Staphylococcus vitulinus
|
|
- Maude Richardson
- 5 years ago
- Views:
Transcription
1 Strain identifier BacDive ID: DOI: /bacdive Type strain: no Designation: B92/78 NT215 Culture col. no.: DSM 9930, ATCC 51698, PCM 2443 Sections Name and taxonomic classification Morphology and physiology Culture and growth conditions Isolation, sampling and environmental informationarrow Application and interaction Molecular biology Strain availability References Name and taxonomic classification Domain Bacteria Phylum Firmicutes Class Bacilli Order Bacillales Family Staphylococcaceae Genus Staphylococcus Species Staphylococcus vitulinus Full Scientific Name Staphylococcus vitulinus Webster et al emend. Svec et al Designation: B92/78 NT215 Type strain: no Prokaryotic Nomenclature Up-to-date (PNU) Ref.: Domain Bacteria Ref.: Phylum Firmicutes Ref.: Class Bacilli Ref.: Literature reference Int. J. Syst. Evol. Microbiol. 60:469 Ref.: Family Staphylococcaceae Ref.: Literature reference Int. J. Syst. Evol. Microbiol. 60:470 Ref.: Genus Staphylococcus
2 Ref.: Taxonomical status genus (AL) Ref.: Literature reference Int. J. Syst. Bacteriol. 30:365 AL Ref.: Species Staphylococcus vitulinus Ref.: Taxonomical status sp. nov. (VP) Ref.: Literature reference Int. J. Syst. Bacteriol. 44:458* Ref.: Full Scientific Name Staphylococcus vitulinus corrig. Webster et al emend. Svec et al Ref.: Synonym Staphylococcus pulvereri Ref.: Synonym Staphylococcus vitulus Morphology and physiology Type of hemolysis alpha/beta Enzymes Enzyme Enzyme activity EC number catalase cytochrome-c oxidase API ID32STA API ID 521 URE - ADH (Arg) - ODC - ESC - GLU + FRU + MNE - MAL - LAC - TRE + MAN + RAF - RIB - CEL - NIT + VP + betagal - ArgA -
3 PAL - PyrA - NOVO + SAC + NAG - TUR - ARA - betagur - Murein short key A11.08 Murein types A3alpha L-Lys-L-Ala-Gly 4-5 Culture and growth conditions TRYPTICASE SOY YEAST EXTRACT MEDIUM (DSMZ Medium 92), 37 C growth yes link pdf Trypticase soy broth 30.0 g Yeast extract 3.0 g Agar 15.0 g Distilled water mladjust ph to COLUMBIA BLOOD MEDIUM (DSMZ Medium 693), 37 C growth yes link Columbia agar base supplemented with 5% defibrinated sheep blood. Ref.: MEDIUM 3 - Columbia agar Ref.: growth yes Ref.: Columbia agar ( g);distilled water ( ml) Temperatures Kind of temperature Temperature optimum 37 C Ref.: growth 37 C Temperature range mesophilic
4 Isolation, sampling and environmental information Sample type/isolated from human hip infection Application and interaction Pathogenicity (human) yes Biosafety level 1 Risk group (German classification) Molecular biology GC-content 27 mol% thermal denaturation, midpoint method (Tm) database accession description accession number length(bp) Associated NCBI tax ID (DDBJ Direct Staphylococcus vitulinus rrn gene for 16S ribosomal RNA AB * (GenBank Direct Staphylococcus pulvereri heat shock protein 60 gene, partial cds AF * (GenBank Direct Staphylococcus pulvereri strain DSM S ribosomal RNA gene, partial sequence AY * GenBank Direct submission U Strain availability Culture collection no. DSM 9930, ATCC 51698, PCM 2443 Strain history <- PCM Associated Passport(s) in StrainInfo References
5 Ref.: Ref.: Leibniz Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH; Curators of the DSMZ; DSM 9930 D.Gleim, M.Kracht, N.Weiss et. al.: Prokaryotic Nomenclature Up-to-date - compilation of all names of Bacteria and Archaea, validly published according to the Bacteriological Code since 1. Jan. 1980, and validly published nomenclatural changes since. Verslyppe, B., De Smet, W., De Baets, B., De Vos, P., Dawyndt P. StrainInfo introduces electronic passports for microorganisms.. Syst Appl Microbiol. 37: ( /j.syapm , ) None; Curators of the CIP; None * These References are textmined back to top
The collaborative working environment an envisaged new level of knowledge transfer and innovative collaboration
Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH The collaborative working environment an envisaged new level of knowledge transfer and innovative collaboration Erko Stackebrandt,
More informationCultivation and Conservation of Competent Endophytes May In-Vitro Culture help?
COST Action FA1103 Core Group 3 Meeting New concepts and strategies for longterm cultivation and conservation of competent endophytes for plant growth and plant protection Cultivation and Conservation
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationInternational Journal of Systematic and Evolutionary Microbiology (2014), 64,
International Journal of Systematic and Evolutionary Microbiology (2014), 64, 293 297 DOI 10.1099/ijs.0.057158-0 Taxonomic Note The family name Solimonadaceae Losey et al. 2013 is illegitimate, proposals
More informationGenomic insights into the taxonomic status of the Bacillus cereus group. Laboratory of Marine Genetic Resources, Third Institute of Oceanography,
1 2 3 Genomic insights into the taxonomic status of the Bacillus cereus group Yang Liu 1, Qiliang Lai 1, Markus Göker 2, Jan P. Meier-Kolthoff 2, Meng Wang 3, Yamin Sun 3, Lei Wang 3 and Zongze Shao 1*
More informationIsolation and characterization of racemase from Ensifer sp that acts on - aminolactams and -amino acid amides
1 Journal of Industrial Microbiology & Biotechnology 2 3 4 Isolation and characterization of racemase from Ensifer sp. 23-3 that acts on - aminolactams and -amino acid amides 5 6 7 Daisuke Matsui 1,2,$,
More informationA Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems
A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems Tao Yuan, Asst/Prof. Stephen Tiong-Lee Tay and Dr Volodymyr Ivanov School of Civil and Environmental
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationPharmaceutical Microbiology Forum Newsletter Vol. 12 (4) Page 3 of 14 (NCIMB 8545, CIP NBRC. Salmonella enterica ssp typhimurium
Page 3 of 14 Continued from page 2 Table 2. Absence of Specified Details Media Growth Promotion Organisms for Trypticase Soy Staphylococcus aureus Escherichia coli Pseudomonas aeruginosa Salmonella Staphylococcus
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationMicrobial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
More informationRapid Learning Center Chemistry :: Biology :: Physics :: Math
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/37 *AP is a registered trademark of the College Board, which does not
More informationAEROBIC BACTERIA GRAM POSITIVE BACTERIA. Tests S. aureus CNST S. saprophyticus Micrococcus species 6
AEROBIC BACTERIA GRAM BACTERIA GRAM COCCI - Catalase-Positive s S. aureus CNST S. saprophyticus Micrococcus species 6 Stomatococcus species 7 T-DNase 1 + - - - - Staph-Slide + - - - - Agglutination 1,2,4
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationIsotopically labeled sulfur compounds and synthetic. selenium and tellurium analogues to study sulfur
Supporting Information for Isotopically labeled sulfur compounds and synthetic selenium and tellurium analogues to study sulfur metabolism in marine bacteria Nelson L. Brock 1, Christian A. Citron 1, Claudia
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Classification of living organisms into groups. A group or level of classification
Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationNiche specific amino acid features within the core genes of the genus Shewanella
www.bioinformation.net Hypothesis Volume 8(19) Niche specific amino acid features within the core genes of the genus Shewanella Rachana Banerjee* & Subhasis Mukhopadhyay Department of Biophysics, Molecular
More informationClassification and Viruses Practice Test
Classification and Viruses Practice Test Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Biologists use a classification system to group organisms in part
More informationDSM (FAD ; CRL/160047)
EUROPEAN COMMISSION DIRECTORATE GENERAL JOINT RESEARCH CENTRE Directorate D: Institute for Reference Materials and Measurements European Union Reference Laboratory for Feed Additives Ref. Ares(2017)1927666-11/04/2017
More informationIntroduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1
Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationPaenibacillus popilliae
Paenibacillus popilliae Paenibacillus popilliae Emended description of Paenibacillus lentimorbus (Dutky 1940) comb. nov. Paenibacillus lentimorbus (len.ti.mor«bus. L. adj. lentus slow; L. n. morbus disease;
More informationThe Evolution of DNA Uptake Sequences in Neisseria Genus from Chromobacteriumviolaceum. Cory Garnett. Introduction
The Evolution of DNA Uptake Sequences in Neisseria Genus from Chromobacteriumviolaceum. Cory Garnett Introduction In bacteria, transformation is conducted by the uptake of DNA followed by homologous recombination.
More informationInternational Journal of Systematic and Evolutionary Microbiology (2013), 63, Inhoffenstrasse 7B, Braunschweig, Germany
International Journal of Systematic and Evolutionary Microbiology (2013), 63, 4354 4360 DOI 10.1099/ijs.0.056440-0 Designation of type strains for seven species of the order Myxococcales and proposal for
More informationOverview of the major bacterial pathogens The major bacterial pathogens are presented in this table:
Practical Microbiology 30/11/2018 University of Sulaimani college of Pharmacy Year2 Lab. 5: Overview of the major bacterial pathogens The major bacterial pathogens are presented in this table: Major Bacterial
More informationHAEMOPHILUS MODULE 29.1 INTRODUCTION OBJECTIVES 29.2 MORPHOLOGY. Notes
29 HAEMOPHILUS 29.1 INTRODUCTION The genus Haemophilus contains small, nonmotile, nonsporing, oxidase positive, pleomorphic, gram negative bacilli that are parasitic on human beings or animals. Haemophilus
More informationTwo novel psychrotolerant species, Bacillus psychrotolerans sp. nov. and Bacillus psychrodurans sp. nov., which contain ornithine in their cell walls
International Journal of Systematic and Evolutionary Microbiology (2002), 52, 2127 2133 DOI: 10.1099/ijs.0.01665-0 Two novel psychrotolerant species, Bacillus psychrotolerans sp. nov. and Bacillus psychrodurans
More informationCellular Basis of Microbiology
Presentation Subtitle Dr. Gary Mumaugh Cellular Basis of Microbiology Microorganism: Structure Structure of Prokaryotic Cell Structure of Eukaryotic Cell Microorganism: Varieties of Shapes Microorganism:
More informationModified Oxidase and Benzidine Tests for Separation of Staphylococci from Micrococci
JOURNAL OF CLNCAL MCROBOLOGY, June 1981, p. 1031-1035 0095-1137/81/061031-05$02.00/0 Vol. 13, No. 6 Modified Oxidase and Benzidine Tests for Separation of Staphylococci from Micrococci ANTON FALLER AND
More informationAssigning Taxonomy to Marker Genes. Susan Huse Brown University August 7, 2014
Assigning Taxonomy to Marker Genes Susan Huse Brown University August 7, 2014 In a nutshell Taxonomy is assigned by comparing your DNA sequences against a database of DNA sequences from known taxa Marker
More informationIntroductory Microbiology Dr. Hala Al Daghistani
Introductory Microbiology Dr. Hala Al Daghistani Why Study Microbes? Microbiology is the branch of biological sciences concerned with the study of the microbes. 1. Microbes and Man in Sickness and Health
More informationTineke Jones Agriculture and Agri-Food Canada Lacombe Research Centre Lacombe, Alberta
Growth of Escherichia Coli at Chiller Temperatures Tineke Jones Agriculture and Agri-Food Canada Lacombe Research Centre Lacombe, Alberta \ Introduction The responses of mesophilic microorganisms to chiller
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationIntroduction to microbiology
Sulaimani University College of Pharmacy Microbiology Introduction to microbiology Dr. Abdullah Ahmed Hama PhD. Molecular Medical Parasitology abdullah.hama@spu.edu.iq 1 Definition Microbiology: is the
More informationBacillus anthracis. Last Lecture: 1. Introduction 2. History 3. Koch s Postulates. 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes
Last Lecture: Bacillus anthracis 1. Introduction 2. History 3. Koch s Postulates Today s Lecture: 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes 3. Phylogenetics I. Basic Cell structure: (Fig.
More informationCLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1
CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1 MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 2/13 2/14 - B 2/15 2/16 - B 2/17 2/20 Intro to Viruses Viruses VS Cells 2/21 - B Virus Reproduction Q 1-2 2/22 2/23
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes
More informationIntroduction To Microbiology CLS 311
Introduction To Microbiology CLS 311 What is microbiology? It is a branch of biology that studies microorganisms and their effects on humans Microorganisms a collection of organisms that share the characteristic
More informationKILGORE COLLEGE BIOLOGY DEPARTMENT Biology 2421 Syllabus
COURSE: BIOL 2421 (4-3-4) TITLE: CATALOG DESCRIPTION: Microbiology and Pathology A study of the morphology, physiology, genetics, taxonomy and control of microorganisms. This course includes a study of
More informationRobert Edgar. Independent scientist
Robert Edgar Independent scientist robert@drive5.com www.drive5.com "Bacterial taxonomy is a hornets nest that no one, really, wants to get into." Referee #1, UTAX paper Assume prokaryotic species meaningful
More informationEASTERN ARIZONA COLLEGE Microbiology
EASTERN ARIZONA COLLEGE Microbiology Course Design 2015-2016 Course Information Division Science Course Number BIO 205 (SUN# BIO 2205) Title Microbiology Credits 4 Developed by Ed Butler/Revised by Willis
More informationWarm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)
Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,
More informationBACTERIA. CLS 212: Medical Microbiology Miss Zeina Alkudmani
BACTERIA CLS 212: Medical Microbiology Miss Zeina Alkudmani Prokaryotes Prokaryotic cells possess simpler structures than eukaryotic cells, since they do not have a nucleus or a lot of cytoplasmic organelles.
More informationNUT-TTC/EMB Code 5541
NUT-TTC/EMB Code 5541 COMING SOON! BioPaddles Colony Identification App Nutrient-TTC Agar (NUT-TTC) Eosin Methylene Blue Agar (EMB) USE: Isolation and differentiation of Gram (-) enteric bacilli. Coliform
More informationMicrobiology Helmut Pospiech
Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition
More informationGenome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.
Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction
More informationPlant Names and Classification
Plant Names and Classification Science of Taxonomy Identification (necessary!!) Classification (order out of chaos!) Nomenclature (why not use common names?) Reasons NOT to use common names Theophrastus
More informationChapter 1. Basics of Microbiology
Chapter 1 Basics of Microbiology Objectives How microorganisms are classified (taxonomy) What they look like (morphology) The major divisions among microorganisms based upon their function in the environment
More informationStation A: #3. If two organisms belong to the same order, they must also belong to the same
Station A: #1. Write your mnemonic for remembering the order of the taxa (from the broadest, most generic taxon to the most specific). Out to the side of each, write the name of each taxon the mnemonic
More informationComputational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
More informationDiversity of Halophilic Archaea from Ezzemoul Sabkha in Algeria
Óbuda University e-bulletin Vol. 5, No. 1, 2015 Diversity of Halophilic Archaea from Ezzemoul Sabkha in Algeria Karima Kharroub 1, Amine Mohamed Gomri 1, Mercedes Monteoliva-Sanchez 2 1 Department of Biotechnology/
More informationMicrobiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
More informationUniversity of Groningen
University of Groningen Agmatine deiminase pathway genes in Lactobacillus brevis are linked to the tyrosine decarboxylation operon in a putative acid resistance locus Lucas, Patrick M.; Blancato, Victor
More informationDEPARTMENT OF ANIMAL HEALTH TECHNOLOGY COURSE OUTLINE - FALL 2014 LAB PROCEDURES AND MICROBIOLOGY AH 174 E- MAIL:
DEPARTMENT OF ANIMAL HEALTH TECHNOLOGY COURSE OUTLINE - FALL 2014 LAB PROCEDURES AND MICROBIOLOGY AH 174 INSTRUCTOR: Dr. Chris Mizzi Kristy Mergeart, RAHT PHONE: 780-835-6617 780-835-6779 OFFICE: AS 133
More informationHomeostasis Worksheet
Biology Ms. Ye Name Date Block Homeostasis Worksheet Homeostasis is a dynamic process of regulating and maintaining stable internal conditions MODEL 1: Maintaining a Car Speed. The process of homeostasis
More informationLIST OF PROKARYOTIC NAMES VALIDLY PUBLISHED. in August 2016
Leibniz Institut DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH LIST OF PROKARYOTIC NAMES VALIDLY PUBLISHED in August 2016 compiled by Dorothea Gleim, Leibniz Institut DSMZ Deutsche Sammlung
More informationLIST OF PROKARYOTIC NAMES VALIDLY PUBLISHED. in October 2017
Leibniz Institut DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH LIST OF PROKARYOTIC NAMES VALIDLY PUBLISHED in October 2017 compiled by Dorothea Gleim, Leibniz Institut DSMZ Deutsche
More information(b) In 1977, Carl Woese suggested that there are three domains of living organisms: the Archaea, the Bacteria and the Eukaryota.
1 Prokaryotic and eukaryotic organisms can be classified depending on their cellular structure. (a) Describe three structural differences between prokaryotic and eukaryotic cells. (b) In 1977, Carl Woese
More informationIsolation of marine bacteria, antagonistic to human pathogens
Indian Journal of Marine Sciences Vol. 31(1), March 2002, pp. 39-44 Isolation of marine bacteria, antagonistic to human pathogens K. Jayanth, G. Jeyasekaran* & R. Jeya Shakila Department of Fish Processing
More informationSupporting Information
1 Supporting Information 5 6 7 8 9 10 11 1 1 1 15 16 17 Sequences: E. coli lysine riboswitch (ECRS): GTACTACCTGCGCTAGCGCAGGCCAGAAGAGGCGCGTTGCCCAAGTAACGGTGTTGGAGGAGCCAG TCCTGTGATAACACCTGAGGGGGTGCATCGCCGAGGTGATTGAACGGCTGGCCACGTTCATCATCGG
More informationHaemophilus influenzae and Haemophilus parainfluenzae
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 1975, p. 89-95 Copyright ( 1975 American Societv for Microbiology Vol. 1, No. 1 Printed in U.S.A. New Satellitism Test for Isolation and Identification of Haemophilus
More informationKingdoms in Eukarya: Protista, Fungi, Plantae, & Animalia Each Eukarya kingdom has distinguishing characteristics:
NAME pg. 1 Classification Domain Kingdom Phylum Class Order Family Genus species Eukarya Animalia Chordata Mammalia Primate Hominidae Homo sapiens Mnemonic: DUMB KING PHILIP CAME OVER FOR GOOD SOUP Domain
More informationWhat is a cell? (*Know the parts of the microscope!)
Cells What is a cell? All living things have cells whether it is one or many! Therefore, a cell is the basic unit of all life. The invention of the microscope was pivotal to the study of cell biology.
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationSUPPLEMENTARY INFORMATION
Supplementary Methods A total of 18 denitrifying species were isolated (Suppl. Table S3) and stored in ready to use aliquots at -80 C. In preparation for each experiment (Suppl. Fig. S1), the strains were
More informationMicrobiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
More informationIntroduction. Recall: 1) Life is both similar and diverse 2) Evolution helps us understand who is related to who
Biology 11 Taxonomy Objectives By the end of the lesson you should be able to: State the levels of classification and the man who created the classification system Describe the 3 domains and the 4 kingdoms
More informationdoi: / _25
Boc, A., P. Legendre and V. Makarenkov. 2013. An efficient algorithm for the detection and classification of horizontal gene transfer events and identification of mosaic genes. Pp. 253-260 in: B. Lausen,
More informationPhylogenetic Diversity of Coliform Isolates in USA. Phylogenetic Classification
Phylogenetic Diversity of Coliform Isolates in USA Ya Zhang and Wen Tso Liu University of Illinois at Urbana Champaign Mark LeChevallier American Water Inc. Nov 2011 Phylogenetic Classification group organisms
More informationBiology 160 Cell Lab. Name Lab Section: 1:00pm 3:00 pm. Student Learning Outcomes:
Biology 160 Cell Lab Name Lab Section: 1:00pm 3:00 pm Student Learning Outcomes: Upon completion of today s lab you will be able to do the following: Properly use a compound light microscope Discuss the
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: https://digitalcontentmarket.org/download/test-bank-formicrobiology-a-systems-approach-3rd-edition-by-cowan Chapter
More informationStepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
More informationBACTERIAL TOLERANCE TO HEAVY METALS UNDER THE INFLUENCE OF ph, TEMPERATURE AND SALINITY
BACTERIAL TOLERANCE TO HEAVY METALS UNDER THE INFLUENCE OF ph, TEMPERATURE AND SALINITY 1 J. JOONU, 2 KAVITHA.P, 3 SUGANYA.T 1, 2, 3 Department of Zoology, Bishop Heber College, Trichy 17, Tamilnadu. India
More informationHaliea salexigens gen. nov., sp. nov., a member of the Gammaproteobacteria from the Mediterranean Sea
Please note that this is an author-produced PDF of an article accepted for publication following peer review. The definitive publisher-authenticated version is available on the publisher Web site International
More informationResistance of Escherichia coli and Salmonella typhimurium to Carbenicillin
J. gen. Microbiol. (1969, 58, 301-305 Printed in Great Britain 301 Resistance of Escherichia coli and Salmonella typhimurium to Carbenicillin By H. C. NEU AND H. S,WARZ Department of Medicine, College
More informationCERTIFICATE. Inactivation of pathogens by cold disinfection. in the cryostat CryoStar NX70
Labor für Mikrobiologie und Ökotoxikologie Priv. Doz. Dr. Ingo Maier Microm International GmbH Mr Dieter Teppke Otto-Hahn-Straße 1a 69190 Walldorf Germany Hochgratweg 12 D-88779 Amtzell, Germany Tel +49
More informationCulture Medium for Selective Isolation and Enumeration of Gram-Negative Bacteria from Ground Meatst
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 1981, p. 303-307 0099-2240/81/090303-05$02.00/0 Vol. 42, No. 2 Culture Medium for Selective Isolation and Enumeration of Gram-Negative Bacteria from Ground
More informationMolecular identification of alkaliphilic and halotolerant strain Bacillus sp. FTU as Bacillus pseudofirmus FTU
Extremophiles (2002) 6:195 199 Digital Object Identifier (DOI) 10.1007/s007920100240 1 ORIGINAL PAPER Maria S. Muntyan Tatiana P. Tourova Anatolij M. Lysenko Tatiana V. Kolganova Dagmar Fritze Vladimir
More information16S Metagenomics Report
Sample: BL-09 Report Date: 05/11/2017 18:40:20 Sample Information Sample ID: Sample Name: Run Folder: Taxonomy File: BL_09 BL_09 D:\Illumina\MiSeqAnalysis\170509_M01675_0059_000000000-AW8GB gg_13_5_species_32bp.dat
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationDomain Bacteria. BIO 220 Microbiology Jackson Community College
Domain Bacteria BIO 220 Microbiology Jackson Community College John Ireland, Ph.D. 2006 Scientific Nomenclature Domain - Bacteria Phylum Important for gross characteristics Class Intermediate characteristics
More informationa-dB. Code assigned:
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the
More informationTentative Identification of Methanogenic Bacteria by Fluorescence Microscopy
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 1977, p. 713-717 Copyright (C 1977 American Society for Microbiology Vol. 33, No. 3 Printed in U.S.A. Tentative Identification of Methanogenic Bacteria by Fluorescence
More informationDynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a
More informationMultiple Choice Write the letter on the line provided that best answers the question or completes the statement.
Chapter 18 Classification Chapter Test A Multiple Choice Write the letter on the line provided that best answers the question or completes the statement. 1. Scientists assign each kind of organism a universally
More informationExercise 7-A INTRODUCTION TO PROKARYOTES AND ENRICHMENTS FOR SELECTED BACTERIA FROM THE ENVIRONMENT
Exercise 7-A INTRODUCTION TO PROKARYOTES AND ENRICHMENTS FOR SELECTED BACTERIA FROM THE ENVIRONMENT Introduction The prokaryotes, Bacteria and Archaea are ubiquitous organisms that as a group are the most
More informationMicroscopy, Staining, and Classification. ~10 um. Red Blood Cells = mm 1500 um. Width of penny
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 4 Microscopy, Staining, and Classification Figure 3.4 Approximate size of various types
More informationKharkov National Medical University. Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich
Kharkov National Medical University Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich Tkachenko Victoria 1, 5, 11, 14, 19, 21, 30 Kovalenko Natalia 2, 12, 25, 29 Siritsa
More informationphenomenon called cross resistance. As a consequence of cross resistance the entire class of aminoglycosides looses its therapeutic potential.
Experiment 25 Laboratory to Biology III Diversity of Microorganisms / Wintersemester / page 1 Mechanisms of aminoglycoside resistance in mycobacteria Advisor P.D. Dr. Peter Sander, psander@immv.unizh.ch,
More informationSupporting Information
1 Supporting Information 2 3 4 5 Automated High-Throughput Identification and Characterisation of Clinically Important Bacteria and Fungi using Rapid Evaporative Ionisation Mass Spectrometry (REIMS) 6
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationEffect of Coliform and Proteus Bacteria on Growth
APPLIED MICROBIOLOGY, Jan., 19 Copyright @ 19 American Society for Microbiology Vol. 14, No. 1 Printed in U.S.A. Effect of Coliform and Proteus Bacteria on Growth of Staphylococcus aureus1 J. V. DiGIACINTO2
More informationarchive Silica as biologically transmutated source for bacterial growth similar to carbon
Correspondence s.karthy@gmail.com Disciplines Physiology Keywords Bacteria Biological Evolution Physiology archive Type of Observation Standalone Type of Link Orphan Data Submitted Nov 27, 2015 Published
More informationUnit 3: Control and regulation Higher Biology
Unit 3: Control and regulation Higher Biology To study the roles that genes play in the control of growth and development of organisms To be able to Give some examples of features which are controlled
More information32 J.B. Figueras et al. / FEMS Microbiology Letters 152 (1997) 31^36 Table 1 List of strains used in this work, their origins and some phenotypic char
FEMS Microbiology Letters 152 (1997) 31^36 Phylogeny of the genus Chlorobium based on 16S rdna sequence Jordi B. Figueras *, L. Jesus Garcia-Gil, Carles A. Abella Laboratory of Microbiology, Institute
More information