Microbial analysis with STAMP

Size: px
Start display at page:

Download "Microbial analysis with STAMP"

Transcription

1 Microbial analysis with STAMP Conor Meehan

2 A quick aside on who I am Tangents already!

3 Who I am A postdoc at the Institute of Tropical Medicine in Antwerp, Belgium Mycobacteria evolution and epidemiology Previously postdoc at Dalhousie University, Halifax, Canada Human microbiome (esp. gut and airways) Previously PhD student at NUI Galway, Ireland HIV evolution and drug resistance Biologist trapped in the body of a computer scientist Scripting for speed, not for development

4 What I do/can maybe help with Microbial genetics Pathogen evolution (esp. HIV and Mycobacteria) Phylogenetic reconstruction Lateral gene transfer Microbiome analysis (esp. gut and airway) Protein structure prediction Species concepts in light of the microbiome Knowing which beers to drink at the Kidd Comparing European and North American lifestyles (as I have done both)

5 What data do you have?

6 OTU list Qiime Mothur MG-RAST Pplacer Etc. Function list MG-RAST HUManN KEGG SEED COG/eggNOG PICRUSt Etc. Microbiome datasets

7 PICRUSt?

8 PICRUSt Phylogenetic Investigation of Communities by Reconstruction of Unobserved States Langille MG, Zaneveld J et al. (2013) Predictive functional profiling of microbial communities using 16S rrna marker gene sequences. Nature Biotechnology 31,

9 16S rrna gene QIIME/ MOTHUR Sample 1 Sample 2 Sample 3 OTU OTU OTU Shotgun Metagenomics MG- RAST/ HUMAnN Sample 1 Sample 2 Sample 3 K K K PICRUST CurFs will talk about this in detail on Friday

10 I get it, I have data. Now what? Well, what do you want to know?

11 Potential Questions Differences in abundances between conditions Environmental conditions ph, salinity, etc. Host measurements BMI, age, etc. STAMP Geographical influences Gradients across environmental conditions Composition differences between sites Alpha/Beta diversities GenGIS

12 STAMP (no S = software)

13 STAMP Software that allows for statistical comparison of samples to distinguish ecological influences Parks, DH and Beiko RG (2010). Identifying biologically relevant differences between metagenomic communities. Bioinformatics, 26, Utilises various statistical tests and corrects for multiple sampling Allows for comparisons of individual samples or groups of samples Outputs graphical and tabular lists of OTUs/functions that differ between groups. Primarily used for comparisons between metagenomes, can also compare between genomes (e.g. COG category counts)

14 A quick tutorial (i.e. I do it, you watch, we ll call it interactive learning)

15 Lachnospiraceae sporulation Tutorial dataset Genome analysis suggested that gut-residing Lachnospiraceae undergo sporulation while those in other environments do not. Question was: are there more Lachnospiraceae-related sporulation genes in gut microbiomes than in others? Mapped reads from 3 environments (multiple samples) to sporulationrelated genes in lachnospiraceae genomes Compared environments to see if there is an overabundance in the gut microbiome Part of Meehan CJ & Beiko RG (2014) A phylogenomic view of ecological specialization in the Lachnospiraceae, a family of digestive tract-associated bacteria, Genome Biol Evol. 6(13)

16 STAMP it

17 A quick research example (i.e. I show you what I did with STAMP)

18 An example application Meehan CJ and Beiko RG (2012) Lateral gene transfer of an ABC transporter complex between major constituents of the human gut microbiome, BMC Microbiology 12:248 Dataset: MetaHIT 124 patients Metadata included the BMI of the patient Classed these into low (18-22; 34 samples) and obese (33+; 33 samples) Are there functional differences between the gut microbiomes of these two groups?

19 Functional assignment and abundance comparisons Assembled contigs from metagenomic reads input to Orphelia Predicts ORFs Any <150nt discarded Homology search against IMG genomes using USEARCH Assigns KOs (good example of why you need to learn to script) Dataset input to STAMP to look for differences between low and high BMI groups

20

21 Nickel/peptides transporter Found to be greatest in difference between the low and high BMI groups Contains 5 proteins, 4 of which differed significantly between groups What species are contributing these functions to the microbiome?

22 Species assignments A phylogenetic tree was built for each of the 5 KOs Full length genes extracted from all IMG genomes Aligned with ClustalOmega, trimmed with BMGE, built with FastTree Metagenomic reads assigned to each of the 5 KOs in previous steps were placed on relevant reference tree Pplacer classifies reads in a rank flexible manner Allows for probability cut-off for selecting assignment Integrates the NCBI taxonomy using Taxtastic Faecalibacterium prausnitzii found to be highly associated with all 5 KOs Examine trees for sister taxa Reveals LGT from other residence of gut microbiome Strain differences in operon presence and gene orders

23 Species Operon 1 Operon 2 Operon 3 Operon 4 Operon 5 Operon 6 F. prausnitzii M21/2 F. prausnitzii A2-165 F. cf. prausnitzii KLE1255 F. prausnitzii SL3/ F. prausnitzii L2-6

24 Microbial analysis Can take OTU lists and get estimated KO/SEED categories with PICRUSt Once you have OTU and/or functional tables there is a whole host of analyses that can be done Phylogenetic placements and counts (pplacer) Comparisons between samples (STAMP etc.) Comparisons between environmental factors (STAMP etc.) Geographical influence on compositions (gengis) Lets talk gengis after this short break. Download and install gengis from here: Download the GOS dataset from here: Go to the tutorial page here:

Microbiome: 16S rrna Sequencing 3/30/2018

Microbiome: 16S rrna Sequencing 3/30/2018 Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics

More information

Assigning Taxonomy to Marker Genes. Susan Huse Brown University August 7, 2014

Assigning Taxonomy to Marker Genes. Susan Huse Brown University August 7, 2014 Assigning Taxonomy to Marker Genes Susan Huse Brown University August 7, 2014 In a nutshell Taxonomy is assigned by comparing your DNA sequences against a database of DNA sequences from known taxa Marker

More information

Supervised Learning to Predict Geographic Origin of Human Metagenomic Samples

Supervised Learning to Predict Geographic Origin of Human Metagenomic Samples Supervised Learning to Predict Geographic Origin of Human Metagenomic Samples Christopher Malow cmalow@stanford.edu Abstract Metagenomic studies of human fecal samples have used whole genome shotgun sequencing

More information

Supplemental Online Results:

Supplemental Online Results: Supplemental Online Results: Functional, phylogenetic, and computational determinants of prediction accuracy using reference genomes A series of tests determined the relationship between PICRUSt s prediction

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)

More information

Amplicon Sequencing. Dr. Orla O Sullivan SIRG Research Fellow Teagasc

Amplicon Sequencing. Dr. Orla O Sullivan SIRG Research Fellow Teagasc Amplicon Sequencing Dr. Orla O Sullivan SIRG Research Fellow Teagasc What is Amplicon Sequencing? Sequencing of target genes (are regions of ) obtained by PCR using gene specific primers. Why do we do

More information

Handling Fungal data in MoBeDAC

Handling Fungal data in MoBeDAC Handling Fungal data in MoBeDAC Jason Stajich UC Riverside Fungal Taxonomy and naming undergoing a revolution One fungus, one name http://www.biology.duke.edu/fungi/ mycolab/primers.htm http://www.biology.duke.edu/fungi/

More information

Supplementary Information

Supplementary Information Supplementary Information Altitudinal patterns of diversity and functional traits of metabolically active microorganisms in stream biofilms Linda Wilhelm 1, Katharina Besemer 2, Lena Fragner 3, Hannes

More information

FIG S1: Rarefaction analysis of observed richness within Drosophila. All calculations were

FIG S1: Rarefaction analysis of observed richness within Drosophila. All calculations were Page 1 of 14 FIG S1: Rarefaction analysis of observed richness within Drosophila. All calculations were performed using mothur (2). OTUs were defined at the 3% divergence threshold using the average neighbor

More information

Phylogenomics, Multiple Sequence Alignment, and Metagenomics. Tandy Warnow University of Illinois at Urbana-Champaign

Phylogenomics, Multiple Sequence Alignment, and Metagenomics. Tandy Warnow University of Illinois at Urbana-Champaign Phylogenomics, Multiple Sequence Alignment, and Metagenomics Tandy Warnow University of Illinois at Urbana-Champaign Phylogeny (evolutionary tree) Orangutan Gorilla Chimpanzee Human From the Tree of the

More information

Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses

Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses

More information

Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -

Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information - Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a

More information

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu Microbiota and man: the story about us Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities

More information

MiGA: The Microbial Genome Atlas

MiGA: The Microbial Genome Atlas December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From

More information

Exploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University

Exploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University Exploring Microbes in the Sea Alma Parada Postdoctoral Scholar Stanford University Cruising the ocean to get us some microbes It s all about the Microbe! Microbes = microorganisms an organism that requires

More information

Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng

Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS Elizabeth Tseng Dept. of CSE, University of Washington Johanna Lampe Lab, Fred Hutchinson Cancer

More information

Bioinformatics tools for phylogeny and visualization. Yanbin Yin

Bioinformatics tools for phylogeny and visualization. Yanbin Yin Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and

More information

Using Ensembles of Hidden Markov Models for Grand Challenges in Bioinformatics

Using Ensembles of Hidden Markov Models for Grand Challenges in Bioinformatics Using Ensembles of Hidden Markov Models for Grand Challenges in Bioinformatics Tandy Warnow Founder Professor of Engineering The University of Illinois at Urbana-Champaign http://tandy.cs.illinois.edu

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Other resources. Greengenes (bacterial) Silva (bacteria, archaeal and eukarya)

Other resources. Greengenes (bacterial)  Silva (bacteria, archaeal and eukarya) General QIIME resources http://qiime.org/ Blog (news, updates): http://qiime.wordpress.com/ Support/forum: https://groups.google.com/forum/#!forum/qiimeforum Citing QIIME: Caporaso, J.G. et al., QIIME

More information

Istituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program.

Istituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program. Istituto di Microbiologia Università Cattolica del Sacro Cuore, Roma Gut Microbiota assessment and the Meta-HIT program Giovanni Delogu 1 Most of the bacteria species living in the gut cannot be cultivated

More information

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure

More information

Taxonomical Classification using:

Taxonomical Classification using: Taxonomical Classification using: Extracting ecological signal from noise: introduction to tools for the analysis of NGS data from microbial communities Bergen, April 19-20 2012 INTRODUCTION Taxonomical

More information

Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria

Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria Seminar presentation Pierre Barbera Supervised by:

More information

Taxonomy and Clustering of SSU rrna Tags. Susan Huse Josephine Bay Paul Center August 5, 2013

Taxonomy and Clustering of SSU rrna Tags. Susan Huse Josephine Bay Paul Center August 5, 2013 Taxonomy and Clustering of SSU rrna Tags Susan Huse Josephine Bay Paul Center August 5, 2013 Primary Methods of Taxonomic Assignment Bayesian Kmer Matching RDP http://rdp.cme.msu.edu Wang, et al (2007)

More information

Programme Specification (Undergraduate) For 2017/18 entry Date amended: 25/06/18

Programme Specification (Undergraduate) For 2017/18 entry Date amended: 25/06/18 Programme Specification (Undergraduate) For 2017/18 entry Date amended: 25/06/18 1. Programme title(s) and UCAS code(s): BSc Biological Sciences C100 BSc Biological Sciences (Biochemistry) C700 BSc Biological

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi) Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to

More information

Supplementary Information

Supplementary Information Supplementary Information Table S1. Per-sample sequences, observed OTUs, richness estimates, diversity indices and coverage. Samples codes as follows: YED (Young leaves Endophytes), MED (Mature leaves

More information

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:

More information

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of

More information

Undergraduate Curriculum in Biology

Undergraduate Curriculum in Biology Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles

More information

BIOL 101 Introduction to Biological Research Techniques I

BIOL 101 Introduction to Biological Research Techniques I BIOL 101 Introduction to Biological Research Techniques I 1. Develop a research plan including hypothesis, controls and procedures. 2. Conduct a primary literature review relating to their research project.

More information

Introduction to Biology with Lab

Introduction to Biology with Lab Introduction to Biology with Lab Course Text/Materials Mader, Sylvia S. Inquiry into Life, 12th edition, McGraw-Hill, 2008, ISBN: 9780073309330 [find and buy the text: Straighterline.com/textbooks] Custom

More information

Introduction to Evolutionary Concepts

Introduction to Evolutionary Concepts Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource

Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource Sharpton et al. BMC Bioinformatics 2012, 13:264 RESEARCH ARTICLE Open Access Sifting through genomes with iterative-sequence clustering produces a large, phylogenetically diverse protein-family resource

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)

More information

Potential of metatranscriptomics as indicator for ecosystem level diversity and function. diversitv Prof. Dr. Jens Boenigk. Department.

Potential of metatranscriptomics as indicator for ecosystem level diversity and function. diversitv Prof. Dr. Jens Boenigk. Department. Department Bio diversitv Prof. Dr. Jens Boenigk From traditional bioindication......via metabarcoding & molecular diversity......to monitoring functional genes From traditional bioindication......via metabarcoding

More information

Chapter 19 Organizing Information About Species: Taxonomy and Cladistics

Chapter 19 Organizing Information About Species: Taxonomy and Cladistics Chapter 19 Organizing Information About Species: Taxonomy and Cladistics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics

More information

Exploring environmental genetic diversity with similarity networks

Exploring environmental genetic diversity with similarity networks Exploring environmental genetic diversity with similarity networks Philippe Lopez UMR CNRS 7138 Evolution Paris Seine Université Pierre et Marie Curie Paris, France Why look at environmental data? Great

More information

Outline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity?

Outline Classes of diversity measures. Species Divergence and the Measurement of Microbial Diversity. How do we describe and compare diversity? Species Divergence and the Measurement of Microbial Diversity Cathy Lozupone University of Colorado, Boulder. Washington University, St Louis. Outline Classes of diversity measures α vs β diversity Quantitative

More information

Chapters AP Biology Objectives. Objectives: You should know...

Chapters AP Biology Objectives. Objectives: You should know... Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.

More information

The Prokaryotic World

The Prokaryotic World The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,

More information

BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B

BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B BIOL 1010 Introduction to Biology: The Evolution and Diversity of Life. Spring 2011 Sections A & B Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 ʻTree of Life,ʼ ʻprimitive,ʼ ʻprogressʼ

More information

Compositional data methods for microbiome studies

Compositional data methods for microbiome studies Compositional data methods for microbiome studies M.Luz Calle Dept. of Biosciences, UVic-UCC http://mon.uvic.cat/bms/ http://mon.uvic.cat/master-omics/ 1 Important role of the microbiome in human health

More information

BIOINFORMATICS LAB AP BIOLOGY

BIOINFORMATICS LAB AP BIOLOGY BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to

More information

Robert Edgar. Independent scientist

Robert Edgar. Independent scientist Robert Edgar Independent scientist robert@drive5.com www.drive5.com "Bacterial taxonomy is a hornets nest that no one, really, wants to get into." Referee #1, UTAX paper Assume prokaryotic species meaningful

More information

Outline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer

Outline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,

More information

Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST

Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and

More information

The problem Lineage model Examples. The lineage model

The problem Lineage model Examples. The lineage model The lineage model A Bayesian approach to inferring community structure and evolutionary history from whole-genome metagenomic data Jack O Brien Bowdoin College with Daniel Falush and Xavier Didelot Cambridge,

More information

Lowndes County Biology II Pacing Guide Approximate

Lowndes County Biology II Pacing Guide Approximate Lowndes County Biology II Pacing Guide 2009-2010 MS Frameworks Pacing Guide Worksheet Grade Level: Biology II Grading Period: 1 st 9 weeks Chapter/Unit Lesson Topic Objective Number 1 The Process of 1.

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus

More information

arxiv: v1 [q-bio.pe] 7 Jul 2014

arxiv: v1 [q-bio.pe] 7 Jul 2014 PHYLOGENETICS AND THE HUMAN MICROBIOME. FREDERICK A. MATSEN IV arxiv:1407.1794v1 [q-bio.pe] 7 Jul 2014 ABSTRACT. The human microbiome is the ensemble of genes in the microbes that live inside and on the

More information

Supporting Information

Supporting Information Supporting Information Ziemert et al. 10.1073/pnas.1324161111 Fig. S1. Geographic origin and numbers of Salinispora strains used in this study. Fig. S2. Operational biosynthetic unit (OBU) phylogeny supports

More information

Bioinformatics Exercises

Bioinformatics Exercises Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted

More information

Comparative Bioinformatics Midterm II Fall 2004

Comparative Bioinformatics Midterm II Fall 2004 Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans

More information

A Bayesian taxonomic classification method for 16S rrna gene sequences with improved species-level accuracy

A Bayesian taxonomic classification method for 16S rrna gene sequences with improved species-level accuracy Gao et al. BMC Bioinformatics (2017) 18:247 DOI 10.1186/s12859-017-1670-4 SOFTWARE Open Access A Bayesian taxonomic classification method for 16S rrna gene sequences with improved species-level accuracy

More information

Introduction to de novo RNA-seq assembly

Introduction to de novo RNA-seq assembly Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies

More information

Genômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal

Genômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal Genômica comparativa João Carlos Setubal IQ-USP outubro 2012 11/5/2012 J. C. Setubal 1 Comparative genomics There are currently (out/2012) 2,230 completed sequenced microbial genomes publicly available

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Structure, function and host control of rhizosphere microbiome

Structure, function and host control of rhizosphere microbiome Structure, function and host control of rhizosphere microbiome Davide Bulgarelli PhD, Microbiome AgBioTech Europe London, September 21st, 2017 Outline The rhizosphere microbiome Barley as a model to study

More information

Single-cell genomics applied to the picobiliphytes using next-generation sequencing

Single-cell genomics applied to the picobiliphytes using next-generation sequencing Department of Ecology, Evolution and Natural Resources and Institute of Marine and Coastal Sciences Rutgers University, NJ 08901 Single-cell genomics applied to the picobiliphytes using next-generation

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

AP Environmental Science I. Unit 1-2: Biodiversity & Evolution

AP Environmental Science I. Unit 1-2: Biodiversity & Evolution NOTE/STUDY GUIDE: Unit 1-2, Biodiversity & Evolution AP Environmental Science I, Mr. Doc Miller, M.Ed. North Central High School Name: ID#: NORTH CENTRAL HIGH SCHOOL NOTE & STUDY GUIDE AP Environmental

More information

SPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together

SPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together SPECIATION Origin of new species=speciation -Process by which one species splits into two or more species, accounts for both the unity and diversity of life SPECIES BIOLOGICAL CONCEPT Population or groups

More information

Open projects for BSc & MSc

Open projects for BSc & MSc Next Generation Sequencing New sequencing technologies enable biologists to obtain complete genome and New sequencing technologies enable biologists to obtain complete transcriptome data of non-model organisms.

More information

Probing diversity in a hidden world: applications of NGS in microbial ecology

Probing diversity in a hidden world: applications of NGS in microbial ecology Probing diversity in a hidden world: applications of NGS in microbial ecology Guus Roeselers TNO, Microbiology & Systems Biology Group Symposium on Next Generation Sequencing October 21, 2013 Royal Museum

More information

The practice of naming and classifying organisms is called taxonomy.

The practice of naming and classifying organisms is called taxonomy. Chapter 18 Key Idea: Biologists use taxonomic systems to organize their knowledge of organisms. These systems attempt to provide consistent ways to name and categorize organisms. The practice of naming

More information

Supplementary Information

Supplementary Information Supplementary Information 1 List of Figures 1 Models of circular chromosomes. 2 Distribution of distances between core genes in Escherichia coli K12, arc based model. 3 Distribution of distances between

More information

Molecular Genetics for Aquatic and Marine Biodiversity Conservation

Molecular Genetics for Aquatic and Marine Biodiversity Conservation Molecular Genetics for Aquatic and Marine Biodiversity Conservation Course Code: 176040H01... Overview In a wider standpoint, conservation genetics uses a combination of ecology, molecular biology, population

More information

Using Topological Data Analysis to find discrimination between microbial states in human microbiome data

Using Topological Data Analysis to find discrimination between microbial states in human microbiome data Using Topological Data Analysis to find discrimination between microbial states in human microbiome data Mehrdad Yazdani 1,2, Larry Smarr 1,3 and Rob Knight 4 1 California Institute for Telecommunications

More information

Curriculum Links. AQA GCE Biology. AS level

Curriculum Links. AQA GCE Biology. AS level Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2

More information

Bio 119 Bacterial Genomics 6/26/10

Bio 119 Bacterial Genomics 6/26/10 BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis

More information

Phylogenetics and the Human Microbiome

Phylogenetics and the Human Microbiome Systematic Biology Advance Access published September 24, 2014 Syst. Biol. 0(0):1 16, 2014 The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All

More information

Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity

Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Microbial DNA qpcr Multi-Assay Kit Clostridium perfringens Pathogenicity Cat. no. 330043 BBID-1507ZR-3 For real-time PCR-based, application-specific microbial identification or profiling The Clostridium

More information

Homology Modeling. Roberto Lins EPFL - summer semester 2005

Homology Modeling. Roberto Lins EPFL - summer semester 2005 Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton,

More information

Introduction to Biology Web Course Informational and Test Schedule

Introduction to Biology Web Course Informational and Test Schedule Introduction to Biology Web Course Informational and Test Schedule Spring 2011 Inquiry into Life by Sylvia Mader Introduction to Biological Science (BIO1100AAW1 & 2) Three Hours Credit Nancy Petersen Brian

More information

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,

More information

1. HyperLogLog algorithm

1. HyperLogLog algorithm SUPPLEMENTARY INFORMATION FOR KRAKENHLL (BREITWIESER AND SALZBERG, 2018) 1. HyperLogLog algorithm... 1 2. Database building and reanalysis of the patient data (Salzberg, et al., 2016)... 7 3. Enabling

More information

Approved Courses for General Science students with Major/Minors in Biological Sciences

Approved Courses for General Science students with Major/Minors in Biological Sciences Approved Courses for General Science students with Major/Minors in Biological Sciences List C: Physiology, cell and developmental biology BIOIN 301 Bioinformatics. * (fi 6) (first term, 3-0-0). Introduction

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

Undergraduate Curriculum in Biology

Undergraduate Curriculum in Biology Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles

More information

Postgraduate teaching for the next generation of taxonomists

Postgraduate teaching for the next generation of taxonomists Postgraduate teaching for the next generation of taxonomists Alfried P. Vogler Professor of Molecular Systematics Imperial College London and Natural History Museum MSc in Taxonomy and Biodiversity MRes

More information

Evolutionary Genetics: Part 0.2 Introduction to Population genetics

Evolutionary Genetics: Part 0.2 Introduction to Population genetics Evolutionary Genetics: Part 0.2 Introduction to Population genetics S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Population genetics Evolution = changes

More information

Graduate Funding Information Center

Graduate Funding Information Center Graduate Funding Information Center UNC-Chapel Hill, The Graduate School Graduate Student Proposal Sponsor: Program Title: NESCent Graduate Fellowship Department: Biology Funding Type: Fellowship Year:

More information

Outline. Classification of Living Things

Outline. Classification of Living Things Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics

More information

Molecular Biology Of The Cell 6th Edition Alberts

Molecular Biology Of The Cell 6th Edition Alberts We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with molecular biology of

More information

Studying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life

Studying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life Lesson Overview 1.3 Characteristics of Living Things What characteristics do all living things share? Living things are made up of basic units called cells, are based on a universal genetic code, obtain

More information

EASTERN ARIZONA COLLEGE Biology Concepts

EASTERN ARIZONA COLLEGE Biology Concepts EASTERN ARIZONA COLLEGE Biology Concepts Course Design 2017-2018 Course Information Division Science Course Number BIO 100 Title Biology Concepts Credits 4 Developed by Michael McCarthy Lecture/Lab Ratio

More information

CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1

CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1 CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1 MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 2/13 2/14 - B 2/15 2/16 - B 2/17 2/20 Intro to Viruses Viruses VS Cells 2/21 - B Virus Reproduction Q 1-2 2/22 2/23

More information

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions

More information

Chapter 19. Microbial Taxonomy

Chapter 19. Microbial Taxonomy Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION City of origin as a confounding variable. The original study was designed such that the city where sampling was performed was perfectly confounded with where the DNA extractions and sequencing was performed.

More information

Cluster Analysis of Gene Expression Microarray Data. BIOL 495S/ CS 490B/ MATH 490B/ STAT 490B Introduction to Bioinformatics April 8, 2002

Cluster Analysis of Gene Expression Microarray Data. BIOL 495S/ CS 490B/ MATH 490B/ STAT 490B Introduction to Bioinformatics April 8, 2002 Cluster Analysis of Gene Expression Microarray Data BIOL 495S/ CS 490B/ MATH 490B/ STAT 490B Introduction to Bioinformatics April 8, 2002 1 Data representations Data are relative measurements log 2 ( red

More information