Homology Modeling. Roberto Lins EPFL - summer semester 2005

Size: px
Start display at page:

Download "Homology Modeling. Roberto Lins EPFL - summer semester 2005"

Transcription

1 Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton, Bioinformatics, genes, protein & computers; A.M. Lesk, Introduction to Bioinformatics; A.D. Baxevanis & B.F. Ouellette, Bioinformatics, a practical guide to the analysis of genes and proteins; several online materials (George Washington University, University of Houston, Tel-Aviv University) and resources (RCSB, NCBI, SWISS-PROT) as well as personal research data.

2 Functional Genomics Genome Expressome algorithm algorithm database database Proteome database algorithm TERTIARY STRUCTURE (fold) TERTIARY STRUCTURE (fold) Metabolome algorithm database

3 Limitations of Experimental Methods Annotated proteins in the databank: ~ 100,000 Total number including ORFs: ~ 700,000 Proteins with known structure: ~5,000! Dataset for analysis ORF, or Open Reading Frame, is a region of genome that codes for a protein Have been identified by whole genome sequencing efforts ORFs with no known function are termed orphan

4 Structural Biology Consortia: Brute Force Approach Towards Structure Elucidation * Aim to solve about 400 structures a year Employment of a Ph.Ds & Postdocs army Large-scale expression & crystallization attempts Basic strategies remain the same No (known) new tricks Unrelenting ones will be ignored + Enhances the statistical base for inferring sequence structure relationships

5 Can we predict structure from sequence? GCTCCTCACTGTCTGTGTTTATTC TTTTAGCTTCTTCAGATCTTTTAG TCTGAGGAAGCCTGGCATGTGCA AATGAAGTTAACCTAA...

6 Comparative Modeling (Homology Modeling) Basis Structure is much more conserved than sequence during evolution Higher the similarity, higher is the confidence in the modeled structure Limited applicability A large number of proteins and ORFs have no similarity to proteins with known structure

7 What s homology modeling? Predicts the three-dimensional structure of a given protein sequence (target) based on an alignment to one or more known protein structures (templates). If similarity between the target sequence and the template sequence is detected, structural similarity can be assumed. In general, 30% sequence identity is required to generate an useful model. It can be used to understand function, activity, specificity, etc. It is of interest to drug companies wishing to do structure-aided drug design A keystone of structural proteomics

8 Homology modeling - applications Structure-based assessment of target drugability Structure-guided design of mutagenesis experiments Tool compound design for probing biological function Homology model based ligand design Design of in vitro test assays Structure-based prediction of drug metabolism and toxicity

9 Accuracy and application of protein structure

10 Does sequence similarity implies structure similarity? Safe zone (thanks to evolution!) Twilight zone

11 2.5 Chotia & Lesk, 1986 RMSD of backbone atoms (Ǻ) RMSD Natoms! i= 1 = d 2 i Natoms % identical residues in core Natoms = total number of atoms; d i = distance between the coordinates of an atom i at t 0 and t n, when the structures are superimposed.

12 My target sequence has over 30% sequence identity with a known protein structure, so I want to generate a 3D model. What do I have to do?

13 Structure prediction by homology modeling

14 Homology modeling makes two fundamental assumptions The structure of a protein is determined by its primary amino acid sequence (Anfinsen). During evolution, the structure of protein a has changed much slower than its sequence. Similar sequences adopt identical structures and distantly related sequences fold into similar structures.

15 In summary: homology modeling steps 1) Template recognition & initial alignment 2) Alignment correction 3) Backbone generation 4) Loop modeling 5) Side-chain modeling 6) Model optimization 7) Model validation

16 Template recognition & initial alignment Select the best template from a library of known protein structures derived from the PDB Templates can be found using the target sequence as a query for searching using FASTA or BLAST

17 Gaining confidence in template searching Once a suitable template is found, a literature search on the relevant fold can determine what biological role it plays Does this match the biological/biochemical function that you expect? Ligand(s) present? Resolution of the template Family of Proteins Multiple templates?

18 Further Considerations: Proteins are homologous if they are related by divergence from a common ancestor duplication Function may be related or very different! paralogues speciation orthologues species 1 species 2 Function more likely to be conserved

19 In summary: there are two types of homologous - Orthologs: proteins that carry out the same function in different species -Paralogs: proteins that perform different, but related functions within one organism

20 Alignment of the target onto the template Correct alignment is necessary to create the most probable 3D structure of the target If sequences aligns incorrectly, it will result in false positive or negative results Important to consider: - algorithms - scoring alignments - gap penalties Identity SCRs (Structure Conserved Regions and SVRs (Structure Variable Regions)

21 Alignment Outcome The (true) alignment indicates the evolutionary process giving rise to the different sequences starting from the same ancestor sequence and then changing through mutations (insertions, deletions, and substitutions)

22 Alignment vs. databases Task: given a query sequence and millions of database records, find the optimal alignment between the query and a record AGTCTCCAGTTATGCCA

23 Alignment vs. databases Tool: given two sequences, there exists an algorithm to find the best alignment. Naïve solution: apply algorithm to each of the records, one by one. Problem: an exact algorithm is just too slow to run millions of times (even linear time algorithm will run slowly on a huge database). Solution: - run in parallel (expensive) - use of a fast (heuristic) method to discard irrelevant records and the apply the exact algorithm to the remaining few

24 Sequence alignment algorithms Used to calculate a similarity score to infer sequence homology between two sequences Examples: the two most used in homology modeling are: BLAST: General strategy is to optimise the maximal segment pair (MSP) score - BLAST computes similarity, not alignment (Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J., J. Mol. Biol. (1990) 215: ) FastA (local alignment): searches for both full and partial sequence matches, i.e., local similarity obtained; more sensitive than BLAST, but slower; many gaps may represent a problem (Pearson, W. R., Lipman, D. J., P.N.A.S. (1988) 85: ).

25 BLAST FastA Sequence alignment outputs

26 Alignment corrections Alignments are scored (substitution score) in order to define similarity between 2 aa residues in the sequences A substitutions score is calculated for each aligned pair of letters. Substitution matrices: - reflect the true probabilities of mutations occurring through a period of evolution - PAM family: based on global aligments of closely related proteins. Mutation probability matrix. - BLOSUM family: based on observed alignments, no extrapolation of sequences that are related.

27 Gap Penalties Gap is one or more empty spaces in one sequence aligned with letters in the other sequence These empty spaces may or may not be treated as penalties: - higher penalty score is assigned for the first missing aa then the subsequent ones; it considers the fact that each mutational event can insert or delete many residues at a time

28 Gap Penalties

29 Gap Penalties Insertion/deletion of structural domains can easily be done at loop sites N C

30 Gap Penalties The overall alignment score is the sum of similarity and gap scores: the higher the overall alignment score, the better the alignment (more conserved)

31 Corrections by hand may still be needed!

32 Multiple Sequence Alignments Multiple nucleotide or amino sequence alignment techniques are usually performed to fit one of the following scopes : -to characterize protein families, identify shared regions of homology in a multiple sequence alignment; (this happens generally when a sequence search revealed homologies to several sequences) ; -to determine the consensus sequence of several aligned sequences; -to help prediction of the secondary and tertiary structures of new sequences; - preliminary step in molecular evolution analysis using Phylogenetic methods for constructing phylogenetic trees.

33

34 Backbone generation Uses known structurally conserved regions to generate coordinates for the unknown For SCRs - copy coordinates from known structures For variable regions (VR) - copy from known structure, if the residue types are similar; otherwise, use databases for fragtmented loop sequences.

35 Backbone generation Template-based fragment assembly a) Find structurally conserved regions b) build model core

36 Loop modeling

37 Loop modeling 1. Database search for segments from known protein structures fitting fixed end-points 2. Molecular mechanics/molecular dynamics 3. Combination of 1+2

38 Loop modeling Ab initio rebuilding (e.g., Monte Carlo, MD, etc) to build missing loops

39 Side chain modeling 1. Use of rotamer libraries (backbone dependent) 2. Molecular mechanics optimization - Dead-end elimination (heuristic) - Monte Carlo (heuristic) - Branch & Bound (exact) 3. Mean-field methods

40 Model optimization Molecular mechanics methods Model validation/evaluation Model should be evaluated for: - correctness of the overall fold/structure - errors over localized regions - stereochemical parameters: bond lengths, angles, etc Some softwares for model verification: - Procheck -WHAT IF -PROSA II -Profile 3D & Verify 3D

41 Model validation/evaluation The Ramachandran plot

42 Model validation/evaluation

43 Model validation/evaluation Profile 3D & Verify 3D: -verify newly solved structures or homology models -find structures/folds compatible with a given sequence -find sequences compatible with known structure/fold from a database of sequences

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded

More information

Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment

Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot

More information

Week 10: Homology Modelling (II) - HHpred

Week 10: Homology Modelling (II) - HHpred Week 10: Homology Modelling (II) - HHpred Course: Tools for Structural Biology Fabian Glaser BKU - Technion 1 2 Identify and align related structures by sequence methods is not an easy task All comparative

More information

Molecular Modeling. Prediction of Protein 3D Structure from Sequence. Vimalkumar Velayudhan. May 21, 2007

Molecular Modeling. Prediction of Protein 3D Structure from Sequence. Vimalkumar Velayudhan. May 21, 2007 Molecular Modeling Prediction of Protein 3D Structure from Sequence Vimalkumar Velayudhan Jain Institute of Vocational and Advanced Studies May 21, 2007 Vimalkumar Velayudhan Molecular Modeling 1/23 Outline

More information

Sequence Alignment: A General Overview. COMP Fall 2010 Luay Nakhleh, Rice University

Sequence Alignment: A General Overview. COMP Fall 2010 Luay Nakhleh, Rice University Sequence Alignment: A General Overview COMP 571 - Fall 2010 Luay Nakhleh, Rice University Life through Evolution All living organisms are related to each other through evolution This means: any pair of

More information

BLAST. Varieties of BLAST

BLAST. Varieties of BLAST BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database

More information

THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types

THEORY. Based on sequence Length According to the length of sequence being compared it is of following two types Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between

More information

Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment

Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment Introduction to Bioinformatics online course : IBT Jonathan Kayondo Learning Objectives Understand

More information

Basic Local Alignment Search Tool

Basic Local Alignment Search Tool Basic Local Alignment Search Tool Alignments used to uncover homologies between sequences combined with phylogenetic studies o can determine orthologous and paralogous relationships Local Alignment uses

More information

In-Depth Assessment of Local Sequence Alignment

In-Depth Assessment of Local Sequence Alignment 2012 International Conference on Environment Science and Engieering IPCBEE vol.3 2(2012) (2012)IACSIT Press, Singapoore In-Depth Assessment of Local Sequence Alignment Atoosa Ghahremani and Mahmood A.

More information

Single alignment: Substitution Matrix. 16 march 2017

Single alignment: Substitution Matrix. 16 march 2017 Single alignment: Substitution Matrix 16 march 2017 BLOSUM Matrix BLOSUM Matrix [2] (Blocks Amino Acid Substitution Matrices ) It is based on the amino acids substitutions observed in ~2000 conserved block

More information

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling. Chapter 4 Part I Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

More information

Sequence Alignment Techniques and Their Uses

Sequence Alignment Techniques and Their Uses Sequence Alignment Techniques and Their Uses Sarah Fiorentino Since rapid sequencing technology and whole genomes sequencing, the amount of sequence information has grown exponentially. With all of this

More information

Sequence analysis and comparison

Sequence analysis and comparison The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species

More information

BIOINFORMATICS: An Introduction

BIOINFORMATICS: An Introduction BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and

More information

Chapter 5. Proteomics and the analysis of protein sequence Ⅱ

Chapter 5. Proteomics and the analysis of protein sequence Ⅱ Proteomics Chapter 5. Proteomics and the analysis of protein sequence Ⅱ 1 Pairwise similarity searching (1) Figure 5.5: manual alignment One of the amino acids in the top sequence has no equivalent and

More information

BLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010

BLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010 BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for

More information

A profile-based protein sequence alignment algorithm for a domain clustering database

A profile-based protein sequence alignment algorithm for a domain clustering database A profile-based protein sequence alignment algorithm for a domain clustering database Lin Xu,2 Fa Zhang and Zhiyong Liu 3, Key Laboratory of Computer System and architecture, the Institute of Computing

More information

Pairwise & Multiple sequence alignments

Pairwise & Multiple sequence alignments Pairwise & Multiple sequence alignments Urmila Kulkarni-Kale Bioinformatics Centre 411 007 urmila@bioinfo.ernet.in Basis for Sequence comparison Theory of evolution: gene sequences have evolved/derived

More information

Modeling for 3D structure prediction

Modeling for 3D structure prediction Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing

More information

Protein Structure Prediction, Engineering & Design CHEM 430

Protein Structure Prediction, Engineering & Design CHEM 430 Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment

More information

CISC 889 Bioinformatics (Spring 2004) Sequence pairwise alignment (I)

CISC 889 Bioinformatics (Spring 2004) Sequence pairwise alignment (I) CISC 889 Bioinformatics (Spring 2004) Sequence pairwise alignment (I) Contents Alignment algorithms Needleman-Wunsch (global alignment) Smith-Waterman (local alignment) Heuristic algorithms FASTA BLAST

More information

Introduction to protein alignments

Introduction to protein alignments Introduction to protein alignments Comparative Analysis of Proteins Experimental evidence from one or more proteins can be used to infer function of related protein(s). Gene A Gene X Protein A compare

More information

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Jianlin Cheng, PhD Department of Computer Science Informatics Institute 2011 Topics Introduction Biological Sequence Alignment and Database Search Analysis of gene expression

More information

Sequence Alignments. Dynamic programming approaches, scoring, and significance. Lucy Skrabanek ICB, WMC January 31, 2013

Sequence Alignments. Dynamic programming approaches, scoring, and significance. Lucy Skrabanek ICB, WMC January 31, 2013 Sequence Alignments Dynamic programming approaches, scoring, and significance Lucy Skrabanek ICB, WMC January 31, 213 Sequence alignment Compare two (or more) sequences to: Find regions of conservation

More information

Alignment principles and homology searching using (PSI-)BLAST. Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU)

Alignment principles and homology searching using (PSI-)BLAST. Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) Alignment principles and homology searching using (PSI-)BLAST Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) http://ibivu.cs.vu.nl Bioinformatics Nothing in Biology makes sense except in

More information

Bioinformatics (GLOBEX, Summer 2015) Pairwise sequence alignment

Bioinformatics (GLOBEX, Summer 2015) Pairwise sequence alignment Bioinformatics (GLOBEX, Summer 2015) Pairwise sequence alignment Substitution score matrices, PAM, BLOSUM Needleman-Wunsch algorithm (Global) Smith-Waterman algorithm (Local) BLAST (local, heuristic) E-value

More information

Protein Modeling Methods. Knowledge. Protein Modeling Methods. Fold Recognition. Knowledge-based methods. Introduction to Bioinformatics

Protein Modeling Methods. Knowledge. Protein Modeling Methods. Fold Recognition. Knowledge-based methods. Introduction to Bioinformatics Protein Modeling Methods Introduction to Bioinformatics Iosif Vaisman Ab initio methods Energy-based methods Knowledge-based methods Email: ivaisman@gmu.edu Protein Modeling Methods Ab initio methods:

More information

Sara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)

Sara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline

More information

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture

More information

3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT

3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT 3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT.03.239 25.09.2012 SEQUENCE ANALYSIS IS IMPORTANT FOR... Prediction of function Gene finding the process of identifying the regions of genomic DNA that encode

More information

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics. Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond

More information

Tools and Algorithms in Bioinformatics

Tools and Algorithms in Bioinformatics Tools and Algorithms in Bioinformatics GCBA815, Fall 2015 Week-4 BLAST Algorithm Continued Multiple Sequence Alignment Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and

More information

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major

More information

Biochemistry 324 Bioinformatics. Pairwise sequence alignment

Biochemistry 324 Bioinformatics. Pairwise sequence alignment Biochemistry 324 Bioinformatics Pairwise sequence alignment How do we compare genes/proteins? When we have sequenced a genome, we try and identify the function of unknown genes by finding a similar gene

More information

Quantifying sequence similarity

Quantifying sequence similarity Quantifying sequence similarity Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 16 th 2016 After this lecture, you can define homology, similarity, and identity

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, May 2,

Grundlagen der Bioinformatik, SS 08, D. Huson, May 2, Grundlagen der Bioinformatik, SS 08, D. Huson, May 2, 2008 39 5 Blast This lecture is based on the following, which are all recommended reading: R. Merkl, S. Waack: Bioinformatik Interaktiv. Chapter 11.4-11.7

More information

An Introduction to Sequence Similarity ( Homology ) Searching

An Introduction to Sequence Similarity ( Homology ) Searching An Introduction to Sequence Similarity ( Homology ) Searching Gary D. Stormo 1 UNIT 3.1 1 Washington University, School of Medicine, St. Louis, Missouri ABSTRACT Homologous sequences usually have the same,

More information

Building 3D models of proteins

Building 3D models of proteins Building 3D models of proteins Why make a structural model for your protein? The structure can provide clues to the function through structural similarity with other proteins With a structure it is easier

More information

Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program)

Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program) Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program) Course Name: Structural Bioinformatics Course Description: Instructor: This course introduces fundamental concepts and methods for structural

More information

Molecular Modeling Lecture 7. Homology modeling insertions/deletions manual realignment

Molecular Modeling Lecture 7. Homology modeling insertions/deletions manual realignment Molecular Modeling 2018-- Lecture 7 Homology modeling insertions/deletions manual realignment Homology modeling also called comparative modeling Sequences that have similar sequence have similar structure.

More information

Homology and Information Gathering and Domain Annotation for Proteins

Homology and Information Gathering and Domain Annotation for Proteins Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The

More information

09/06/25. Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Non-uniform distribution of folds. Scheme of protein structure predicition

09/06/25. Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Non-uniform distribution of folds. Scheme of protein structure predicition Sequence identity Structural similarity Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Fold recognition Sommersemester 2009 Peter Güntert Structural similarity X Sequence identity Non-uniform

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction CMPS 6630: Introduction to Computational Biology and Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the

More information

Homology. and. Information Gathering and Domain Annotation for Proteins

Homology. and. Information Gathering and Domain Annotation for Proteins Homology and Information Gathering and Domain Annotation for Proteins Outline WHAT IS HOMOLOGY? HOW TO GATHER KNOWN PROTEIN INFORMATION? HOW TO ANNOTATE PROTEIN DOMAINS? EXAMPLES AND EXERCISES Homology

More information

Computational Biology

Computational Biology Computational Biology Lecture 6 31 October 2004 1 Overview Scoring matrices (Thanks to Shannon McWeeney) BLAST algorithm Start sequence alignment 2 1 What is a homologous sequence? A homologous sequence,

More information

Bioinformatics. Scoring Matrices. David Gilbert Bioinformatics Research Centre

Bioinformatics. Scoring Matrices. David Gilbert Bioinformatics Research Centre Bioinformatics Scoring Matrices David Gilbert Bioinformatics Research Centre www.brc.dcs.gla.ac.uk Department of Computing Science, University of Glasgow Learning Objectives To explain the requirement

More information

Research Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family.

Research Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Research Proposal Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Name: Minjal Pancholi Howard University Washington, DC. June 19, 2009 Research

More information

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments

More information

Optimization of a New Score Function for the Detection of Remote Homologs

Optimization of a New Score Function for the Detection of Remote Homologs PROTEINS: Structure, Function, and Genetics 41:498 503 (2000) Optimization of a New Score Function for the Detection of Remote Homologs Maricel Kann, 1 Bin Qian, 2 and Richard A. Goldstein 1,2 * 1 Department

More information

CMPS 3110: Bioinformatics. Tertiary Structure Prediction

CMPS 3110: Bioinformatics. Tertiary Structure Prediction CMPS 3110: Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the laws of physics! Conformation space is finite

More information

CONCEPT OF SEQUENCE COMPARISON. Natapol Pornputtapong 18 January 2018

CONCEPT OF SEQUENCE COMPARISON. Natapol Pornputtapong 18 January 2018 CONCEPT OF SEQUENCE COMPARISON Natapol Pornputtapong 18 January 2018 SEQUENCE ANALYSIS - A ROSETTA STONE OF LIFE Sequence analysis is the process of subjecting a DNA, RNA or peptide sequence to any of

More information

Large-Scale Genomic Surveys

Large-Scale Genomic Surveys Bioinformatics Subtopics Fold Recognition Secondary Structure Prediction Docking & Drug Design Protein Geometry Protein Flexibility Homology Modeling Sequence Alignment Structure Classification Gene Prediction

More information

Ch. 9 Multiple Sequence Alignment (MSA)

Ch. 9 Multiple Sequence Alignment (MSA) Ch. 9 Multiple Sequence Alignment (MSA) - gather seqs. to make MSA - doing MSA with ClustalW - doing MSA with Tcoffee - comparing seqs. that cannot align Introduction - from pairwise alignment to MSA -

More information

Local Alignment Statistics

Local Alignment Statistics Local Alignment Statistics Stephen Altschul National Center for Biotechnology Information National Library of Medicine National Institutes of Health Bethesda, MD Central Issues in Biological Sequence Comparison

More information

Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences

Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences Jianlin Cheng, PhD Department of Computer Science University of Missouri 2008 Free for Academic

More information

Christian Sigrist. November 14 Protein Bioinformatics: Sequence-Structure-Function 2018 Basel

Christian Sigrist. November 14 Protein Bioinformatics: Sequence-Structure-Function 2018 Basel Christian Sigrist General Definition on Conserved Regions Conserved regions in proteins can be classified into 5 different groups: Domains: specific combination of secondary structures organized into a

More information

CAP 5510 Lecture 3 Protein Structures

CAP 5510 Lecture 3 Protein Structures CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity

More information

Practical considerations of working with sequencing data

Practical considerations of working with sequencing data Practical considerations of working with sequencing data File Types Fastq ->aligner -> reference(genome) coordinates Coordinate files SAM/BAM most complete, contains all of the info in fastq and more!

More information

5. MULTIPLE SEQUENCE ALIGNMENT BIOINFORMATICS COURSE MTAT

5. MULTIPLE SEQUENCE ALIGNMENT BIOINFORMATICS COURSE MTAT 5. MULTIPLE SEQUENCE ALIGNMENT BIOINFORMATICS COURSE MTAT.03.239 03.10.2012 ALIGNMENT Alignment is the task of locating equivalent regions of two or more sequences to maximize their similarity. Homology:

More information

Alignment & BLAST. By: Hadi Mozafari KUMS

Alignment & BLAST. By: Hadi Mozafari KUMS Alignment & BLAST By: Hadi Mozafari KUMS SIMILARITY - ALIGNMENT Comparison of primary DNA or protein sequences to other primary or secondary sequences Expecting that the function of the similar sequence

More information

Protein structure analysis. Risto Laakso 10th January 2005

Protein structure analysis. Risto Laakso 10th January 2005 Protein structure analysis Risto Laakso risto.laakso@hut.fi 10th January 2005 1 1 Summary Various methods of protein structure analysis were examined. Two proteins, 1HLB (Sea cucumber hemoglobin) and 1HLM

More information

Phylogenetic inference

Phylogenetic inference Phylogenetic inference Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, March 7 th 016 After this lecture, you can discuss (dis-) advantages of different information types

More information

Statistical Machine Learning Methods for Biomedical Informatics II. Hidden Markov Model for Biological Sequences

Statistical Machine Learning Methods for Biomedical Informatics II. Hidden Markov Model for Biological Sequences Statistical Machine Learning Methods for Biomedical Informatics II. Hidden Markov Model for Biological Sequences Jianlin Cheng, PhD William and Nancy Thompson Missouri Distinguished Professor Department

More information

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

CS612 - Algorithms in Bioinformatics

CS612 - Algorithms in Bioinformatics Fall 2017 Protein Structure Detection Methods October 30, 2017 Comparative Modeling Comparative modeling is modeling of the unknown based on comparison to what is known In the context of modeling or computing

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

Bioinformatics. Macromolecular structure

Bioinformatics. Macromolecular structure Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain

More information

Similarity or Identity? When are molecules similar?

Similarity or Identity? When are molecules similar? Similarity or Identity? When are molecules similar? Mapping Identity A -> A T -> T G -> G C -> C or Leu -> Leu Pro -> Pro Arg -> Arg Phe -> Phe etc If we map similarity using identity, how similar are

More information

Sequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5

Sequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5 Sequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5 Why Look at More Than One Sequence? 1. Multiple Sequence Alignment shows patterns of conservation 2. What and how many

More information

Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues

Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues Programme 8.00-8.20 Last week s quiz results + Summary 8.20-9.00 Fold recognition 9.00-9.15 Break 9.15-11.20 Exercise: Modelling remote homologues 11.20-11.40 Summary & discussion 11.40-12.00 Quiz 1 Feedback

More information

Protein Modeling. Generating, Evaluating and Refining Protein Homology Models

Protein Modeling. Generating, Evaluating and Refining Protein Homology Models Protein Modeling Generating, Evaluating and Refining Protein Homology Models Troy Wymore and Kristen Messinger Biomedical Initiatives Group Pittsburgh Supercomputing Center Homology Modeling of Proteins

More information

17 Non-collinear alignment Motivation A B C A B C A B C A B C D A C. This exposition is based on:

17 Non-collinear alignment Motivation A B C A B C A B C A B C D A C. This exposition is based on: 17 Non-collinear alignment This exposition is based on: 1. Darling, A.E., Mau, B., Perna, N.T. (2010) progressivemauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One 5(6):e11147.

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of omputer Science San José State University San José, alifornia, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Pairwise Sequence Alignment Homology

More information

BLAST: Target frequencies and information content Dannie Durand

BLAST: Target frequencies and information content Dannie Durand Computational Genomics and Molecular Biology, Fall 2016 1 BLAST: Target frequencies and information content Dannie Durand BLAST has two components: a fast heuristic for searching for similar sequences

More information

Computational Molecular Biology. Protein Structure and Homology Modeling

Computational Molecular Biology. Protein Structure and Homology Modeling Computational Molecular Biology Protein Structure and Homology Modeling Prof. Alejandro Giorge1 Dr. Francesco Musiani Sequence, function and structure relationships v Life is the ability to metabolize

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 07: profile Hidden Markov Model http://bibiserv.techfak.uni-bielefeld.de/sadr2/databasesearch/hmmer/profilehmm.gif Slides adapted from Dr. Shaojie Zhang

More information

Sequence analysis and Genomics

Sequence analysis and Genomics Sequence analysis and Genomics October 12 th November 23 rd 2 PM 5 PM Prof. Peter Stadler Dr. Katja Nowick Katja: group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute

More information

Protein Structure: Data Bases and Classification Ingo Ruczinski

Protein Structure: Data Bases and Classification Ingo Ruczinski Protein Structure: Data Bases and Classification Ingo Ruczinski Department of Biostatistics, Johns Hopkins University Reference Bourne and Weissig Structural Bioinformatics Wiley, 2003 More References

More information

Introduction to sequence alignment. Local alignment the Smith-Waterman algorithm

Introduction to sequence alignment. Local alignment the Smith-Waterman algorithm Lecture 2, 12/3/2003: Introduction to sequence alignment The Needleman-Wunsch algorithm for global sequence alignment: description and properties Local alignment the Smith-Waterman algorithm 1 Computational

More information

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)

Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*

More information

Tools and Algorithms in Bioinformatics

Tools and Algorithms in Bioinformatics Tools and Algorithms in Bioinformatics GCBA815, Fall 2013 Week3: Blast Algorithm, theory and practice Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and Systems Biology

More information

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To

More information

Protein function prediction based on sequence analysis

Protein function prediction based on sequence analysis Performing sequence searches Post-Blast analysis, Using profiles and pattern-matching Protein function prediction based on sequence analysis Slides from a lecture on MOL204 - Applied Bioinformatics 18-Oct-2005

More information

Getting To Know Your Protein

Getting To Know Your Protein Getting To Know Your Protein Comparative Protein Analysis: Part III. Protein Structure Prediction and Comparison Robert Latek, PhD Sr. Bioinformatics Scientist Whitehead Institute for Biomedical Research

More information

Orthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona

Orthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Orthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Toni Gabaldón Contact: tgabaldon@crg.es Group website: http://gabaldonlab.crg.es Science blog: http://treevolution.blogspot.com

More information

Bioinformatics Exercises

Bioinformatics Exercises Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted

More information

Francisco Melo, Damien Devos, Eric Depiereux and Ernest Feytmans

Francisco Melo, Damien Devos, Eric Depiereux and Ernest Feytmans From: ISMB-97 Proceedings. Copyright 1997, AAAI (www.aaai.org). All rights reserved. ANOLEA: A www Server to Assess Protein Structures Francisco Melo, Damien Devos, Eric Depiereux and Ernest Feytmans Facultés

More information

Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm. Alignment scoring schemes and theory: substitution matrices and gap models

Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm. Alignment scoring schemes and theory: substitution matrices and gap models Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm Alignment scoring schemes and theory: substitution matrices and gap models 1 Local sequence alignments Local sequence alignments are necessary

More information

Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids

Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids Science in China Series C: Life Sciences 2007 Science in China Press Springer-Verlag Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids

More information

Sequence Alignment: Scoring Schemes. COMP 571 Luay Nakhleh, Rice University

Sequence Alignment: Scoring Schemes. COMP 571 Luay Nakhleh, Rice University Sequence Alignment: Scoring Schemes COMP 571 Luay Nakhleh, Rice University Scoring Schemes Recall that an alignment score is aimed at providing a scale to measure the degree of similarity (or difference)

More information

Pairwise sequence alignments

Pairwise sequence alignments Pairwise sequence alignments Volker Flegel VI, October 2003 Page 1 Outline Introduction Definitions Biological context of pairwise alignments Computing of pairwise alignments Some programs VI, October

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

Example of Function Prediction

Example of Function Prediction Find similar genes Example of Function Prediction Suggesting functions of newly identified genes It was known that mutations of NF1 are associated with inherited disease neurofibromatosis 1; but little

More information

Sequence alignment methods. Pairwise alignment. The universe of biological sequence analysis

Sequence alignment methods. Pairwise alignment. The universe of biological sequence analysis he universe of biological sequence analysis Word/pattern recognition- Identification of restriction enzyme cleavage sites Sequence alignment methods PstI he universe of biological sequence analysis - prediction

More information

Protein Structure Prediction

Protein Structure Prediction Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on

More information