Microbiology Helmut Pospiech
|
|
- Philip Douglas
- 5 years ago
- Views:
Transcription
1 Microbiology Helmut Pospiech
2 The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition of prokaryotic species Collection of strains sharing a high degree of similarity in several independent traits Most important traits include 70% or greater DNA-DNA hybridization and 97% or greater 16S rrna gene sequence identity Brock Biology of Microorganisms, 12th ed.
3 The Species Concept in Microbiology Biological species concept not meaningful for prokaryotes as they are haploid and do not undergo sexual reproduction Genealogical species concept is an alternative Prokaryotic species is a group of strains that based on DNA sequences of multiple genes cluster closely with others phylogenetically and are distinct from other groups of strains Brock Biology of Microorganisms, 12th ed.
4 Multi-Gene Phylogenetic Analysis 16S rrna genes gyrb genes luxabfe genes Figure Brock Biology of Microorganisms, 12th ed.
5 The Species Concept in Microbiology Ecotype Population of cells that share a particular resource Different ecotypes can coexist in a habitat Bacterial speciation may occur from a combination of repeated periodic selection for a favorable trait within an ecotype and lateral gene flow Brock Biology of Microorganisms, 12th ed.
6 A Model for Bacterial Speciation Figure Brock Biology of Microorganisms, 12th ed.
7 The Species Concept in Microbiology This model is based solely on the assumption of vertical gene flow New genetic capabilities can also arise by horizontal gene transfer; the extent among bacteria is variable Brock Biology of Microorganisms, 12th ed.
8 Trouble with the Tree of Life Concept Ring of Life rather than a tree of life since the eukaryotic genome represents a fusion of a bacterial and archaeal genome (Riviera and Lake (2004), Nature 431, 152) A reticulated tree would better describe the genotypic relationship of organisms due to vast horizontal gene transfer (Doolittle (1999), Science 284, 2124; Martin (1999), BioEssays 21, 99)
9 Universal common ancestry of life on earth? a, The multiple-ancestry possibility: depicted here is life originating from two separate forms, with proteins with similar functions arising independently. Transfers, by endosymbiosis or by lateral gene transfers, are shown by dotted lines. b, A single origin (universal common ancestry), at least after the advent of protein synthesis. Correlations between patterns at different amino-acid positions are used to test between the two possibilities. Steel M & Penny D (2010) Nature 465,168.
10 The Species Concept in Microbiology No firm estimate on the number of prokaryotic species Nearly 7,000 species of Bacteria and Archaea are presently known
11 Classification and Nomenclature Classification Organization of organisms into progressively more inclusive groups on the basis of either phenotypic similarity or evolutionary relationship
12 Classification and Nomenclature Prokaryotes are given descriptive genus names and species epithets following the binomial system of nomenclature used throughout biology Assignment of names for species and higher groups of prokaryotes is regulated by the Bacteriological Code - The International Code of Nomenclature of Bacteria
13 Taxonomic Hierarchy for Allochromatium warmingii Brock Biology of Microorganisms, 13th ed.
14 14.14 Classification and Nomenclature Major references in bacterial diversity Bergey s Manual of Systematic Bacteriology (Springer) The Prokaryotes (Springer)
15 Classification and Nomenclature Formal recognition of a new prokaryotic species requires Deposition of a sample of the organism in two culture collections Official publication of the new species name and description in the International Journal of Systematic and Evolutionary Microbiology (IJSEM) The International Committee on Systematics of Prokaryotes (ICSP) is responsible for overseeing nomenclature and taxonomy of Bacteria and Archaea
16
17 Uneven distribution of components of the archaeal cell division (FtsZ, CdvBC, and actin), DNA maintenance (topoisomerases IA and IB, eukaryotic-like histones), protein ubiquitinylation, and transcription (Rpb8) systems. Such uneven distributions could result from ancient HGTs among the archaeal lineages and/or differences in the loss of multiple systems present in the last common archaeal ancestor (orange circle). Dark purple indicates a character present in all members of the corresponding lineage, whereas light purple indicates a character present in only some representatives of the lineage. Uncertainties, given the lack of a complete genome sequence for Nitrososphaera gargensis, are noted by question marks. Brochier-Armanet, Forterre & Gribaldo (2011) Current Opinion in Microbiology 14,
18 Methanogens
19 Phylogeny of Bacteria Brock Biology of Microorganisms, 13th ed.
20 Proteobacteria Largest and metabolically most diverse group of bacteria Most bacteria of industrial, agricultural or medical importance Gram-negative Metabolically extremely diverse Phenotypic classification does not match the phylogenetic relationship between the proteobacteria Brock Biology of Microorganisms, 13th ed.
21 Important groups of Proteobacteria Purple sulfur bacteria Anoxigenic photosynthesis E.g. Chromatium Non-sulfur purple bacteria Anoxigenic photosynthesis Often facultative phototrophic E.g. Rhodobacter Chemolithotrophs Nitrifying bacteria Sulfur- and iron-oxidising bacteria Hydrogen-oxidising bacteria Brock Biology of Microorganisms, 13th ed.
22 Important groups of Proteobacteria Pseudomonas and Pseudomonads Obligatory respiratory Oxidase-positive Ecologically important for aerobic decomposition of organic material in nature Often nutritionally versatile Common in soil and water Some important pathogens Brock Biology of Microorganisms, 13th ed.
23 Important groups of Proteobacteria Gram-negative cocci Include Neisseria and Moraxella Important pathogens of human N. gonorrhoeae gonerrhea N. menigitidis meningitis Vibrio and relatives Facultative anaerobes Oxidase positive Marine environments, e.g. in and on fish Often bioluminescence V. cholerae causes cholera Brock Biology of Microorganisms, 13th ed.
24 Important groups of Proteobacteria Enteric Bacteria Include many medically important pathogens Escherichia, Salmonella, Shigella, Proteus, Klebsiella and Serratia In the enterogastric tracts of mammals, on plants, aquatic environments etc. Brock Biology of Microorganisms, 13th ed.
25 Important groups of Proteobacteria Rickettsias Obligate parasites Live inside host cells Brock Biology of Microorganisms, 13th ed.
26 Important groups of Proteobacteria Spirillia Spiral-shaped bacteria Microaerophilic aerobes Bdellovibrio Prays on bacteria! Brock Biology of Microorganisms, 13th ed.
27 Important groups of Proteobacteria Myxobacteria social bacteria Forming fruiting bodies with spores But not endospores Brock Biology of Microorganisms, 13th ed.
28 Gram-positive bacteria - Firmicutes Lactic acid bacteria Streptococcus / Lactococcus Lactobacillus Endospore formers Bacillus (aerobe) Clostridium (strictly anaerobe) Heliobacteria photosynthetic
29 Gram-positive bacteria - Mullicutes Mycoplasms Parasites Without cell wall Small Smallest genomes
30 Gram-positive bacteria - Actinobacteria Corynebacteria Propionic acid bacteria Mycobacteria Many pathogens Streptomyces
Chapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationMicrobial Taxonomy. Classification of living organisms into groups. A group or level of classification
Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think
More informationFigure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case)
Chapter 11 The Prokaryotes: Domains Bacteria and Archaea Objective Questions 1) Which of the following are found primarily in the intestines of humans? A) Gram-negative aerobic rods and cocci B) Aerobic,
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationDomain Bacteria. BIO 220 Microbiology Jackson Community College
Domain Bacteria BIO 220 Microbiology Jackson Community College John Ireland, Ph.D. 2006 Scientific Nomenclature Domain - Bacteria Phylum Important for gross characteristics Class Intermediate characteristics
More informationCh 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria)
Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria) (don t study Concept 27.2) Some phyla Remember: Bacterial cell structure and shapes 1 Usually very small but some are unusually
More information9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success
5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationOutline. Classification of Living Things
Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationProkaryotes. Chapter 27. PowerPoint Lectures for Biology, Seventh Edition. Lectures by Chris Romero. Neil Campbell and Jane Reece
Chapter 27 Prokaryotes PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: They re (Almost) Everywhere! Most prokaryotes are microscopic But
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationUniversiteit van Pretoria University of Pretoria. Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March Examiners: Dr L Moleleki
Universiteit van Pretoria University of Pretoria Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March 2012 Tyd: 1 uur Time: 1 hour Eksaminatore: Dr L Moleleki Examiners: Dr L Moleleki Beantwoord
More informationA word of caution about a little knowing Lab organisms limit the view of the world of microbiology
Diversity The world of living things (Figure from Madigan et al. 2002) Microbes in all three domains Two of the domains are exclusively prokaryotic and microbial The third contains both unicellular and
More information1. Which of the following species have strains that are capable of undergoing the process of conjugation?
Biology 3340 Summer 2005 Second Examination Version A Name Be sure to put your name on the mark-sense sheet as well Directions: Write your name in the correct space on the mark-sense sheet and the exam
More informationLecture 2 Carbon and Energy Transformations
1.018/7.30J Fall 2003 Fundamentals of Ecology Lecture 2 Carbon and Energy Transformations READINGS FOR NEXT LECTURE: Krebs Chapter 25: Ecosystem Metabolism I: Primary Productivity Luria. 1975. Overview
More informationOrigins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
More informationKingdom Monera(Archaebacteria & Eubacteria)
Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.
More informationKINGDOM MONERA. Bacterial Cell Shape 8/22/2010. The Prokaryotes: Archaebacteria and Eubacteria
KINGDOM MONERA The Prokaryotes: Archaebacteria and Eubacteria Bacteria are the most organisms living on the Earth. (i.e. 10mL of soil contains 1 x 10 10 bacteria. They are found in nearly every habitat
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
More informationB. Correct! Bacillus anthraces produces spores that can cause anthrax. D. Incorrect! Diphtheria is caused by Corynebacterium diphtheriae.
Microbiology - Problem Drill 09 - The Prokaryotes No. 1 of 10 1. Bacillus anthraces is most closely associated with which of the following? (A) Botulism poisoning (B) Anthrax (C) Gangrene (D) Diphtheria
More informationMicrobial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy 1. Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eucaryote, is in a mess we are stuck with it for traditional
More informationSection 18-1 Finding Order in Diversity
Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?
More informationChapter 1. Basics of Microbiology
Chapter 1 Basics of Microbiology Objectives How microorganisms are classified (taxonomy) What they look like (morphology) The major divisions among microorganisms based upon their function in the environment
More informationAnnouncements KEY CONCEPTS
What do these things have in common? Announcements Lab this week: bring textbook and photo atlas. Relevant reading BEFORE lab: Ch. 30 http://i.cnn.net/cnn/specials/2001/trade.center/images/anthrax.jpg
More informationVocabulary- Bacteria (34 words)
Biology II BACTERIA Vocabulary- Bacteria (34 words) 1. Prokaryote 21. phototroph 2. Peptidoglycan 22. chemotroph 3. Methanogen 23. obligate anaerobe 4. Halophile 24. facultative anaerobe 5. Thermoacidophile
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationFig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table
Fig. 26.7a Biodiversity 1. Course Outline Outcomes Instructors Text Grading 2. Course Syllabus Fig. 26.7b Table 26.2-1 1 Table 26.2-2 Outline: Systematics and the Phylogenetic Revolution I. Naming and
More informationKingdom Monera Bacteria
Kingdom Monera Bacteria Common bacteria Prokaryotes Strep throat Anthrax Chlamydia E. coli Meningitis Salmonella Micrococcus(intestinal) Streptococcus mutans Haemophilusinfluenzae Cellphonious bacterious
More information1. Prokaryotic Nutritional & Metabolic Adaptations
Chapter 27B: Bacteria and Archaea 1. Prokaryotic Nutritional & Metabolic Adaptations 2. Survey of Prokaryotic Groups A. Domain Bacteria Gram-negative groups B. Domain Bacteria Gram-positive groups C. Domain
More informationTaxonomy and Biodiversity
Chapter 25/26 Taxonomy and Biodiversity Evolutionary biology The major goal of evolutionary biology is to reconstruct the history of life on earth Process: a- natural selection b- mechanisms that change
More informationHierarchies can be represented as trees:
Diversity of Life Classification - an organized scheme for grouping organisms - a tool for communication - Hierarchical - a series of successive and inclusive rankings Domain - the highest rank - contains
More informationKharkov National Medical University. Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich
Kharkov National Medical University Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich Tkachenko Victoria 1, 5, 11, 14, 19, 21, 30 Kovalenko Natalia 2, 12, 25, 29 Siritsa
More informationBiology Curriculum Pacing Guide MONTGOMERY COUNTY PUBLIC SCHOOLS
MONTGOMERY COUNTY PUBLIC SCHOOLS Biology Curriculum Pacing Guide 1 st 9 Weeks SOL Objectives Vocabulary 7 Days 14 Days BIO.1 The student will demonstrate an understanding of scientific reasoning, logic,
More informationIntro to Prokaryotes Lecture 1 Spring 2014
Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite
More informationIntroduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1
Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus
More informationLECTURE 13. THE BACTERIA (cont.) Photosynthetic Bacteria, phylogenetically widespread. And many Proteobacteria. Photosynthetic Bacteria
Photosynthetic Bacteria, phylogenetically widespread LECTURE 13 THE BACTERIA (cont.) And many Proteobacteria Photosynthetic Bacteria > Green Sulfur > Green Nonsulfur > Purple Sulfur > Purple Nonsulfur
More informationPhylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26
Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,
More information2/25/2013. Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes
1 2 3 4 5 6 7 8 9 10 11 12 Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes Domain Bacteria Proteobacteria From the mythical Greek god Proteus, who could assume many shapes Gram-negative
More informationTEST SUMMARY AND FRAMEWORK TEST SUMMARY
Washington Educator Skills Tests Endorsements (WEST E) TEST SUMMARY AND FRAMEWORK TEST SUMMARY BIOLOGY Copyright 2014 by the Washington Professional Educator Standards Board 1 Washington Educator Skills
More informationName: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationMissouri Educator Gateway Assessments
Missouri Educator Gateway Assessments June 2014 Content Domain Range of Competencies Approximate Percentage of Test Score I. Science and Engineering Practices 0001 0003 21% II. Biochemistry and Cell Biology
More informationMICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012
MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular
More informationOverview of the major bacterial pathogens The major bacterial pathogens are presented in this table:
Practical Microbiology 30/11/2018 University of Sulaimani college of Pharmacy Year2 Lab. 5: Overview of the major bacterial pathogens The major bacterial pathogens are presented in this table: Major Bacterial
More informationScientific names allow scientists to talk about particular species without confusion
Unit 9 Test Review KEY a. Explain the history, purpose, and methods of taxonomy What is taxonomy? the science of naming and classifying organisms Who came up with it? Linnaeus Why do we use taxonomy? Scientific
More informationObligate anaerobes - cannot grow in the presence of oxygen Facultative anaerobes - can grow with or without oxygen Aerobic - require oxygen
PROKARYOTES *include bacteria and archaea *singular: bacterium / plural: bacteria PROPERTIES 1. Bacteria are classified into two kingdoms: Eubacteria (true bacteria) and Archaebacteria (Ancient Bacteria).
More informationBacteria & Archaea. Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school
Bacteria & Archaea Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school What is the bacteria? http://www.unc.edu/depts/tcf/mycoplasma.gif http://gsbs.utmb.edu/microbook/images/fig37_1.jpg
More informationOutline. Viruses, Bacteria, and Archaea. Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea
Viruses, Bacteria, and Archaea Chapter 21 Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea Outline The Viruses The Viruses Viruses are noncellular
More informationSec$on 9. Evolu$onary Rela$onships
Sec$on 9 Evolu$onary Rela$onships Sec$on 9 Learning Goals Explain why the ribosomal 16S gene is a good marker for molecular phylogene$c comparisons. Be able to interpret a phylogene$c tree. Explain the
More informationClassifying Prokaryotes: Eubacteria Plasma Membrane. Ribosomes. Plasmid (DNA) Capsule. Cytoplasm. Outer Membrane DNA. Flagellum.
Bacteria The yellow band surrounding this hot spring is sulfur, a waste product of extremophilic prokaryotes, probably of the Domain Archaea, Kingdom Archaebacteria. Bacteria are prokaryotic cells (no
More informationStepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
More informationMajor Events in the History of Earth
Major Events in the History of Earth Cenozoic Humans Land plants Animals Origin of solar system and Earth Multicellular eukaryotes 1 Proterozoic eon 2 Archaean eon 3 4 Single-celled eukaryotes Atmospheric
More informationCLASSIFICATION. Why Classify? 2/18/2013. History of Taxonomy Biodiversity: variety of organisms at all levels from populations to ecosystems.
Why Classify? Classification has been around ever since people paid attention to organisms. CLASSIFICATION One primeval system was based on harmful and non-harmful organisms. Life is easier when we organize
More informationText of objective. Investigate and describe the structure and functions of cells including: Cell organelles
This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004
More informationBurton's Microbiology for the Health Sciences
Burton's Microbiology for the Health Sciences Chapter 3. Cell Structure and Taxonomy Chapter 3 Outline Introduction Eucaryotic Cell Structure Procaryotic Cell Structure Summary of Structural Differences
More informationTER 26. Preview for 2/6/02 Dr. Kopeny. Bacteria and Archaea: The Prokaryotic Domains. Nitrogen cycle
Preview for 2/6/02 Dr. Kopeny Bacteria and Archaea: The Prokaryotic Domains TER 26 Nitrogen cycle Mycobacterium tuberculosis Color-enhanced images shows rod-shaped bacterium responsible for tuberculosis
More informationCOMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.
North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01
More informationSection Title: Archaebacteria vs. Eubacteria
Unit: 3.1 Name: Section Title: Archaebacteria vs. Eubacteria Latin Root Word: Review of Old Information: None New Information: Bacteria Notes Basic Bacteria Facts Classification of Bacteria: Kingdom Archaebacteria
More informationA Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems
A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems Tao Yuan, Asst/Prof. Stephen Tiong-Lee Tay and Dr Volodymyr Ivanov School of Civil and Environmental
More informationChapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
More informationClassification. Old 5 Kingdom system. New 3 Domain system. reflects a greater understanding of evolution & molecular evidence
Classification Old 5 Kingdom system Monera, Protists, Plants, Fungi, Animals New 3 Domain system reflects a greater understanding of evolution & molecular evidence Prokaryote: Bacteria Prokaryote: Archaebacteria
More informationCh 3. Bacteria and Archaea
Ch 3 Bacteria and Archaea SLOs for Culturing of Microorganisms Compare and contrast the overall cell structure of prokaryotes and eukaryotes. List structures all bacteria possess. Describe three basic
More informationChapter 16: Reconstructing and Using Phylogenies
Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/
More informationGame plan Lecture Lab Prelabs
Game plan Lecture Binary fission Growth curves Physical requirements for growth Chemical requirements for growth Lab Lab Exam Prelabs Growth Curve Bring books and APO-3 for next class Microbial growth
More informationSPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together
SPECIATION Origin of new species=speciation -Process by which one species splits into two or more species, accounts for both the unity and diversity of life SPECIES BIOLOGICAL CONCEPT Population or groups
More informationOverview: Masters of Adaptation. Prokaryotes thrive almost everywhere, including places too acidic, salty, cold, or hot for most other organisms
Chapter 27 Bacteria and Archaea Overview: Masters of Adaptation Prokaryotes thrive almost everywhere, including places too acidic, salty, cold, or hot for most other organisms They have an astonishing
More informationChapter 21 PROKARYOTES AND VIRUSES
Chapter 21 PROKARYOTES AND VIRUSES Bozeman Video classification of life http://www.youtube.com/watch?v=tyl_8gv 7RiE Impacts, Issues: West Nile Virus Takes Off Alexander the Great, 336 B.C., conquered a
More informationA. Correct! Taxonomy is the science of classification. B. Incorrect! Taxonomy is the science of classification.
DAT - Problem Drill 07: Diversity of Life Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. What is taxonomy? Question #01 (A) Taxonomy
More informationChapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics
Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus
More informationThe Prokaryotes: Domains Bacteria and Archaea
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 11 The Prokaryotes: Domains Bacteria and Archaea Table 11.1 Classification of Selected Prokaryotes*
More informationCharacteristics. Nucleoid Region single circular chromosome plasmids mesosome
Prokaryotes Characteristics Nucleoid Region single circular chromosome plasmids mesosome No membranebound organelles Ribosomes (70S) Plasma membrane Cell wall peptidoglycan Capsule glycocalyx Flagella
More informationMid-Year Exam Review
Biology 504 Mid-Year Exam Review Name: Spontaneous Generation Ch. 2 Heath Biology 1. What is meant by spontaneous generation? Give 3 examples of the appearance of living things that people believed were
More informationBiology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes
More informationChapters 25 and 26. Searching for Homology. Phylogeny
Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The
More information9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification
Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains and Kingdoms Click on a lesson name to select. Early Systems of Classification Biologists use a system of classification
More informationTRACING BACK TO THE BEGINNING
BACTERIA! TRACING BACK TO THE BEGINNING PROKARYOTES KINGDOM EUBACTERIA KINGDOM ARCHAEBACTERIA CHARACTERISTICS: 1. NO NUCLEUS 2. NO MEMBRANE BOUND ORGANELLES 4. MOST ARE SMALLER THAN EUKARYOTES 5. ARE SINGLE-CELLED
More informationThere are 5 kingdoms: Animalia multicellular animals, heterotrophic (eat other things), evolved 700,000,000 years ago (1,000,000 2,000,000 species)
Classification The modern system of naming gives each living thing 7 names. Each name is a little more specific than the one before it. The categories are (in order from least to most specific): Kingdom
More informationPhylogenetic Diversity of Coliform Isolates in USA. Phylogenetic Classification
Phylogenetic Diversity of Coliform Isolates in USA Ya Zhang and Wen Tso Liu University of Illinois at Urbana Champaign Mark LeChevallier American Water Inc. Nov 2011 Phylogenetic Classification group organisms
More information016/03/11/world/bact eria-discoveryplastic/index.html
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 11 Characterizing and Classifying Prokaryotes http://www.cnn.com/2 016/03/11/world/bact
More informationPhylogeny & Systematics
Phylogeny & Systematics Phylogeny & Systematics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite
More informationEvolution Problem Drill 09: The Tree of Life
Evolution Problem Drill 09: The Tree of Life Question No. 1 of 10 Question 1. The age of the Earth is estimated to be about 4.0 to 4.5 billion years old. All of the following methods may be used to estimate
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationBACTERIA AND ARCHAEA 10/15/2012
BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in
More informationBiol 1409: Study Guide for Exam I. Introduction to Diversity
Biol 1409: Study Guide for Exam I Introduction to Diversity 1. Define Biosphere and describe where it is found 2. Describe why our planet is so hospitable to life 3. Name and briefly describe the major
More informationCharacterizing and Classifying Prokaryotes
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 11 Characterizing and Classifying Prokaryotes Bacteria as Plastic Recyclers http://www.cnn.com/2016/03/11/world/b
More informationPhys 214. Planets and Life
Phys 214. Planets and Life Dr. Cristina Buzea Department of Physics Room 259 E-mail: cristi@physics.queensu.ca (Please use PHYS214 in e-mail subject) Lecture 16. Phylogenetic tree. Metabolism. Carbon and
More informationProkaryotes Vs. Eukaryotes
The Microbial World Prokaryotes Vs. Eukaryotes Mircrobes of the Ocean Primary Producers Are the organisms that produce bio-mass from inorganic compounds (autotrophs). -Photosynthetic autotrophs Phytoplankton
More information