Genomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography,
|
|
|
- Nathaniel Lynch
- 5 years ago
- Views:
Transcription
1 1 2 3 Genomic insights into the taxonomic status of the Bacillus cereus group Yang Liu 1, Qiliang Lai 1, Markus Göker 2, Jan P. Meier-Kolthoff 2, Meng Wang 3, Yamin Sun 3, Lei Wang 3 and Zongze Shao 1* State Key Laboratory Breeding Base of Marine Genetic Resources; Key Laboratory of Marine Genetic Resources, Third Institute of Oceanography, SOA; South China Sea Bio-Resource Exploitation and Utilization Collaborative Innovation Centre; Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources; Key Laboratory of Marine Genetic Resources of Fujian Province, Xiamen 365, China Leibniz Institute DSMZ German Collection of Microorganisms and Cell Cultures GmbH, Inhoffenstraße 7B, 38124, Braunschweig, Germany TEDA School of Biological Sciences and Biotechnology Nankai University, Tianjin, China *Corresponding author: Zongze Shao. Tel: Fax: shaozz@163.com co-first author 1
2 Contents Supplementary Figures... 3 Figure S1 Whole-genome phylogeny of 224 bacteria of the B. cereus group inferred using the latest GBDP version and rooted with Bacillus subtilis ATCC 6051 T... 4 Figure S2 Phylogenetic tree inferred from 7 copies of the 16S rrna gene of 202 bacteria of the B. cereus group Figure S3 nmlsa-based phylogenetic tree of 224 bacteria of the B. cereus group using 20 housekeeping genes Figure S4 Phylogenetic tree inferred from the ccpa gene of 224 bacteria of the B. cereus group Supplementary Data Data S1 Complete list of the 225 strains used in this study with detailed annotations Data S2 Pairwise dddh values between the 224 strains of the B. cereus group Data S3 Distribution of 224 strains into 30 clusters (putative species) Data S4 The 20 housekeeping genes used for the nmlsa analysis Data S5 List of characteristic genes used as reference sequences for the local Blastn 2
3 Supplementary Figures Clusters (see color of leaves; colors in clockwise order; numbers are cluster IDs): single strain in cluster BCG09 BCG13 BCG15 BCG19 BCG14 BCG05 BCG17 BCG10 BCG11 BCG04 BCG12 BCG16 BCG03 BCG01 BCG02 BCG18
4 Figure S1 Whole-genome phylogeny of 224 bacteria of the B. cereus group inferred using the latest GBDP version and rooted with Bacillus subtilis ATCC 6051 T. Numbers above branches are greedy-with-trimming pseudo-bootstrap support values from replicates if larger than 50%. Leaves are colored according to their affiliation to clusters. The three outer circles show whether or not the (i) cry locus, (ii) pxo1(-like) plasmid and/or the (iii) pxo2(-like) plasmid is found. Type strains are printed with T. The strains with a complete genome sequence are marked by an asterisk (*). The tree was inferred using FastME and visualized using itol. The leaf labels are strain names according to the NCBI database. Please note that the species names B. gaemokensis, B. manliponensis and B. bingmayongensis are effectively but not yet validly published. 4
5 Clusters (see color of leaves; numbers are cluster IDs): single strain in cluster BCG15 BCG05 BCG11 BCG16 BCG02 BCG09 BCG19 BCG17 BCG04 BCG03 BCG18 BCG13 BCG14 BCG10 BCG12 BCG01
6
7
8
9
10
11
12
13
14 Figure S2 Phylogenetic tree inferred from 7 copies of the 16S rrna gene of 202 bacteria of the B. cereus group. A total of 7 copies of the 16S rrna gene were complete from site 352 to site 1051 in the complete 16S rrna gene, and used to construct the tree. B. subtilis ATCC 6051 T (BSU6051_ ) was used as the outgroup. The 16S rrna genes extracted from type strains are marked by the asterisk symbol (*) and printed in bold font. See the main text for more descriptions. 14
15 BCG09 BCG13 BCG15 BCG19 BCG14 BCG05 BCG17 BCG10 BCG11 BCG04 BCG12 BCG16 BCG03 BCG01 BCG02 BCG18
16 Figure S3 nmlsa-based phylogenetic tree of 224 bacteria of the B. cereus group using 20 housekeeping genes. Numbers on branches are bootstrap support values from 1,000 replicates given in percent. Branches are scaled in terms of the expected number of substitutions per site. Leaves are colored according to their affiliation to clusters (compare Figure 1). The three outer circles show whether or not the (i) cry locus, (ii) pxo1(-like) plasmid and/or the (iii) pxo2(-like) plasmid are found. Type strains are printed in bold font and marked by an asterisk (*). Bacillus subtilis ATCC 6051 T (CP003329) was used as the outgroup. 16
17 0.01 B. subtilis BCG01-11 BCG01-29 BCG01-09* BCG01-07 BCG01-05 BCG01-03 BCG01-01 BCG01-02 BCG01-04 BCG01-06 BCG01-08 BCG01-10 BCG01-12 BCG01-13 BCG01-14 BCG01-15 BCG01-16 BCG01-17 BCG01-18 BCG01-19 BCG01-20 BCG01-21 BCG01-22 BCG01-23 BCG01-24 BCG01-25 BCG01-26 BCG01-27 BCG01-28 BCG01-40 BCG01-30 BCG01-37 BCG10-03 BCG01-43 BCG01-48 BCG01-47 BCG01-42 BCG01-46 BC -3 BCG01-45 BCG01-32 BCG01-33 BCG01-44 BCG01-36 BCG01-41 BCG01-34 BCG01-31 BCG01-49 BCG01-39 BCG01-38 BCG14-01 BCG14-03 BCG14-02 BCG10-01 BCG10-02 BCG20-01 BCG12-10 BCG12-15 BCG12-09 BCG12-08 BCG12-11 BCG12-13 BCG12-16 BCG12-01 BCG12-02 BCG12-03 BCG12-04 BCG12-05 BCG12-06 BCG12-07 BCG12-12 BCG12-14 BCG18-01 BCG18-02 BCG18-03 BCG30-01 BCG28-01 BCG22-01 BCG13-01 BCG13-02 BCG04-14 BCG04-15 BCG04-13 BCG04-12 BCG04-11* BCG04-10 BCG04-09 BCG04-01 BCG04-03 BCG04-08 BCG04-02 BCG04-04 BCG04-05 BCG04-06 BCG04-07 BCG17-11 BCG17-12 BCG17-13 BCG17-10 BCG17-05 BCG17-03 BCG17-01 BCG17-02 BCG17-04 BCG17-06 BCG17-07 BCG17-08 BCG17-09 BCG17-14 BCG03-07 BCG03-09 BCG03-30 BCG03-34 BCG03-19 BCG03-06 BCG03-29 BCG03-31 BCG03-20 BCG03-35 BCG03-36 BCG03-26 BCG03-43 BCG03-37 BCG03-32 BCG03-28 BCG03-23 BCG03-13 BCG03-12 BCG03-05* BCG03-03 BCG03-27 BCG03-40 BCG03-22 BCG03-01 BCG03-02 BCG03-21 BCG03-15 BCG03-04 BCG03-25 BCG03-10 BCG03-11 BCG03-33 BCG03-08 BCG03-14 BCG03-16 BCG03-17 BCG03-18 BCG03-24 BCG03-38 BCG03-39 BCG03-41 BCG03-42 BCG19-01 BCG19-02 BCG26-01 BCG09-15 BCG09-12 BCG09-04 BCG09-05 BCG09-06 BCG09-07 BCG09-08 BCG09-09 BCG09-10 BCG09-14 BCG09-18 BCG09-13 BCG09-19 BCG09-02 BCG09-03 BCG09-11 BCG09-16 BCG09-17 BCG09-01* BCG11-05 BCG11-01 BCG11-02 BCG11-03 BCG11-04 BCG11-06 BCG21-01 BCG16-01 BCG16-02 BCG29-01 BCG16-03 BCG16-04 BCG16-05 BCG24-01 BCG02-10 BCG02-09 BCG02-21* BCG02-04 BCG02-02 BCG02-01 BCG02-03 BCG02-05 BCG02-06 BCG02-07 BCG02-08 BCG02-12 BCG02-13 BCG02-15 BCG02-16 BCG02-20* BCG02-11 BCG02-22 BCG02-17 BCG02-14 BCG02-18 BCG02-19 BCG06-01* BCG27-01 BCG23-01* BCG15-02 BCG15-03 BCG15-01 BCG05-03* BCG05-05 BCG05-04 BCG05-01 BCG05-02 BCG08-01* BCG25-01 BCG07-01* Clusters (see color of leaves; colors in single strain BCG15 BCG05 BCG16 BCG02 BCG11 BCG09 BCG19 BCG14 BCG12 BCG10 BCG01 BCG18 BCG13 BCG03 BCG17 BCG04 in cluster clockwise order; numbers are cluster IDs): Legend of three outer circles: Cry protein (inner circle) missing endotoxin pxo1 plasmid (middle circle) pxo1-like (rep-x) missing pxo1 pxo2 plasmid (outer circle) pxo2-like (rep-r) missing pxo2
18 Figure S4 Phylogenetic trees inferred from the ccpa gene of 224 bacteria of the B. cereus group. Numbers on branches are bootstrap support values from 1,000 replicates given in percent. Branches are scaled in terms of the expected number of substitutions per site. Leaves are colored according to their affiliation to clusters (compare Figure 1). The three outer circles show whether or not the (i) cry locus, (ii) pxo1(-like) plasmid and/or the (iii) pxo2(-like) plasmid are found. Type strains are printed in bold font and marked by an asterisk (*). Bacillus subtilis ATCC 6051 T (CP003329) was used as the outgroup. 18
Using Bioinformatics to Study Evolutionary Relationships Instructions
3 Using Bioinformatics to Study Evolutionary Relationships Instructions Student Researcher Background: Making and Using Multiple Sequence Alignments One of the primary tasks of genetic researchers is comparing
Bioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.
Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure
Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata.
Supplementary Note S2 Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Phylogenetic trees reconstructed by a variety of methods from either single-copy orthologous loci (Class
Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
PGA: A Program for Genome Annotation by Comparative Analysis of. Maximum Likelihood Phylogenies of Genes and Species
PGA: A Program for Genome Annotation by Comparative Analysis of Maximum Likelihood Phylogenies of Genes and Species Paulo Bandiera-Paiva 1 and Marcelo R.S. Briones 2 1 Departmento de Informática em Saúde
The collaborative working environment an envisaged new level of knowledge transfer and innovative collaboration
Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH The collaborative working environment an envisaged new level of knowledge transfer and innovative collaboration Erko Stackebrandt,
Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers
1 2 Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers heat resistance to Fe/Mn-SODs 3 4 Running Title: Thermostability-improving peptide for SODs 5 6 7 8 Authors Wei
A phylogenomic toolbox for assembling the tree of life
A phylogenomic toolbox for assembling the tree of life or, The Phylota Project (http://www.phylota.org) UC Davis Mike Sanderson Amy Driskell U Pennsylvania Junhyong Kim Iowa State Oliver Eulenstein David
Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
Supplementary Information
Supplementary Information Supplementary Figure 1. Schematic pipeline for single-cell genome assembly, cleaning and annotation. a. The assembly process was optimized to account for multiple cells putatively
Staphylococcus vitulinus
Strain identifier BacDive ID: 14658 DOI: 10.13145/bacdive14658.20171208.2.1 Type strain: no Designation: B92/78 NT215 Culture col. no.: DSM 9930, ATCC 51698, PCM 2443 Sections Name and taxonomic classification
Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)
Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to
MiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
BLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010
BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for
Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
Microbial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
Bio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
Supporting Information
Supporting Information Das et al. 10.1073/pnas.1302500110 < SP >< LRRNT > < LRR1 > < LRRV1 > < LRRV2 Pm-VLRC M G F V V A L L V L G A W C G S C S A Q - R Q R A C V E A G K S D V C I C S S A T D S S P E
a-dB. Code assigned:
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the
Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis
Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis 10 December 2012 - Corrections - Exercise 1 Non-vertebrate chordates generally possess 2 homologs, vertebrates 3 or more gene copies; a Drosophila
Exploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University
Exploring Microbes in the Sea Alma Parada Postdoctoral Scholar Stanford University Cruising the ocean to get us some microbes It s all about the Microbe! Microbes = microorganisms an organism that requires
Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
SUPPLEMENTARY INFORMATION
Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,
Genomic expression catalogue of a global collection of BCG vaccine strains. show evidence for highly diverged metabolic and cell-wall adaptations.
Genomic expression catalogue of a global collection of BCG vaccine strains show evidence for highly diverged metabolic and cell-wall adaptations. Abdallah M. Abdallah 1 *, Grant A. Hill-Cawthorne 1,2,
Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
Comparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
Open a Word document to record answers to any italicized questions. You will the final document to me at
Molecular Evidence for Evolution Open a Word document to record answers to any italicized questions. You will email the final document to me at tchnsci@yahoo.com Pre Lab Activity: Genes code for amino
Dr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
Biology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
STEM-hy: Species Tree Estimation using Maximum likelihood (with hybridization)
STEM-hy: Species Tree Estimation using Maximum likelihood (with hybridization) Laura Salter Kubatko Departments of Statistics and Evolution, Ecology, and Organismal Biology The Ohio State University kubatko.2@osu.edu
I. Short Answer Questions DO ALL QUESTIONS
EVOLUTION 313 FINAL EXAM Part 1 Saturday, 7 May 2005 page 1 I. Short Answer Questions DO ALL QUESTIONS SAQ #1. Please state and BRIEFLY explain the major objectives of this course in evolution. Recall
Supporting Information
Supporting Information Ziemert et al. 10.1073/pnas.1324161111 Fig. S1. Geographic origin and numbers of Salinispora strains used in this study. Fig. S2. Operational biosynthetic unit (OBU) phylogeny supports
Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
Bioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
EuroBioBank/TREAT-NMD Annual Meeting «Membership to the EuroBioBank Network»
EuroBioBank/TREAT-NMD Annual Meeting 2008 «Membership to the EuroBioBank Network» CLIQUEZ ICI POUR SOUS TITRE Anne-Mary Bodin EuroBioBank Project Assistant Jeanne-Hélène di Donato Consultant, 3 C-R Paris,
BIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
BLAST. Varieties of BLAST
BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database
08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
Detection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test
Polish Journal of Microbiology 2006, Vol. 55, No 2, 113 118 Detection of Enterotoxic Bacillus cereus Producing Hemolytic and Non Hemolytic Enterotoxins by PCR Test EL BIETA O TUSZAK-WALCZAK *, PIOTR WALCZAK
BINF6201/8201. Molecular phylogenetic methods
BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics
The Complete Genome Sequence of Bacillus thuringiensis subsp. chinensis strain CT-43
JB Accepts, published online ahead of print on 6 May 2011 J. Bacteriol. doi:10.1128/jb.05085-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
PHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
Synteny Portal Documentation
Synteny Portal Documentation Synteny Portal is a web application portal for visualizing, browsing, searching and building synteny blocks. Synteny Portal provides four main web applications: SynCircos,
Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline
Phylogenetics Todd Vision iology 522 March 26, 2007 pplications of phylogenetics Studying organismal or biogeographic history Systematics ating events in the fossil record onservation biology Studying
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a
Bergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng
Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS Elizabeth Tseng Dept. of CSE, University of Washington Johanna Lampe Lab, Fred Hutchinson Cancer
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.
Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four
concentration ( mol l -1 )
concentration ( mol l -1 ) 8 10 0 20 40 60 80 100 120 140 160 180 methane sulfide ammonium oxygen sulfate (/10) b depth (m) 12 14 Supplementary Figure 1. Water column parameters from August 2011. Chemical
Cluster Analysis of Gene Expression Microarray Data. BIOL 495S/ CS 490B/ MATH 490B/ STAT 490B Introduction to Bioinformatics April 8, 2002
Cluster Analysis of Gene Expression Microarray Data BIOL 495S/ CS 490B/ MATH 490B/ STAT 490B Introduction to Bioinformatics April 8, 2002 1 Data representations Data are relative measurements log 2 ( red
Predicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
Paenibacillus popilliae
Paenibacillus popilliae Paenibacillus popilliae Emended description of Paenibacillus lentimorbus (Dutky 1940) comb. nov. Paenibacillus lentimorbus (len.ti.mor«bus. L. adj. lentus slow; L. n. morbus disease;
Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT
Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions
Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
Topology. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
Topology 1 Introduction 2 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 G+C content 7 Codon usage 27 marc.bailly-bechet@univ-lyon1.fr The big picture Eukaryota Bacteria Many linear chromosomes
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/8/e1500527/dc1 Supplementary Materials for A phylogenomic data-driven exploration of viral origins and evolution The PDF file includes: Arshan Nasir and Gustavo
C3020 Molecular Evolution. Exercises #3: Phylogenetics
C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from
Molecular Characterization and Proposed Taxonomic Placement of the Biosimulant 'BG'
Molecular Characterization and Proposed Taxonomic Placement of the Biosimulant 'BG' S.A. Burke 1, J.W. Wright 2, M.K. Robinson, B. Bronk 3, and R.L. Warren 1 1 Battelle Dugway Operations 2 U.S. Army Soldier
Phylogenetics: Building Phylogenetic Trees
1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss Methods Identification of orthologues, alignment and evolutionary distances A preliminary set of orthologues was
A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems
A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems Tao Yuan, Asst/Prof. Stephen Tiong-Lee Tay and Dr Volodymyr Ivanov School of Civil and Environmental
Biological Networks: Comparison, Conservation, and Evolution via Relative Description Length By: Tamir Tuller & Benny Chor
Biological Networks:,, and via Relative Description Length By: Tamir Tuller & Benny Chor Presented by: Noga Grebla Content of the presentation Presenting the goals of the research Reviewing basic terms
a-dB. Code assigned:
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the
Cladistics and Bioinformatics Questions 2013
AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species
Algorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Distance Methods Character Methods
The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
Phylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University
Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary
This is a repository copy of Microbiology: Mind the gaps in cellular evolution.
This is a repository copy of Microbiology: Mind the gaps in cellular evolution. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/114978/ Version: Accepted Version Article:
SUPPLEMENTARY INFORMATION
Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)
Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder
Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder nrpace@colorado.edu Outline What is the Tree of Life? -- Historical Conceptually
Computational approaches for functional genomics
Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding
Introduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
2 Genome evolution: gene fusion versus gene fission
2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,
Comparative Bioinformatics Midterm II Fall 2004
Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans
Chapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
doi: / _25
Boc, A., P. Legendre and V. Makarenkov. 2013. An efficient algorithm for the detection and classification of horizontal gene transfer events and identification of mosaic genes. Pp. 253-260 in: B. Lausen,
Chad Burrus April 6, 2010
Chad Burrus April 6, 2010 1 Background What is UniFrac? Materials and Methods Results Discussion Questions 2 The vast majority of microbes cannot be cultured with current methods Only half (26) out of
National Engineering Research Center of Industry Crystallization Technology, School
Electronic Supplementary Material (ESI) for CrystEngComm. This journal is The Royal Society of Chemistry 2018 Supporting Information Insight into the Role of Piperazine in the Thermodynamics and Nucleation
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and
Supplementary Fig. 1. Infection of three C. elegans strains used for spatially restricted enzymatic tagging. Animals infected with N.
Supplementary Fig. 1. Infection of three C. elegans strains used for spatially restricted enzymatic tagging. Animals infected with N. parisii stained with a FISH probe (red) specific for Nematocida rrna.
Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
Essentiality in B. subtilis
Essentiality in B. subtilis 100% 75% Essential genes Non-essential genes Lagging 50% 25% Leading 0% non-highly expressed highly expressed non-highly expressed highly expressed 1 http://www.pasteur.fr/recherche/unites/reg/
Mitochondrial Genome Annotation
Protein Genes 1,2 1 Institute of Bioinformatics University of Leipzig 2 Department of Bioinformatics Lebanese University TBI Bled 2015 Outline Introduction Mitochondrial DNA Problem Tools Training Annotation
Bio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
Session 5: Phylogenomics
Session 5: Phylogenomics B.- Phylogeny based orthology assignment REMINDER: Gene tree reconstruction is divided in three steps: homology search, multiple sequence alignment and model selection plus tree
New Tools for Visualizing Genome Evolution
New Tools for Visualizing Genome Evolution Lutz Hamel Dept. of Computer Science and Statistics University of Rhode Island J. Peter Gogarten Dept. of Molecular and Cell Biology University of Connecticut
GENE ONTOLOGY (GO) Wilver Martínez Martínez Giovanny Silva Rincón
GENE ONTOLOGY (GO) Wilver Martínez Martínez Giovanny Silva Rincón What is GO? The Gene Ontology (GO) project is a collaborative effort to address the need for consistent descriptions of gene products in
Microbiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics