Assigning Taxonomy to Marker Genes. Susan Huse Brown University August 7, 2014
|
|
- Randolph Beasley
- 5 years ago
- Views:
Transcription
1 Assigning Taxonomy to Marker Genes Susan Huse Brown University August 7, 2014
2 In a nutshell Taxonomy is assigned by comparing your DNA sequences against a database of DNA sequences from known taxa
3 Marker Genes Bacteria 16S (SSU rrna) Archaea 16S (SSU rrna) Protist 18S (SSU rrna) Fungi ITS, LSU rrna
4 Taxonomic Consistency For meaningful community comparisons, taxonomic names must be consistent: Names - one organism should have only one name Levels for automated comparisons, need consistent levels: Kingdom;Phylum;Class;Order;Family;Genus;Species
5 Official Taxonomic Names Bergey s Taxonomic Outline manual of taxonomic names for bacteria List of Prokaryotic names with Standing in the Nomenclature (vetting process) NCBI similar taxonomy, but multiple subs (subclass, suborder, subfamily, tribe) Fungi UNITE Archaea also a work in progress
6 Primary Methods of Taxonomic Assignment Marker genes RDP GAST BLAST Shotgun Metagenomic MetaPhlAn AMPHORA
7 Ribosomal Database Project Uses Bayesian Kmer Matching Wang, et al (2007) Appl Environ Microbiol. 73(16):
8 k-mer indexing TGCTAGCTAGTGACATCCACAGAACTTTCCA GAGATGGATTGGTGCCTTCGGGAACTGTGA! Ex. 4-mer indexing TGCT 1! AGCT 1! GCTA 2! 1! TAGT 1! CTAG 2! 1! TAGC 1! AGTG 1! GTGA 1!
9 RDP Web Results Reports: Taxonomy at each level Bootstrap value at each level Min 80% by default Domain Phylum Class Order Family Genus Root[100%] Bacteria[100%] Proteobacteria [100%] Alphaproteobacteria[100%] Rhodospirillales[100%] Rhodospirillaceae[100%] Dongia[99%]
10 Bootstrap Confidence Estimation the number of times a genus was selected out of 100 bootstrap trials was used as an estimate of confidence in the assignment to that genus.
11 Bootstrap Cutoff Values 0% 50% 80% V3 % classified to genus 100% 92.4% 82.3% % classified to correct genus 92.0% 95.0% 98.1% V4 0% 50% 80% % classified to genus 100% 97% 87.9% % classified to correct genus 92.8% 94.5% 95.7% V6 0% 50% 80% % classified to genus 100% 73.5% 40.4% % classified to correct genus 79.0% 96.5% 98.7% Based on 7,028 human gut sequences, RDP-classified full-length then cut and reclassified
12 Incremental Accuracy V3 0% 50% 80% % classified to genus 100% 92.4% 82.3% % classified to correct genus 92.0% 95.0% 98.1% Assume 1000 reads: At 80%: 823 are classified to genus 807 are identified correctly (823 X = 807) 16 seq are identified incorrectly ( = 16) At 50%: 924 are classified to genus (101 more) 878 are correct (924 X 0.95 = 878) (71 more) 46 are incorrect (30 more) 30% of the added reads are incorrect (=30/101).
13 GAST: Global Assignment of Sequence Taxonomy GAST uses direct comparison to a reference database to assign taxonomy. Huse, et al (2008) PLoS Genetics 4: e
14 Reference Matching Sequence matching to nearest sequence in a reference database. global alignment (USEARCH) rather than local alignment (BLAST) Distance is defined by the number of mismatches along the sequence alignment. Huse, et al (2008) PLoS Genetics 4: e
15 Assigned Taxon Name GAST uses a lowest common taxon method to assign taxonomy when a read is equidistant to more than one reference sequence. Assignment requires a minimum of 66% concurrence (2/3s majority).
16 GAST Flowchart High Quality 16S tags Nearest RefSeq(s) and GAST Distance RefDB (e.g., RefV3V4 RefSSU) Using tags cut to match primers is much more efficient Consensus Taxonomy (2/3s majority)
17 GAST R1: TGGTCTTGACATCCACAGAT! Q: TGGTCTTGACATCCACAGAT! Query exactly matches 1 reference RefID: R1 Distance: 0.0
18 GAST R1: TGGACTTGACATCCACAGAT! Q: TGGTCTTGACATCCACAGAT! TGGTCTTGACATCGACAGAT! R2: TGGTCTTGGCATCTACAGAT! Query inexactly matches 2 references with two mismatches each RefID R1,R2 Distance = 1 / 20 = 0.05
19 Consensus Calculation If Query equally matches multiple references: Firmicutes; Clostridia; Clostridiales; Lachnospiraceae (1 hit) Firmicutes; Clostridia; Clostridiales; Clostridiaceae; Clostridium (4 hits) Firmicutes; Clostridia; Clostridiales; Clostridiaceae; Clostridium; perfringens (5 hits) 1. Calculate community size: = Lowest rank = species 3. Calculate voting: 5 / 10 = 50% (less than 66%) 4. Next rank = genus 5. Calculate genus voting: (4+5) / 10 = 90% 6. Assign taxonomy to genus level
20 GAST Distance GAST does not report a bootstrap value or confidence interval, GAST reports the distance to the nearest sequence. If distance = 0, then good accuracy If distance = 0.05 (5%) then likely same family and maybe genus, but not species.
21 BLAST Top BLAST hit can lead to unexpected results: hits to unclassified, sources other than microbial SSU rrna local alignments can be misleading Supervised BLAST is an excellent tool Unsupervised can be dangerous
22 Methods Comparison RDP is considered the standard available via RDP website, mothur, QIIME, or local Works better on longer sequences, not as well on shorter sequences. GAST works well for shorter sequences can go to species depending on the reference database BLAST to nt often returns incorrect taxonomy, not good for pipelines, good for checking individual results
23 16S regions give similar results at the genus level V3 N = 299,044 Other = 99 V6 N = 322,971 Other = 82 Full-Length N = 5,519 Other = 26 Human gut microbiota with 250nt V3, 60nt V6, 1000nt FL
24 Reference Database Considerations 1. Size of the database Does it contain reference sequences similar to your data? 2. Taxonomy of the database Are the references classified to genus or species? 3. Quality of the database Are there chimeras or low-quality sequences?
25 Example Reference Databases 1. SILVA database SSU, LSU 2. RDP training set SSU, ITS 3. Greengenes
26 Specialized Databases HOMD Human Oral Microbiome Database OSU CORE for oral UNITE
27 Which Hypervariable Region? Two regions are better than one - more information Different regions have different specificity at the genus or species level Different primer sets can have different biases Depends on your samples
28 16S Specificity in SILVA RefHVR sequences mapping V3-V5 V6-V4 Unique taxon 97.1% 97.5% If genus, unique genus 99.7% 99.8% If species, unique species 93.1% 93.6% 2 Taxa (ambiguous) 2.3% 2.0% 2 Lineages 0.6% 0.5% Unique lineage mapping 99% 99% Assigning taxonomy is only as good as your reference
29 Sources of Error in Taxonomic Analyses Primer bias Chimeras Non-16S tag amplified Discovery of novel 16S Unrepresented in reference database Low-quality references Taxonomy not available Incorrect taxonomy Ambiguous hypervariable sequence Reference biased toward most studied
Taxonomy and Clustering of SSU rrna Tags. Susan Huse Josephine Bay Paul Center August 5, 2013
Taxonomy and Clustering of SSU rrna Tags Susan Huse Josephine Bay Paul Center August 5, 2013 Primary Methods of Taxonomic Assignment Bayesian Kmer Matching RDP http://rdp.cme.msu.edu Wang, et al (2007)
More informationRobert Edgar. Independent scientist
Robert Edgar Independent scientist robert@drive5.com www.drive5.com "Bacterial taxonomy is a hornets nest that no one, really, wants to get into." Referee #1, UTAX paper Assume prokaryotic species meaningful
More informationMicrobiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
More informationTaxonomical Classification using:
Taxonomical Classification using: Extracting ecological signal from noise: introduction to tools for the analysis of NGS data from microbial communities Bergen, April 19-20 2012 INTRODUCTION Taxonomical
More informationAmplicon Sequencing. Dr. Orla O Sullivan SIRG Research Fellow Teagasc
Amplicon Sequencing Dr. Orla O Sullivan SIRG Research Fellow Teagasc What is Amplicon Sequencing? Sequencing of target genes (are regions of ) obtained by PCR using gene specific primers. Why do we do
More informationrrdp: Interface to the RDP Classifier
rrdp: Interface to the RDP Classifier Michael Hahsler Anurag Nagar Abstract This package installs and interfaces the naive Bayesian classifier for 16S rrna sequences developed by the Ribosomal Database
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationComparison of Three Fugal ITS Reference Sets. Qiong Wang and Jim R. Cole
RDP TECHNICAL REPORT Created 04/12/2014, Updated 08/08/2014 Summary Comparison of Three Fugal ITS Reference Sets Qiong Wang and Jim R. Cole wangqion@msu.edu, colej@msu.edu In this report, we evaluate the
More informationAccuracy of taxonomy prediction for 16S rrna and fungal ITS sequences
Accuracy of taxonomy prediction for 16S rrna and fungal ITS sequences Robert C. Edgar Sonoma, CA, USA ABSTRACT Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rrna) is a fundamental
More informationBacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria
Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria Seminar presentation Pierre Barbera Supervised by:
More informationHandling Fungal data in MoBeDAC
Handling Fungal data in MoBeDAC Jason Stajich UC Riverside Fungal Taxonomy and naming undergoing a revolution One fungus, one name http://www.biology.duke.edu/fungi/ mycolab/primers.htm http://www.biology.duke.edu/fungi/
More informationImpact of training sets on classification of high-throughput bacterial 16s rrna gene surveys
(2012) 6, 94 103 & 2012 International Society for Microbial Ecology All rights reserved 1751-7362/12 www.nature.com/ismej ORIGINAL ARTICLE Impact of training sets on classification of high-throughput bacterial
More informationTitle ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
More informationIntroduction to microbiota data analysis
Introduction to microbiota data analysis Natalie Knox, PhD Head Bacterial Genomics, Bioinformatics Core National Microbiology Laboratory, Public Health Agency of Canada 2 National Microbiology Laboratory
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.
Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure
More informationA Bayesian taxonomic classification method for 16S rrna gene sequences with improved species-level accuracy
Gao et al. BMC Bioinformatics (2017) 18:247 DOI 10.1186/s12859-017-1670-4 SOFTWARE Open Access A Bayesian taxonomic classification method for 16S rrna gene sequences with improved species-level accuracy
More informationPipelining RDP Data to the Taxomatic Background Accomplishments vs objectives
Pipelining RDP Data to the Taxomatic Timothy G. Lilburn, PI/Co-PI George M. Garrity, PI/Co-PI (Collaborative) James R. Cole, Co-PI (Collaborative) Project ID 0010734 Grant No. DE-FG02-04ER63932 Background
More informationMicrobial analysis with STAMP
Microbial analysis with STAMP Conor Meehan cmeehan@itg.be A quick aside on who I am Tangents already! Who I am A postdoc at the Institute of Tropical Medicine in Antwerp, Belgium Mycobacteria evolution
More informationThe Effect of Primer Choice and Short Read Sequences on the Outcome of 16S rrna Gene Based Diversity Studies
The Effect of Primer Choice and Short Read Sequences on the Outcome of 16S rrna Gene Based Diversity Studies Jonas Ghyselinck 1 *., Stefan Pfeiffer 2 *., Kim Heylen 1, Angela Sessitsch 2, Paul De Vos 1
More informationA Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems
A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems Tao Yuan, Asst/Prof. Stephen Tiong-Lee Tay and Dr Volodymyr Ivanov School of Civil and Environmental
More informationAssessing and Improving Methods Used in Operational Taxonomic Unit-Based Approaches for 16S rrna Gene Sequence Analysis
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2011, p. 3219 3226 Vol. 77, No. 10 0099-2240/11/$12.00 doi:10.1128/aem.02810-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Assessing
More informationVocabulary: Fill in the definition for each word. Use your book and/or class notes. You can put the words in your own words. Animalia: Archaea:
Name: _ Due Date: _ Per: _ Unit 4.2 Study Guide Directions: Complete all sections to the best of your ability. On the day of the Quiz (the due date for this assignment) turn this in with all of your Unit
More informationUnit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities.
KEY CONCEPT Organisms can be classified based on physical similarities. Linnaeus developed the scientific naming system still used today. Taxonomy is the science of naming and classifying organisms. White
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationPlant Names and Classification
Plant Names and Classification Science of Taxonomy Identification (necessary!!) Classification (order out of chaos!) Nomenclature (why not use common names?) Reasons NOT to use common names Theophrastus
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationAn Automated Phylogenetic Tree-Based Small Subunit rrna Taxonomy and Alignment Pipeline (STAP)
An Automated Phylogenetic Tree-Based Small Subunit rrna Taxonomy and Alignment Pipeline (STAP) Dongying Wu 1 *, Amber Hartman 1,6, Naomi Ward 4,5, Jonathan A. Eisen 1,2,3 1 UC Davis Genome Center, University
More informationSupplementary Figure 1. Chao 1 richness estimator of microbial OTUs (16S rrna
Supplementary Information Supplementary Figure 1. Chao 1 richness estimator of microbial OTUs (16S rrna gene survey) from skin and hindgut of wild vultures and from feces of zoo birds. Supplementary Note
More informationOther resources. Greengenes (bacterial) Silva (bacteria, archaeal and eukarya)
General QIIME resources http://qiime.org/ Blog (news, updates): http://qiime.wordpress.com/ Support/forum: https://groups.google.com/forum/#!forum/qiimeforum Citing QIIME: Caporaso, J.G. et al., QIIME
More informationOutline. Classification of Living Things
Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics
More informationSupplemental Online Results:
Supplemental Online Results: Functional, phylogenetic, and computational determinants of prediction accuracy using reference genomes A series of tests determined the relationship between PICRUSt s prediction
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationCensusing the Sea in the 21 st Century
Censusing the Sea in the 21 st Century Nancy Knowlton & Matthieu Leray Photo: Ove Hoegh-Guldberg Smithsonian s National Museum of Natural History Estimates of Marine/Reef Species Numbers (Millions) Marine
More informationSUPPLEMENTARY INFORMATION
Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,
More informationMitochondrial Genome Annotation
Protein Genes 1,2 1 Institute of Bioinformatics University of Leipzig 2 Department of Bioinformatics Lebanese University TBI Bled 2015 Outline Introduction Mitochondrial DNA Problem Tools Training Annotation
More informationPrac%cal Bioinforma%cs for Life Scien%sts. Week 14, Lecture 28. István Albert Bioinforma%cs Consul%ng Center Penn State
Prac%cal Bioinforma%cs for Life Scien%sts Week 14, Lecture 28 István Albert Bioinforma%cs Consul%ng Center Penn State Final project A group of researchers are interested in studying protein binding loca%ons
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationAutomating the Quest for Novel Prokaryotic Diversity (Revisited)
Automating the Quest for Novel Prokaryotic Diversity (Revisited) 1,6 George M. Garrity, 5 Timothy G. Lilburn, 1 Scott H. Harrison, 2 Yun Bai, 3 Yuan Zhang, 6 Catherine Lyons and 4,6 James, R. Cole 1 Department
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
More informationBacillus anthracis. Last Lecture: 1. Introduction 2. History 3. Koch s Postulates. 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes
Last Lecture: Bacillus anthracis 1. Introduction 2. History 3. Koch s Postulates Today s Lecture: 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes 3. Phylogenetics I. Basic Cell structure: (Fig.
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationChapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics
Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus
More informationInterpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder
Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder nrpace@colorado.edu Outline What is the Tree of Life? -- Historical Conceptually
More information1. HyperLogLog algorithm
SUPPLEMENTARY INFORMATION FOR KRAKENHLL (BREITWIESER AND SALZBERG, 2018) 1. HyperLogLog algorithm... 1 2. Database building and reanalysis of the patient data (Salzberg, et al., 2016)... 7 3. Enabling
More informationSystems biology. Abstract
Bioinformatics, 31(10), 2015, 1607 1613 doi: 10.1093/bioinformatics/btu855 Advance Access Publication Date: 6 January 2015 Original Paper Systems biology Selection of models for the analysis of risk-factor
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationUnsupervised Learning in Spectral Genome Analysis
Unsupervised Learning in Spectral Genome Analysis Lutz Hamel 1, Neha Nahar 1, Maria S. Poptsova 2, Olga Zhaxybayeva 3, J. Peter Gogarten 2 1 Department of Computer Sciences and Statistics, University of
More informationCentrifuge: rapid and sensitive classification of metagenomic sequences
Centrifuge: rapid and sensitive classification of metagenomic sequences Daehwan Kim, Li Song, Florian P. Breitwieser, and Steven L. Salzberg Supplementary Material Supplementary Table 1 Supplementary Note
More informationMicrobes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng
Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS Elizabeth Tseng Dept. of CSE, University of Washington Johanna Lampe Lab, Fred Hutchinson Cancer
More informationPHYLOGENY & THE TREE OF LIFE
PHYLOGENY & THE TREE OF LIFE PREFACE In this powerpoint we learn how biologists distinguish and categorize the millions of species on earth. Early we looked at the process of evolution here we look at
More informationThe Tree of Life. Chapter 17
The Tree of Life Chapter 17 1 17.1 Taxonomy The science of naming and classifying organisms 2000 years ago Aristotle Grouped plants and animals Based on structural similarities Greeks and Romans included
More informationCH. 18 Classification
CH. 18 Classification Name:_ 1. Biologists use a classification system to group organisms in part because organisms a. are going extinct. b. are very numerous and diverse. c. are too much alike. d. share
More informationInferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT
Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions
More informationBLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010
BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationNaïve Bayesian Classifier for Rapid Assignment of rrna Sequences into the New Bacterial Taxonomy
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2007, p. 5261 5267 Vol. 73, No. 16 0099-2240/07/$08.00 0 doi:10.1128/aem.00062-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Naïve
More informationTaxonomic identification from metagenomic and metabarcoding data using. any genetic marker
biorxiv preprint first posted online Jan. 27, 2018; doi: http://dx.doi.org/10.1101/253377. The copyright holder for this preprint (which was not peer-reviewed) is the author/funder, who has granted biorxiv
More informationBiology 2.1 Taxonomy: Domain, Kingdom, Phylum. ICan2Ed.com
Biology 2.1 Taxonomy: Domain, Kingdom, Phylum ICan2Ed.com Taxonomy is the scientific field that catalogs, describes, and names living organisms. The way to divide living organisms into groups based on
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationSupervised Learning to Predict Geographic Origin of Human Metagenomic Samples
Supervised Learning to Predict Geographic Origin of Human Metagenomic Samples Christopher Malow cmalow@stanford.edu Abstract Metagenomic studies of human fecal samples have used whole genome shotgun sequencing
More informationOutline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity?
Species Divergence and the Measurement of Microbial Diversity Cathy Lozupone University of Colorado, Boulder. Washington University, St Louis. Outline Classes of diversity measures α vs β diversity Quantitative
More information16S Metagenomics Report
Sample: 16S Report Date: 05/11/2015 23:14:11 (UTC) Sample Configuration Sample ID: Sample Name: Run Folder: Taxonomy File: 16S 16S /data/scratch/workspace/runfolder gg_13_5_species_32bp.dat Sample Information
More informationCLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1
CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1 MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 2/13 2/14 - B 2/15 2/16 - B 2/17 2/20 Intro to Viruses Viruses VS Cells 2/21 - B Virus Reproduction Q 1-2 2/22 2/23
More information16S Metagenomics Report
Sample: BL-09 Report Date: 05/11/2017 18:40:20 Sample Information Sample ID: Sample Name: Run Folder: Taxonomy File: BL_09 BL_09 D:\Illumina\MiSeqAnalysis\170509_M01675_0059_000000000-AW8GB gg_13_5_species_32bp.dat
More informationThe Classification of Plants and Other Organisms. Chapter 18
The Classification of Plants and Other Organisms Chapter 18 LEARNING OBJECTIVE 1 Define taxonomy Explain why the assignment of a scientific name to each species is important for biologists KEY TERMS TAXONOMY
More informationobjective functions...
objective functions... COFFEE (Notredame et al. 1998) measures column by column similarity between pairwise and multiple sequence alignments assumes that the pairwise alignments are optimal assumes a set
More informationBackground: Why Is Taxonomy Important?
Background: Why Is Taxonomy Important? Taxonomy is the system of classifying, or organizing, living organisms into a system based on their similarities and differences. Imagine you are a scientist who
More informationClassification and Viruses Practice Test
Classification and Viruses Practice Test Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Biologists use a classification system to group organisms in part
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationChapter 17. Organizing Life's Diversity
Chapter 17 Organizing Life's Diversity Key Concepts: Chapter 17 1. List the six kingdoms. 2. Our current system of classification was originally based on structures; scientists now base classification
More informationProbing diversity in a hidden world: applications of NGS in microbial ecology
Probing diversity in a hidden world: applications of NGS in microbial ecology Guus Roeselers TNO, Microbiology & Systems Biology Group Symposium on Next Generation Sequencing October 21, 2013 Royal Museum
More informationMacroevolution Part I: Phylogenies
Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most
More informationMicrobial Taxonomy and Phylogeny: Extending from rrnas to Genomes
Microbial Taxonomy and Phylogeny: Extending from rrnas to Genomes Dr. Kostas Konstantinidis Department of Civil and Environmental Engineering & Department of Biology (Adjunct), Center for Bioinformatics
More informationBiology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
More informationName: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
More informationStructure, function and host control of rhizosphere microbiome
Structure, function and host control of rhizosphere microbiome Davide Bulgarelli PhD, Microbiome AgBioTech Europe London, September 21st, 2017 Outline The rhizosphere microbiome Barley as a model to study
More informationFuyong Li 1,2, Thomas C. A. Hitch 3, Yanhong Chen 1, Christopher J. Creevey 3 and Le Luo Guan 1*
Li et al. Microbiome (2019) 7:6 https://doi.org/10.1186/s40168-019-0618-5 RESEARCH Open Access Comparative metagenomic and metatranscriptomic analyses reveal the breed effect on the rumen microbiome and
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes
More informationMicrobiology Helmut Pospiech
Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition
More informationClassification of Living Things Test Review
Classification of Living Things Test Review #1 What is taxonomy? a. the scientific study of how living things are classified b. the name of Aristotle s classification system c. the process used by geologists
More information9.3 Classification. Lesson Objectives. Vocabulary. Introduction. Linnaean Classification
9.3 Classification Lesson Objectives Outline the Linnaean classification, and define binomial nomenclature. Describe phylogenetic classification, and explain how it differs from Linnaean classification.
More informationPhylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26
Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,
More informationSUPPLEMENTARY INFORMATION
Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)
More information- conserved in Eukaryotes. - proteins in the cluster have identifiable conserved domains. - human gene should be included in the cluster.
NCBI BLAST Services DELTA-BLAST BLAST (http://blast.ncbi.nlm.nih.gov/), Basic Local Alignment Search tool, is a suite of programs for finding similarities between biological sequences. DELTA-BLAST is a
More informationOutline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer
Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,
More informationTaxonomy and Biodiversity
Chapter 25/26 Taxonomy and Biodiversity Evolutionary biology The major goal of evolutionary biology is to reconstruct the history of life on earth Process: a- natural selection b- mechanisms that change
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationHonor pledge: I have neither given nor received unauthorized aid on this test. Name :
Midterm Exam #1 MB 451 : Microbial Diversity Honor pledge: I have neither given nor received unauthorized aid on this test. Signed : Date : Name : 1. What are the three primary evolutionary branches of
More informationChapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationMicrobial Taxonomy. Classification of living organisms into groups. A group or level of classification
Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think
More informationUnit 9: Taxonomy (Classification) Notes
Name Exam Date Class Unit 9: Taxonomy (Classification) Notes What is Classification? is when we place organisms into based on their. Classification is also known as. Taxonomists are scientists that & organisms
More informationOrganizing Life on Earth
Organizing Life on Earth Inquire: Organizing Life on Earth Overview Scientists continually obtain new information that helps to understand the evolutionary history of life on Earth. Each group of organisms
More informationIstituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program.
Istituto di Microbiologia Università Cattolica del Sacro Cuore, Roma Gut Microbiota assessment and the Meta-HIT program Giovanni Delogu 1 Most of the bacteria species living in the gut cannot be cultivated
More informationa,bD (modules 1 and 10 are required)
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the
More informationBioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
More informationBLAST. Varieties of BLAST
BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database
More information