Homology Modeling. Roberto Lins EPFL - summer semester 2005
|
|
- Beatrice Patrick
- 6 years ago
- Views:
Transcription
1 Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton, Bioinformatics, genes, protein & computers; A.M. Lesk, Introduction to Bioinformatics; A.D. Baxevanis & B.F. Ouellette, Bioinformatics, a practical guide to the analysis of genes and proteins; several online materials (George Washington University, University of Houston, Tel-Aviv University) and resources (RCSB, NCBI, SWISS-PROT) as well as personal research data.
2 Functional Genomics Genome Expressome algorithm algorithm database database Proteome database algorithm TERTIARY STRUCTURE (fold) TERTIARY STRUCTURE (fold) Metabolome algorithm database
3 Limitations of Experimental Methods Annotated proteins in the databank: ~ 100,000 Total number including ORFs: ~ 700,000 Proteins with known structure: ~5,000! Dataset for analysis ORF, or Open Reading Frame, is a region of genome that codes for a protein Have been identified by whole genome sequencing efforts ORFs with no known function are termed orphan
4 Structural Biology Consortia: Brute Force Approach Towards Structure Elucidation * Aim to solve about 400 structures a year Employment of a Ph.Ds & Postdocs army Large-scale expression & crystallization attempts Basic strategies remain the same No (known) new tricks Unrelenting ones will be ignored + Enhances the statistical base for inferring sequence structure relationships
5 Can we predict structure from sequence? GCTCCTCACTGTCTGTGTTTATTC TTTTAGCTTCTTCAGATCTTTTAG TCTGAGGAAGCCTGGCATGTGCA AATGAAGTTAACCTAA...
6 Comparative Modeling (Homology Modeling) Basis Structure is much more conserved than sequence during evolution Higher the similarity, higher is the confidence in the modeled structure Limited applicability A large number of proteins and ORFs have no similarity to proteins with known structure
7 What s homology modeling? Predicts the three-dimensional structure of a given protein sequence (target) based on an alignment to one or more known protein structures (templates). If similarity between the target sequence and the template sequence is detected, structural similarity can be assumed. In general, 30% sequence identity is required to generate an useful model. It can be used to understand function, activity, specificity, etc. It is of interest to drug companies wishing to do structure-aided drug design A keystone of structural proteomics
8 Homology modeling - applications Structure-based assessment of target drugability Structure-guided design of mutagenesis experiments Tool compound design for probing biological function Homology model based ligand design Design of in vitro test assays Structure-based prediction of drug metabolism and toxicity
9 Accuracy and application of protein structure
10 Does sequence similarity implies structure similarity? Safe zone (thanks to evolution!) Twilight zone
11 2.5 Chotia & Lesk, 1986 RMSD of backbone atoms (Ǻ) RMSD Natoms! i= 1 = d 2 i Natoms % identical residues in core Natoms = total number of atoms; d i = distance between the coordinates of an atom i at t 0 and t n, when the structures are superimposed.
12 My target sequence has over 30% sequence identity with a known protein structure, so I want to generate a 3D model. What do I have to do?
13 Structure prediction by homology modeling
14 Homology modeling makes two fundamental assumptions The structure of a protein is determined by its primary amino acid sequence (Anfinsen). During evolution, the structure of protein a has changed much slower than its sequence. Similar sequences adopt identical structures and distantly related sequences fold into similar structures.
15 In summary: homology modeling steps 1) Template recognition & initial alignment 2) Alignment correction 3) Backbone generation 4) Loop modeling 5) Side-chain modeling 6) Model optimization 7) Model validation
16 Template recognition & initial alignment Select the best template from a library of known protein structures derived from the PDB Templates can be found using the target sequence as a query for searching using FASTA or BLAST
17 Gaining confidence in template searching Once a suitable template is found, a literature search on the relevant fold can determine what biological role it plays Does this match the biological/biochemical function that you expect? Ligand(s) present? Resolution of the template Family of Proteins Multiple templates?
18 Further Considerations: Proteins are homologous if they are related by divergence from a common ancestor duplication Function may be related or very different! paralogues speciation orthologues species 1 species 2 Function more likely to be conserved
19 In summary: there are two types of homologous - Orthologs: proteins that carry out the same function in different species -Paralogs: proteins that perform different, but related functions within one organism
20 Alignment of the target onto the template Correct alignment is necessary to create the most probable 3D structure of the target If sequences aligns incorrectly, it will result in false positive or negative results Important to consider: - algorithms - scoring alignments - gap penalties Identity SCRs (Structure Conserved Regions and SVRs (Structure Variable Regions)
21 Alignment Outcome The (true) alignment indicates the evolutionary process giving rise to the different sequences starting from the same ancestor sequence and then changing through mutations (insertions, deletions, and substitutions)
22 Alignment vs. databases Task: given a query sequence and millions of database records, find the optimal alignment between the query and a record AGTCTCCAGTTATGCCA
23 Alignment vs. databases Tool: given two sequences, there exists an algorithm to find the best alignment. Naïve solution: apply algorithm to each of the records, one by one. Problem: an exact algorithm is just too slow to run millions of times (even linear time algorithm will run slowly on a huge database). Solution: - run in parallel (expensive) - use of a fast (heuristic) method to discard irrelevant records and the apply the exact algorithm to the remaining few
24 Sequence alignment algorithms Used to calculate a similarity score to infer sequence homology between two sequences Examples: the two most used in homology modeling are: BLAST: General strategy is to optimise the maximal segment pair (MSP) score - BLAST computes similarity, not alignment (Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J., J. Mol. Biol. (1990) 215: ) FastA (local alignment): searches for both full and partial sequence matches, i.e., local similarity obtained; more sensitive than BLAST, but slower; many gaps may represent a problem (Pearson, W. R., Lipman, D. J., P.N.A.S. (1988) 85: ).
25 BLAST FastA Sequence alignment outputs
26 Alignment corrections Alignments are scored (substitution score) in order to define similarity between 2 aa residues in the sequences A substitutions score is calculated for each aligned pair of letters. Substitution matrices: - reflect the true probabilities of mutations occurring through a period of evolution - PAM family: based on global aligments of closely related proteins. Mutation probability matrix. - BLOSUM family: based on observed alignments, no extrapolation of sequences that are related.
27 Gap Penalties Gap is one or more empty spaces in one sequence aligned with letters in the other sequence These empty spaces may or may not be treated as penalties: - higher penalty score is assigned for the first missing aa then the subsequent ones; it considers the fact that each mutational event can insert or delete many residues at a time
28 Gap Penalties
29 Gap Penalties Insertion/deletion of structural domains can easily be done at loop sites N C
30 Gap Penalties The overall alignment score is the sum of similarity and gap scores: the higher the overall alignment score, the better the alignment (more conserved)
31 Corrections by hand may still be needed!
32 Multiple Sequence Alignments Multiple nucleotide or amino sequence alignment techniques are usually performed to fit one of the following scopes : -to characterize protein families, identify shared regions of homology in a multiple sequence alignment; (this happens generally when a sequence search revealed homologies to several sequences) ; -to determine the consensus sequence of several aligned sequences; -to help prediction of the secondary and tertiary structures of new sequences; - preliminary step in molecular evolution analysis using Phylogenetic methods for constructing phylogenetic trees.
33
34 Backbone generation Uses known structurally conserved regions to generate coordinates for the unknown For SCRs - copy coordinates from known structures For variable regions (VR) - copy from known structure, if the residue types are similar; otherwise, use databases for fragtmented loop sequences.
35 Backbone generation Template-based fragment assembly a) Find structurally conserved regions b) build model core
36 Loop modeling
37 Loop modeling 1. Database search for segments from known protein structures fitting fixed end-points 2. Molecular mechanics/molecular dynamics 3. Combination of 1+2
38 Loop modeling Ab initio rebuilding (e.g., Monte Carlo, MD, etc) to build missing loops
39 Side chain modeling 1. Use of rotamer libraries (backbone dependent) 2. Molecular mechanics optimization - Dead-end elimination (heuristic) - Monte Carlo (heuristic) - Branch & Bound (exact) 3. Mean-field methods
40 Model optimization Molecular mechanics methods Model validation/evaluation Model should be evaluated for: - correctness of the overall fold/structure - errors over localized regions - stereochemical parameters: bond lengths, angles, etc Some softwares for model verification: - Procheck -WHAT IF -PROSA II -Profile 3D & Verify 3D
41 Model validation/evaluation The Ramachandran plot
42 Model validation/evaluation
43 Model validation/evaluation Profile 3D & Verify 3D: -verify newly solved structures or homology models -find structures/folds compatible with a given sequence -find sequences compatible with known structure/fold from a database of sequences
Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationAlgorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
More informationWeek 10: Homology Modelling (II) - HHpred
Week 10: Homology Modelling (II) - HHpred Course: Tools for Structural Biology Fabian Glaser BKU - Technion 1 2 Identify and align related structures by sequence methods is not an easy task All comparative
More informationMolecular Modeling. Prediction of Protein 3D Structure from Sequence. Vimalkumar Velayudhan. May 21, 2007
Molecular Modeling Prediction of Protein 3D Structure from Sequence Vimalkumar Velayudhan Jain Institute of Vocational and Advanced Studies May 21, 2007 Vimalkumar Velayudhan Molecular Modeling 1/23 Outline
More informationSequence Alignment: A General Overview. COMP Fall 2010 Luay Nakhleh, Rice University
Sequence Alignment: A General Overview COMP 571 - Fall 2010 Luay Nakhleh, Rice University Life through Evolution All living organisms are related to each other through evolution This means: any pair of
More informationBLAST. Varieties of BLAST
BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database
More informationTHEORY. Based on sequence Length According to the length of sequence being compared it is of following two types
Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between
More informationModule: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment
Module: Sequence Alignment Theory and Applications Session: Introduction to Searching and Sequence Alignment Introduction to Bioinformatics online course : IBT Jonathan Kayondo Learning Objectives Understand
More informationBasic Local Alignment Search Tool
Basic Local Alignment Search Tool Alignments used to uncover homologies between sequences combined with phylogenetic studies o can determine orthologous and paralogous relationships Local Alignment uses
More informationIn-Depth Assessment of Local Sequence Alignment
2012 International Conference on Environment Science and Engieering IPCBEE vol.3 2(2012) (2012)IACSIT Press, Singapoore In-Depth Assessment of Local Sequence Alignment Atoosa Ghahremani and Mahmood A.
More informationSingle alignment: Substitution Matrix. 16 march 2017
Single alignment: Substitution Matrix 16 march 2017 BLOSUM Matrix BLOSUM Matrix [2] (Blocks Amino Acid Substitution Matrices ) It is based on the amino acids substitutions observed in ~2000 conserved block
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationSequence Alignment Techniques and Their Uses
Sequence Alignment Techniques and Their Uses Sarah Fiorentino Since rapid sequencing technology and whole genomes sequencing, the amount of sequence information has grown exponentially. With all of this
More informationSequence analysis and comparison
The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species
More informationBIOINFORMATICS: An Introduction
BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and
More informationChapter 5. Proteomics and the analysis of protein sequence Ⅱ
Proteomics Chapter 5. Proteomics and the analysis of protein sequence Ⅱ 1 Pairwise similarity searching (1) Figure 5.5: manual alignment One of the amino acids in the top sequence has no equivalent and
More informationBLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010
BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for
More informationA profile-based protein sequence alignment algorithm for a domain clustering database
A profile-based protein sequence alignment algorithm for a domain clustering database Lin Xu,2 Fa Zhang and Zhiyong Liu 3, Key Laboratory of Computer System and architecture, the Institute of Computing
More informationPairwise & Multiple sequence alignments
Pairwise & Multiple sequence alignments Urmila Kulkarni-Kale Bioinformatics Centre 411 007 urmila@bioinfo.ernet.in Basis for Sequence comparison Theory of evolution: gene sequences have evolved/derived
More informationModeling for 3D structure prediction
Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing
More informationProtein Structure Prediction, Engineering & Design CHEM 430
Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment
More informationCISC 889 Bioinformatics (Spring 2004) Sequence pairwise alignment (I)
CISC 889 Bioinformatics (Spring 2004) Sequence pairwise alignment (I) Contents Alignment algorithms Needleman-Wunsch (global alignment) Smith-Waterman (local alignment) Heuristic algorithms FASTA BLAST
More informationIntroduction to protein alignments
Introduction to protein alignments Comparative Analysis of Proteins Experimental evidence from one or more proteins can be used to infer function of related protein(s). Gene A Gene X Protein A compare
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Jianlin Cheng, PhD Department of Computer Science Informatics Institute 2011 Topics Introduction Biological Sequence Alignment and Database Search Analysis of gene expression
More informationSequence Alignments. Dynamic programming approaches, scoring, and significance. Lucy Skrabanek ICB, WMC January 31, 2013
Sequence Alignments Dynamic programming approaches, scoring, and significance Lucy Skrabanek ICB, WMC January 31, 213 Sequence alignment Compare two (or more) sequences to: Find regions of conservation
More informationAlignment principles and homology searching using (PSI-)BLAST. Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU)
Alignment principles and homology searching using (PSI-)BLAST Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) http://ibivu.cs.vu.nl Bioinformatics Nothing in Biology makes sense except in
More informationBioinformatics (GLOBEX, Summer 2015) Pairwise sequence alignment
Bioinformatics (GLOBEX, Summer 2015) Pairwise sequence alignment Substitution score matrices, PAM, BLOSUM Needleman-Wunsch algorithm (Global) Smith-Waterman algorithm (Local) BLAST (local, heuristic) E-value
More informationProtein Modeling Methods. Knowledge. Protein Modeling Methods. Fold Recognition. Knowledge-based methods. Introduction to Bioinformatics
Protein Modeling Methods Introduction to Bioinformatics Iosif Vaisman Ab initio methods Energy-based methods Knowledge-based methods Email: ivaisman@gmu.edu Protein Modeling Methods Ab initio methods:
More informationSara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)
Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline
More informationDesign of a Novel Globular Protein Fold with Atomic-Level Accuracy
Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein
More informationCMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison
CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture
More information3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT
3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT.03.239 25.09.2012 SEQUENCE ANALYSIS IS IMPORTANT FOR... Prediction of function Gene finding the process of identifying the regions of genomic DNA that encode
More informationProcheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.
Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond
More informationTools and Algorithms in Bioinformatics
Tools and Algorithms in Bioinformatics GCBA815, Fall 2015 Week-4 BLAST Algorithm Continued Multiple Sequence Alignment Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and
More informationProtein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror
Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major
More informationBiochemistry 324 Bioinformatics. Pairwise sequence alignment
Biochemistry 324 Bioinformatics Pairwise sequence alignment How do we compare genes/proteins? When we have sequenced a genome, we try and identify the function of unknown genes by finding a similar gene
More informationQuantifying sequence similarity
Quantifying sequence similarity Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 16 th 2016 After this lecture, you can define homology, similarity, and identity
More informationGrundlagen der Bioinformatik, SS 08, D. Huson, May 2,
Grundlagen der Bioinformatik, SS 08, D. Huson, May 2, 2008 39 5 Blast This lecture is based on the following, which are all recommended reading: R. Merkl, S. Waack: Bioinformatik Interaktiv. Chapter 11.4-11.7
More informationAn Introduction to Sequence Similarity ( Homology ) Searching
An Introduction to Sequence Similarity ( Homology ) Searching Gary D. Stormo 1 UNIT 3.1 1 Washington University, School of Medicine, St. Louis, Missouri ABSTRACT Homologous sequences usually have the same,
More informationBuilding 3D models of proteins
Building 3D models of proteins Why make a structural model for your protein? The structure can provide clues to the function through structural similarity with other proteins With a structure it is easier
More informationSyllabus of BIOINF 528 (2017 Fall, Bioinformatics Program)
Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program) Course Name: Structural Bioinformatics Course Description: Instructor: This course introduces fundamental concepts and methods for structural
More informationMolecular Modeling Lecture 7. Homology modeling insertions/deletions manual realignment
Molecular Modeling 2018-- Lecture 7 Homology modeling insertions/deletions manual realignment Homology modeling also called comparative modeling Sequences that have similar sequence have similar structure.
More informationHomology and Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The
More information09/06/25. Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Non-uniform distribution of folds. Scheme of protein structure predicition
Sequence identity Structural similarity Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Fold recognition Sommersemester 2009 Peter Güntert Structural similarity X Sequence identity Non-uniform
More informationCMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction
CMPS 6630: Introduction to Computational Biology and Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the
More informationHomology. and. Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline WHAT IS HOMOLOGY? HOW TO GATHER KNOWN PROTEIN INFORMATION? HOW TO ANNOTATE PROTEIN DOMAINS? EXAMPLES AND EXERCISES Homology
More informationComputational Biology
Computational Biology Lecture 6 31 October 2004 1 Overview Scoring matrices (Thanks to Shannon McWeeney) BLAST algorithm Start sequence alignment 2 1 What is a homologous sequence? A homologous sequence,
More informationBioinformatics. Scoring Matrices. David Gilbert Bioinformatics Research Centre
Bioinformatics Scoring Matrices David Gilbert Bioinformatics Research Centre www.brc.dcs.gla.ac.uk Department of Computing Science, University of Glasgow Learning Objectives To explain the requirement
More informationResearch Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family.
Research Proposal Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Name: Minjal Pancholi Howard University Washington, DC. June 19, 2009 Research
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationOptimization of a New Score Function for the Detection of Remote Homologs
PROTEINS: Structure, Function, and Genetics 41:498 503 (2000) Optimization of a New Score Function for the Detection of Remote Homologs Maricel Kann, 1 Bin Qian, 2 and Richard A. Goldstein 1,2 * 1 Department
More informationCMPS 3110: Bioinformatics. Tertiary Structure Prediction
CMPS 3110: Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the laws of physics! Conformation space is finite
More informationCONCEPT OF SEQUENCE COMPARISON. Natapol Pornputtapong 18 January 2018
CONCEPT OF SEQUENCE COMPARISON Natapol Pornputtapong 18 January 2018 SEQUENCE ANALYSIS - A ROSETTA STONE OF LIFE Sequence analysis is the process of subjecting a DNA, RNA or peptide sequence to any of
More informationLarge-Scale Genomic Surveys
Bioinformatics Subtopics Fold Recognition Secondary Structure Prediction Docking & Drug Design Protein Geometry Protein Flexibility Homology Modeling Sequence Alignment Structure Classification Gene Prediction
More informationCh. 9 Multiple Sequence Alignment (MSA)
Ch. 9 Multiple Sequence Alignment (MSA) - gather seqs. to make MSA - doing MSA with ClustalW - doing MSA with Tcoffee - comparing seqs. that cannot align Introduction - from pairwise alignment to MSA -
More informationLocal Alignment Statistics
Local Alignment Statistics Stephen Altschul National Center for Biotechnology Information National Library of Medicine National Institutes of Health Bethesda, MD Central Issues in Biological Sequence Comparison
More informationStatistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences
Statistical Machine Learning Methods for Bioinformatics II. Hidden Markov Model for Biological Sequences Jianlin Cheng, PhD Department of Computer Science University of Missouri 2008 Free for Academic
More informationChristian Sigrist. November 14 Protein Bioinformatics: Sequence-Structure-Function 2018 Basel
Christian Sigrist General Definition on Conserved Regions Conserved regions in proteins can be classified into 5 different groups: Domains: specific combination of secondary structures organized into a
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationPractical considerations of working with sequencing data
Practical considerations of working with sequencing data File Types Fastq ->aligner -> reference(genome) coordinates Coordinate files SAM/BAM most complete, contains all of the info in fastq and more!
More information5. MULTIPLE SEQUENCE ALIGNMENT BIOINFORMATICS COURSE MTAT
5. MULTIPLE SEQUENCE ALIGNMENT BIOINFORMATICS COURSE MTAT.03.239 03.10.2012 ALIGNMENT Alignment is the task of locating equivalent regions of two or more sequences to maximize their similarity. Homology:
More informationAlignment & BLAST. By: Hadi Mozafari KUMS
Alignment & BLAST By: Hadi Mozafari KUMS SIMILARITY - ALIGNMENT Comparison of primary DNA or protein sequences to other primary or secondary sequences Expecting that the function of the similar sequence
More informationProtein structure analysis. Risto Laakso 10th January 2005
Protein structure analysis Risto Laakso risto.laakso@hut.fi 10th January 2005 1 1 Summary Various methods of protein structure analysis were examined. Two proteins, 1HLB (Sea cucumber hemoglobin) and 1HLM
More informationPhylogenetic inference
Phylogenetic inference Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, March 7 th 016 After this lecture, you can discuss (dis-) advantages of different information types
More informationStatistical Machine Learning Methods for Biomedical Informatics II. Hidden Markov Model for Biological Sequences
Statistical Machine Learning Methods for Biomedical Informatics II. Hidden Markov Model for Biological Sequences Jianlin Cheng, PhD William and Nancy Thompson Missouri Distinguished Professor Department
More informationProtein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror
Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationCS612 - Algorithms in Bioinformatics
Fall 2017 Protein Structure Detection Methods October 30, 2017 Comparative Modeling Comparative modeling is modeling of the unknown based on comparison to what is known In the context of modeling or computing
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationBioinformatics. Macromolecular structure
Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain
More informationSimilarity or Identity? When are molecules similar?
Similarity or Identity? When are molecules similar? Mapping Identity A -> A T -> T G -> G C -> C or Leu -> Leu Pro -> Pro Arg -> Arg Phe -> Phe etc If we map similarity using identity, how similar are
More informationSequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5
Sequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5 Why Look at More Than One Sequence? 1. Multiple Sequence Alignment shows patterns of conservation 2. What and how many
More informationProgramme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues
Programme 8.00-8.20 Last week s quiz results + Summary 8.20-9.00 Fold recognition 9.00-9.15 Break 9.15-11.20 Exercise: Modelling remote homologues 11.20-11.40 Summary & discussion 11.40-12.00 Quiz 1 Feedback
More informationProtein Modeling. Generating, Evaluating and Refining Protein Homology Models
Protein Modeling Generating, Evaluating and Refining Protein Homology Models Troy Wymore and Kristen Messinger Biomedical Initiatives Group Pittsburgh Supercomputing Center Homology Modeling of Proteins
More information17 Non-collinear alignment Motivation A B C A B C A B C A B C D A C. This exposition is based on:
17 Non-collinear alignment This exposition is based on: 1. Darling, A.E., Mau, B., Perna, N.T. (2010) progressivemauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One 5(6):e11147.
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of omputer Science San José State University San José, alifornia, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Pairwise Sequence Alignment Homology
More informationBLAST: Target frequencies and information content Dannie Durand
Computational Genomics and Molecular Biology, Fall 2016 1 BLAST: Target frequencies and information content Dannie Durand BLAST has two components: a fast heuristic for searching for similar sequences
More informationComputational Molecular Biology. Protein Structure and Homology Modeling
Computational Molecular Biology Protein Structure and Homology Modeling Prof. Alejandro Giorge1 Dr. Francesco Musiani Sequence, function and structure relationships v Life is the ability to metabolize
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 07: profile Hidden Markov Model http://bibiserv.techfak.uni-bielefeld.de/sadr2/databasesearch/hmmer/profilehmm.gif Slides adapted from Dr. Shaojie Zhang
More informationSequence analysis and Genomics
Sequence analysis and Genomics October 12 th November 23 rd 2 PM 5 PM Prof. Peter Stadler Dr. Katja Nowick Katja: group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute
More informationProtein Structure: Data Bases and Classification Ingo Ruczinski
Protein Structure: Data Bases and Classification Ingo Ruczinski Department of Biostatistics, Johns Hopkins University Reference Bourne and Weissig Structural Bioinformatics Wiley, 2003 More References
More informationIntroduction to sequence alignment. Local alignment the Smith-Waterman algorithm
Lecture 2, 12/3/2003: Introduction to sequence alignment The Needleman-Wunsch algorithm for global sequence alignment: description and properties Local alignment the Smith-Waterman algorithm 1 Computational
More informationLecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)
Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*
More informationTools and Algorithms in Bioinformatics
Tools and Algorithms in Bioinformatics GCBA815, Fall 2013 Week3: Blast Algorithm, theory and practice Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and Systems Biology
More informationExamples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
More informationProtein function prediction based on sequence analysis
Performing sequence searches Post-Blast analysis, Using profiles and pattern-matching Protein function prediction based on sequence analysis Slides from a lecture on MOL204 - Applied Bioinformatics 18-Oct-2005
More informationGetting To Know Your Protein
Getting To Know Your Protein Comparative Protein Analysis: Part III. Protein Structure Prediction and Comparison Robert Latek, PhD Sr. Bioinformatics Scientist Whitehead Institute for Biomedical Research
More informationOrthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona
Orthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Toni Gabaldón Contact: tgabaldon@crg.es Group website: http://gabaldonlab.crg.es Science blog: http://treevolution.blogspot.com
More informationBioinformatics Exercises
Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted
More informationFrancisco Melo, Damien Devos, Eric Depiereux and Ernest Feytmans
From: ISMB-97 Proceedings. Copyright 1997, AAAI (www.aaai.org). All rights reserved. ANOLEA: A www Server to Assess Protein Structures Francisco Melo, Damien Devos, Eric Depiereux and Ernest Feytmans Facultés
More informationLecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm. Alignment scoring schemes and theory: substitution matrices and gap models
Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm Alignment scoring schemes and theory: substitution matrices and gap models 1 Local sequence alignments Local sequence alignments are necessary
More informationGrouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids
Science in China Series C: Life Sciences 2007 Science in China Press Springer-Verlag Grouping of amino acids and recognition of protein structurally conserved regions by reduced alphabets of amino acids
More informationSequence Alignment: Scoring Schemes. COMP 571 Luay Nakhleh, Rice University
Sequence Alignment: Scoring Schemes COMP 571 Luay Nakhleh, Rice University Scoring Schemes Recall that an alignment score is aimed at providing a scale to measure the degree of similarity (or difference)
More informationPairwise sequence alignments
Pairwise sequence alignments Volker Flegel VI, October 2003 Page 1 Outline Introduction Definitions Biological context of pairwise alignments Computing of pairwise alignments Some programs VI, October
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationExample of Function Prediction
Find similar genes Example of Function Prediction Suggesting functions of newly identified genes It was known that mutations of NF1 are associated with inherited disease neurofibromatosis 1; but little
More informationSequence alignment methods. Pairwise alignment. The universe of biological sequence analysis
he universe of biological sequence analysis Word/pattern recognition- Identification of restriction enzyme cleavage sites Sequence alignment methods PstI he universe of biological sequence analysis - prediction
More informationProtein Structure Prediction
Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on
More information