of TiO 2 -based Photocatalysts by Metal Ions (Pd, Cu, Mn) for Photoreduction of CO 2 into CH 4. Supplementary Information Adjustment and Matching of Energy band of -based Photocatalysts by Metal Ions (Pd, Cu, Mn) for Photoreduction of CO 2 into CH 4. Yabin Yan a, Yanlong Yu c, Shaolong Huang d, Yajun

More information

11. What are the four most abundant elements in a human body? A) C, N, O, H, P B) C, N, O, P C) C, S, O, H D) C, Na, O, H E) C, H, O, Fe

11. What are the four most abundant elements in a human body? A) C, N, O, H, P B) C, N, O, P C) C, S, O, H D) C, Na, O, H E) C, H, O, Fe 48017 omework#1 on VVP Chapter 1: and in the provided answer template on Monday 4/10/17 @ 1:00pm; Answers on this document will not be graded! Matching A) Phylogenetic B) negative C) 2 D) Δ E) TS F) halobacteria

More information

Methods for the study of the conformation of folding intermediates

Methods for the study of the conformation of folding intermediates 7.88 Lecture Notes - 9 7.24/7.88J/5.48J The Protein Folding and Human Disease Fluorescence spectroscopy Denaturation and Denaturing agents Denatured State as a random coil (First Approx.) Renaturation/Refolding

More information

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7. hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:

More information

Supplementary Information. Characteristics of Long Non-coding RNAs in the Brown Norway Rat and. Alterations in the Dahl Salt-Sensitive Rat

Supplementary Information. Characteristics of Long Non-coding RNAs in the Brown Norway Rat and. Alterations in the Dahl Salt-Sensitive Rat Supplementary Information Characteristics of Long Non-coding RNAs in the Brown Norway Rat and Alterations in the Dahl Salt-Sensitive Rat Feng Wang 1,2,3,*, Liping Li 5,*, Haiming Xu 5, Yong Liu 2,3, Chun

More information

NOVABEADS FOOD 1 DNA KIT

NOVABEADS FOOD 1 DNA KIT NOVABEADS FOOD 1 DNA KIT NOVABEADS FOOD DNA KIT is the new generation tool in molecular biology techniques and allows DNA isolations from highly processed food products. The method is based on the use

More information

Stability Study of an Exothermic Biocatalytic Reaction and its Application in Bioprocess Systems

Stability Study of an Exothermic Biocatalytic Reaction and its Application in Bioprocess Systems Pertanika J. Sci. & Technol. 17 (1): 95 115 (2009) ISSN: 0128-7680 Universiti Putra Malaysia Press Stability Study of an Exothermic Biocatalytic Reaction and its Application in Bioprocess Systems M.R.

More information

Energy, Enzymes, and Metabolism. Energy, Enzymes, and Metabolism. A. Energy and Energy Conversions. A. Energy and Energy Conversions

Energy, Enzymes, and Metabolism. Energy, Enzymes, and Metabolism. A. Energy and Energy Conversions. A. Energy and Energy Conversions Energy, Enzymes, and Metabolism Lecture Series 6 Energy, Enzymes, and Metabolism B. ATP: Transferring Energy in Cells D. Molecular Structure Determines Enzyme Fxn Energy is the capacity to do work (cause

More information

F. 2.6 mm a-ketoglutaric Acid Solution (KG) (Prepare 1 ml in Reagent A using a-ketoglutaric Acid, Disodium Salt.)

F. 2.6 mm a-ketoglutaric Acid Solution (KG) (Prepare 1 ml in Reagent A using a-ketoglutaric Acid, Disodium Salt.) Enzymatic Assay of L-GLUTAMATE OXIDASE PRINCIPLE: L-Glutamate + O 2 + H 2 O L-Glutamate Oxidase > a-ketoglutaric Acid + NH 3 + H 2 O 2 2 H 2 O 2 + H 2 O Catalase > 2 H 2 O + O 2 CONDITIONS: T = 30 C, ph

More information

a) s -1 b) 0.10 s -1 c) s -1 d) 0.50 s -1 e) 0.50 M -1 s -1 ** Google Sheets Used to plot and calculate

a) s -1 b) 0.10 s -1 c) s -1 d) 0.50 s -1 e) 0.50 M -1 s -1 ** Google Sheets Used to plot and calculate 1. The reactant concentration in a first-order reaction was 1.70 M after 35.0 sec and 0.01 M after 85.0 sec. What is the rate constant for this reaction? a) -0.10 s -1 b) 0.10 s -1 c) -0.50 s -1 d) 0.50

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Structural basis for the inhibition of Mycobacterium tuberculosis L,D-transpeptidase by meropenem, a drug effective against extensively drug-resistant strains Hyoun Sook Kim

More information

BIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total)

BIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) BIMS 503 Exam I September 24, 2007 _ /email: Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) Questions 1-6 refer to this situation: You are able to partially purify an enzyme activity

More information

An Introduction to Metabolism

An Introduction to Metabolism An Introduction to Metabolism Chapter 8 Objectives Distinguish between the following pairs of terms: catabolic and anabolic pathways; kinetic and potential energy; open and closed systems; exergonic and

More information

MBLG lecture 5. The EGG! Visualising Molecules. Dr. Dale Hancock Lab 715

MBLG lecture 5. The EGG! Visualising Molecules. Dr. Dale Hancock Lab 715 MBLG lecture 5 Dr. Dale Hancock D.Hancock@mmb.usyd.edu.au Lab 715 The EGG! Visualising Molecules In molecular biology and biochemistry it is better to view molecules as killer pythons rather than smarties.

More information

Synthesis of Multi-responsive and Dynamic Chitosanbased. Molecules

Synthesis of Multi-responsive and Dynamic Chitosanbased. Molecules This information is available free of charge via the internet at http://pubs.acs.org/. Supporting Information Synthesis of Multi-responsive and Dynamic Chitosanbased Hydrogels for Controlled Release of

More information

Supplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1

Supplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1 S1 of S8 Supplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1 Katsiaryna Tarasava, Jens Loebus and Eva Freisinger Figure S1. Deconvoluted

More information

Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain, Rensselaer Polytechnic Institute

Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae. Emily Germain, Rensselaer Polytechnic Institute Comparison and Analysis of Heat Shock Proteins in Organisms of the Kingdom Viridiplantae Emily Germain, Rensselaer Polytechnic Institute Mentor: Dr. Hugh Nicholas, Biomedical Initiative, Pittsburgh Supercomputing

More information

SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis):

SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis): SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis): Aim: SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis) is one of the common methods used in the molecular biology

More information

1 Electronic Supporting Information. 2 The transformation and fate of silver nanoparticles in a paddy soil:

1 Electronic Supporting Information. 2 The transformation and fate of silver nanoparticles in a paddy soil: Electronic Supplementary Material (ESI) for Environmental Science: Nano. This journal is The Royal Society of Chemistry 2017 1 Electronic Supporting Information 2 The transformation and fate of silver

More information