Microbiology Helmut Pospiech

Size: px
Start display at page:

Download "Microbiology Helmut Pospiech"

Transcription

1 Microbiology Helmut Pospiech

2 The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition of prokaryotic species Collection of strains sharing a high degree of similarity in several independent traits Most important traits include 70% or greater DNA-DNA hybridization and 97% or greater 16S rrna gene sequence identity Brock Biology of Microorganisms, 12th ed.

3 The Species Concept in Microbiology Biological species concept not meaningful for prokaryotes as they are haploid and do not undergo sexual reproduction Genealogical species concept is an alternative Prokaryotic species is a group of strains that based on DNA sequences of multiple genes cluster closely with others phylogenetically and are distinct from other groups of strains Brock Biology of Microorganisms, 12th ed.

4 Multi-Gene Phylogenetic Analysis 16S rrna genes gyrb genes luxabfe genes Figure Brock Biology of Microorganisms, 12th ed.

5 The Species Concept in Microbiology Ecotype Population of cells that share a particular resource Different ecotypes can coexist in a habitat Bacterial speciation may occur from a combination of repeated periodic selection for a favorable trait within an ecotype and lateral gene flow Brock Biology of Microorganisms, 12th ed.

6 A Model for Bacterial Speciation Figure Brock Biology of Microorganisms, 12th ed.

7 The Species Concept in Microbiology This model is based solely on the assumption of vertical gene flow New genetic capabilities can also arise by horizontal gene transfer; the extent among bacteria is variable Brock Biology of Microorganisms, 12th ed.

8 Trouble with the Tree of Life Concept Ring of Life rather than a tree of life since the eukaryotic genome represents a fusion of a bacterial and archaeal genome (Riviera and Lake (2004), Nature 431, 152) A reticulated tree would better describe the genotypic relationship of organisms due to vast horizontal gene transfer (Doolittle (1999), Science 284, 2124; Martin (1999), BioEssays 21, 99)

9 Universal common ancestry of life on earth? a, The multiple-ancestry possibility: depicted here is life originating from two separate forms, with proteins with similar functions arising independently. Transfers, by endosymbiosis or by lateral gene transfers, are shown by dotted lines. b, A single origin (universal common ancestry), at least after the advent of protein synthesis. Correlations between patterns at different amino-acid positions are used to test between the two possibilities. Steel M & Penny D (2010) Nature 465,168.

10 The Species Concept in Microbiology No firm estimate on the number of prokaryotic species Nearly 7,000 species of Bacteria and Archaea are presently known

11 Classification and Nomenclature Classification Organization of organisms into progressively more inclusive groups on the basis of either phenotypic similarity or evolutionary relationship

12 Classification and Nomenclature Prokaryotes are given descriptive genus names and species epithets following the binomial system of nomenclature used throughout biology Assignment of names for species and higher groups of prokaryotes is regulated by the Bacteriological Code - The International Code of Nomenclature of Bacteria

13 Taxonomic Hierarchy for Allochromatium warmingii Brock Biology of Microorganisms, 13th ed.

14 14.14 Classification and Nomenclature Major references in bacterial diversity Bergey s Manual of Systematic Bacteriology (Springer) The Prokaryotes (Springer)

15 Classification and Nomenclature Formal recognition of a new prokaryotic species requires Deposition of a sample of the organism in two culture collections Official publication of the new species name and description in the International Journal of Systematic and Evolutionary Microbiology (IJSEM) The International Committee on Systematics of Prokaryotes (ICSP) is responsible for overseeing nomenclature and taxonomy of Bacteria and Archaea

16

17 Uneven distribution of components of the archaeal cell division (FtsZ, CdvBC, and actin), DNA maintenance (topoisomerases IA and IB, eukaryotic-like histones), protein ubiquitinylation, and transcription (Rpb8) systems. Such uneven distributions could result from ancient HGTs among the archaeal lineages and/or differences in the loss of multiple systems present in the last common archaeal ancestor (orange circle). Dark purple indicates a character present in all members of the corresponding lineage, whereas light purple indicates a character present in only some representatives of the lineage. Uncertainties, given the lack of a complete genome sequence for Nitrososphaera gargensis, are noted by question marks. Brochier-Armanet, Forterre & Gribaldo (2011) Current Opinion in Microbiology 14,

18 Methanogens

19 Phylogeny of Bacteria Brock Biology of Microorganisms, 13th ed.

20 Proteobacteria Largest and metabolically most diverse group of bacteria Most bacteria of industrial, agricultural or medical importance Gram-negative Metabolically extremely diverse Phenotypic classification does not match the phylogenetic relationship between the proteobacteria Brock Biology of Microorganisms, 13th ed.

21 Important groups of Proteobacteria Purple sulfur bacteria Anoxigenic photosynthesis E.g. Chromatium Non-sulfur purple bacteria Anoxigenic photosynthesis Often facultative phototrophic E.g. Rhodobacter Chemolithotrophs Nitrifying bacteria Sulfur- and iron-oxidising bacteria Hydrogen-oxidising bacteria Brock Biology of Microorganisms, 13th ed.

22 Important groups of Proteobacteria Pseudomonas and Pseudomonads Obligatory respiratory Oxidase-positive Ecologically important for aerobic decomposition of organic material in nature Often nutritionally versatile Common in soil and water Some important pathogens Brock Biology of Microorganisms, 13th ed.

23 Important groups of Proteobacteria Gram-negative cocci Include Neisseria and Moraxella Important pathogens of human N. gonorrhoeae gonerrhea N. menigitidis meningitis Vibrio and relatives Facultative anaerobes Oxidase positive Marine environments, e.g. in and on fish Often bioluminescence V. cholerae causes cholera Brock Biology of Microorganisms, 13th ed.

24 Important groups of Proteobacteria Enteric Bacteria Include many medically important pathogens Escherichia, Salmonella, Shigella, Proteus, Klebsiella and Serratia In the enterogastric tracts of mammals, on plants, aquatic environments etc. Brock Biology of Microorganisms, 13th ed.

25 Important groups of Proteobacteria Rickettsias Obligate parasites Live inside host cells Brock Biology of Microorganisms, 13th ed.

26 Important groups of Proteobacteria Spirillia Spiral-shaped bacteria Microaerophilic aerobes Bdellovibrio Prays on bacteria! Brock Biology of Microorganisms, 13th ed.

27 Important groups of Proteobacteria Myxobacteria social bacteria Forming fruiting bodies with spores But not endospores Brock Biology of Microorganisms, 13th ed.

28 Gram-positive bacteria - Firmicutes Lactic acid bacteria Streptococcus / Lactococcus Lactobacillus Endospore formers Bacillus (aerobe) Clostridium (strictly anaerobe) Heliobacteria photosynthetic

29 Gram-positive bacteria - Mullicutes Mycoplasms Parasites Without cell wall Small Smallest genomes

30 Gram-positive bacteria - Actinobacteria Corynebacteria Propionic acid bacteria Mycobacteria Many pathogens Streptomyces

Chapter 19. Microbial Taxonomy

Chapter 19. Microbial Taxonomy Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)

More information

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms

Microbiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms 1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think

More information

Figure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case)

Figure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case) Chapter 11 The Prokaryotes: Domains Bacteria and Archaea Objective Questions 1) Which of the following are found primarily in the intestines of humans? A) Gram-negative aerobic rods and cocci B) Aerobic,

More information

The Prokaryotic World

The Prokaryotic World The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,

More information

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Microbial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek

More information

Domain Bacteria. BIO 220 Microbiology Jackson Community College

Domain Bacteria. BIO 220 Microbiology Jackson Community College Domain Bacteria BIO 220 Microbiology Jackson Community College John Ireland, Ph.D. 2006 Scientific Nomenclature Domain - Bacteria Phylum Important for gross characteristics Class Intermediate characteristics

More information

Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria)

Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria) Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria) (don t study Concept 27.2) Some phyla Remember: Bacterial cell structure and shapes 1 Usually very small but some are unusually

More information

9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success

9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success 5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes

More information

Introduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani

Introduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.

More information

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.

Microbial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; fast- clock molecules for fine-structure. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University

Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,

More information

A. Incorrect! In the binomial naming convention the Kingdom is not part of the name.

A. Incorrect! In the binomial naming convention the Kingdom is not part of the name. Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific

More information

Outline. Classification of Living Things

Outline. Classification of Living Things Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics

More information

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional

More information

Prokaryotes. Chapter 27. PowerPoint Lectures for Biology, Seventh Edition. Lectures by Chris Romero. Neil Campbell and Jane Reece

Prokaryotes. Chapter 27. PowerPoint Lectures for Biology, Seventh Edition. Lectures by Chris Romero. Neil Campbell and Jane Reece Chapter 27 Prokaryotes PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: They re (Almost) Everywhere! Most prokaryotes are microscopic But

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

Universiteit van Pretoria University of Pretoria. Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March Examiners: Dr L Moleleki

Universiteit van Pretoria University of Pretoria. Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March Examiners: Dr L Moleleki Universiteit van Pretoria University of Pretoria Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March 2012 Tyd: 1 uur Time: 1 hour Eksaminatore: Dr L Moleleki Examiners: Dr L Moleleki Beantwoord

More information

A word of caution about a little knowing Lab organisms limit the view of the world of microbiology

A word of caution about a little knowing Lab organisms limit the view of the world of microbiology Diversity The world of living things (Figure from Madigan et al. 2002) Microbes in all three domains Two of the domains are exclusively prokaryotic and microbial The third contains both unicellular and

More information

1. Which of the following species have strains that are capable of undergoing the process of conjugation?

1. Which of the following species have strains that are capable of undergoing the process of conjugation? Biology 3340 Summer 2005 Second Examination Version A Name Be sure to put your name on the mark-sense sheet as well Directions: Write your name in the correct space on the mark-sense sheet and the exam

More information

Lecture 2 Carbon and Energy Transformations

Lecture 2 Carbon and Energy Transformations 1.018/7.30J Fall 2003 Fundamentals of Ecology Lecture 2 Carbon and Energy Transformations READINGS FOR NEXT LECTURE: Krebs Chapter 25: Ecosystem Metabolism I: Primary Productivity Luria. 1975. Overview

More information

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life

Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life

More information

Kingdom Monera(Archaebacteria & Eubacteria)

Kingdom Monera(Archaebacteria & Eubacteria) Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.

More information

KINGDOM MONERA. Bacterial Cell Shape 8/22/2010. The Prokaryotes: Archaebacteria and Eubacteria

KINGDOM MONERA. Bacterial Cell Shape 8/22/2010. The Prokaryotes: Archaebacteria and Eubacteria KINGDOM MONERA The Prokaryotes: Archaebacteria and Eubacteria Bacteria are the most organisms living on the Earth. (i.e. 10mL of soil contains 1 x 10 10 bacteria. They are found in nearly every habitat

More information

Ch 10. Classification of Microorganisms

Ch 10. Classification of Microorganisms Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,

More information

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution

Taxonomy. Content. How to determine & classify a species. Phylogeny and evolution Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature

More information

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.

SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES. THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR

More information

MiGA: The Microbial Genome Atlas

MiGA: The Microbial Genome Atlas December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From

More information

Chapter 26 Phylogeny and the Tree of Life

Chapter 26 Phylogeny and the Tree of Life Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin

More information

B. Correct! Bacillus anthraces produces spores that can cause anthrax. D. Incorrect! Diphtheria is caused by Corynebacterium diphtheriae.

B. Correct! Bacillus anthraces produces spores that can cause anthrax. D. Incorrect! Diphtheria is caused by Corynebacterium diphtheriae. Microbiology - Problem Drill 09 - The Prokaryotes No. 1 of 10 1. Bacillus anthraces is most closely associated with which of the following? (A) Botulism poisoning (B) Anthrax (C) Gangrene (D) Diphtheria

More information

Microbial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.

Microbial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible. Microbial Taxonomy 1. Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eucaryote, is in a mess we are stuck with it for traditional

More information

Section 18-1 Finding Order in Diversity

Section 18-1 Finding Order in Diversity Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?

More information

Chapter 1. Basics of Microbiology

Chapter 1. Basics of Microbiology Chapter 1 Basics of Microbiology Objectives How microorganisms are classified (taxonomy) What they look like (morphology) The major divisions among microorganisms based upon their function in the environment

More information

Announcements KEY CONCEPTS

Announcements KEY CONCEPTS What do these things have in common? Announcements Lab this week: bring textbook and photo atlas. Relevant reading BEFORE lab: Ch. 30 http://i.cnn.net/cnn/specials/2001/trade.center/images/anthrax.jpg

More information

Vocabulary- Bacteria (34 words)

Vocabulary- Bacteria (34 words) Biology II BACTERIA Vocabulary- Bacteria (34 words) 1. Prokaryote 21. phototroph 2. Peptidoglycan 22. chemotroph 3. Methanogen 23. obligate anaerobe 4. Halophile 24. facultative anaerobe 5. Thermoacidophile

More information

PHYLOGENY AND SYSTEMATICS

PHYLOGENY AND SYSTEMATICS AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study

More information

Fig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table

Fig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table Fig. 26.7a Biodiversity 1. Course Outline Outcomes Instructors Text Grading 2. Course Syllabus Fig. 26.7b Table 26.2-1 1 Table 26.2-2 Outline: Systematics and the Phylogenetic Revolution I. Naming and

More information

Kingdom Monera Bacteria

Kingdom Monera Bacteria Kingdom Monera Bacteria Common bacteria Prokaryotes Strep throat Anthrax Chlamydia E. coli Meningitis Salmonella Micrococcus(intestinal) Streptococcus mutans Haemophilusinfluenzae Cellphonious bacterious

More information

1. Prokaryotic Nutritional & Metabolic Adaptations

1. Prokaryotic Nutritional & Metabolic Adaptations Chapter 27B: Bacteria and Archaea 1. Prokaryotic Nutritional & Metabolic Adaptations 2. Survey of Prokaryotic Groups A. Domain Bacteria Gram-negative groups B. Domain Bacteria Gram-positive groups C. Domain

More information

Taxonomy and Biodiversity

Taxonomy and Biodiversity Chapter 25/26 Taxonomy and Biodiversity Evolutionary biology The major goal of evolutionary biology is to reconstruct the history of life on earth Process: a- natural selection b- mechanisms that change

More information

Hierarchies can be represented as trees:

Hierarchies can be represented as trees: Diversity of Life Classification - an organized scheme for grouping organisms - a tool for communication - Hierarchical - a series of successive and inclusive rankings Domain - the highest rank - contains

More information

Kharkov National Medical University. Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich

Kharkov National Medical University. Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich Kharkov National Medical University Head of Microbiology, Virology and Immunology Department Minukhin Valeriy Vladimirivich Tkachenko Victoria 1, 5, 11, 14, 19, 21, 30 Kovalenko Natalia 2, 12, 25, 29 Siritsa

More information

Biology Curriculum Pacing Guide MONTGOMERY COUNTY PUBLIC SCHOOLS

Biology Curriculum Pacing Guide MONTGOMERY COUNTY PUBLIC SCHOOLS MONTGOMERY COUNTY PUBLIC SCHOOLS Biology Curriculum Pacing Guide 1 st 9 Weeks SOL Objectives Vocabulary 7 Days 14 Days BIO.1 The student will demonstrate an understanding of scientific reasoning, logic,

More information

Intro to Prokaryotes Lecture 1 Spring 2014

Intro to Prokaryotes Lecture 1 Spring 2014 Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite

More information

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus

More information

LECTURE 13. THE BACTERIA (cont.) Photosynthetic Bacteria, phylogenetically widespread. And many Proteobacteria. Photosynthetic Bacteria

LECTURE 13. THE BACTERIA (cont.) Photosynthetic Bacteria, phylogenetically widespread. And many Proteobacteria. Photosynthetic Bacteria Photosynthetic Bacteria, phylogenetically widespread LECTURE 13 THE BACTERIA (cont.) And many Proteobacteria Photosynthetic Bacteria > Green Sulfur > Green Nonsulfur > Purple Sulfur > Purple Nonsulfur

More information

Phylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26

Phylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26 Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,

More information

2/25/2013. Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes

2/25/2013. Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes 1 2 3 4 5 6 7 8 9 10 11 12 Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes Domain Bacteria Proteobacteria From the mythical Greek god Proteus, who could assume many shapes Gram-negative

More information

TEST SUMMARY AND FRAMEWORK TEST SUMMARY

TEST SUMMARY AND FRAMEWORK TEST SUMMARY Washington Educator Skills Tests Endorsements (WEST E) TEST SUMMARY AND FRAMEWORK TEST SUMMARY BIOLOGY Copyright 2014 by the Washington Professional Educator Standards Board 1 Washington Educator Skills

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change

More information

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

Missouri Educator Gateway Assessments

Missouri Educator Gateway Assessments Missouri Educator Gateway Assessments June 2014 Content Domain Range of Competencies Approximate Percentage of Test Score I. Science and Engineering Practices 0001 0003 21% II. Biochemistry and Cell Biology

More information

MICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012

MICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012 MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular

More information

Overview of the major bacterial pathogens The major bacterial pathogens are presented in this table:

Overview of the major bacterial pathogens The major bacterial pathogens are presented in this table: Practical Microbiology 30/11/2018 University of Sulaimani college of Pharmacy Year2 Lab. 5: Overview of the major bacterial pathogens The major bacterial pathogens are presented in this table: Major Bacterial

More information

Scientific names allow scientists to talk about particular species without confusion

Scientific names allow scientists to talk about particular species without confusion Unit 9 Test Review KEY a. Explain the history, purpose, and methods of taxonomy What is taxonomy? the science of naming and classifying organisms Who came up with it? Linnaeus Why do we use taxonomy? Scientific

More information

Obligate anaerobes - cannot grow in the presence of oxygen Facultative anaerobes - can grow with or without oxygen Aerobic - require oxygen

Obligate anaerobes - cannot grow in the presence of oxygen Facultative anaerobes - can grow with or without oxygen Aerobic - require oxygen PROKARYOTES *include bacteria and archaea *singular: bacterium / plural: bacteria PROPERTIES 1. Bacteria are classified into two kingdoms: Eubacteria (true bacteria) and Archaebacteria (Ancient Bacteria).

More information

Bacteria & Archaea. Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school

Bacteria & Archaea. Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school Bacteria & Archaea Ms.Tanyaratana Dumkua Biology Department, MahidolWittayanusorn school What is the bacteria? http://www.unc.edu/depts/tcf/mycoplasma.gif http://gsbs.utmb.edu/microbook/images/fig37_1.jpg

More information

Outline. Viruses, Bacteria, and Archaea. Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea

Outline. Viruses, Bacteria, and Archaea. Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea Viruses, Bacteria, and Archaea Chapter 21 Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea Outline The Viruses The Viruses Viruses are noncellular

More information

Sec$on 9. Evolu$onary Rela$onships

Sec$on 9. Evolu$onary Rela$onships Sec$on 9 Evolu$onary Rela$onships Sec$on 9 Learning Goals Explain why the ribosomal 16S gene is a good marker for molecular phylogene$c comparisons. Be able to interpret a phylogene$c tree. Explain the

More information

Classifying Prokaryotes: Eubacteria Plasma Membrane. Ribosomes. Plasmid (DNA) Capsule. Cytoplasm. Outer Membrane DNA. Flagellum.

Classifying Prokaryotes: Eubacteria Plasma Membrane. Ribosomes. Plasmid (DNA) Capsule. Cytoplasm. Outer Membrane DNA. Flagellum. Bacteria The yellow band surrounding this hot spring is sulfur, a waste product of extremophilic prokaryotes, probably of the Domain Archaea, Kingdom Archaebacteria. Bacteria are prokaryotic cells (no

More information

Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics

Stepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...

More information

Major Events in the History of Earth

Major Events in the History of Earth Major Events in the History of Earth Cenozoic Humans Land plants Animals Origin of solar system and Earth Multicellular eukaryotes 1 Proterozoic eon 2 Archaean eon 3 4 Single-celled eukaryotes Atmospheric

More information

CLASSIFICATION. Why Classify? 2/18/2013. History of Taxonomy Biodiversity: variety of organisms at all levels from populations to ecosystems.

CLASSIFICATION. Why Classify? 2/18/2013. History of Taxonomy Biodiversity: variety of organisms at all levels from populations to ecosystems. Why Classify? Classification has been around ever since people paid attention to organisms. CLASSIFICATION One primeval system was based on harmful and non-harmful organisms. Life is easier when we organize

More information

Text of objective. Investigate and describe the structure and functions of cells including: Cell organelles

Text of objective. Investigate and describe the structure and functions of cells including: Cell organelles This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004

More information

Burton's Microbiology for the Health Sciences

Burton's Microbiology for the Health Sciences Burton's Microbiology for the Health Sciences Chapter 3. Cell Structure and Taxonomy Chapter 3 Outline Introduction Eucaryotic Cell Structure Procaryotic Cell Structure Summary of Structural Differences

More information

TER 26. Preview for 2/6/02 Dr. Kopeny. Bacteria and Archaea: The Prokaryotic Domains. Nitrogen cycle

TER 26. Preview for 2/6/02 Dr. Kopeny. Bacteria and Archaea: The Prokaryotic Domains. Nitrogen cycle Preview for 2/6/02 Dr. Kopeny Bacteria and Archaea: The Prokaryotic Domains TER 26 Nitrogen cycle Mycobacterium tuberculosis Color-enhanced images shows rod-shaped bacterium responsible for tuberculosis

More information

COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.

COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01

More information

Section Title: Archaebacteria vs. Eubacteria

Section Title: Archaebacteria vs. Eubacteria Unit: 3.1 Name: Section Title: Archaebacteria vs. Eubacteria Latin Root Word: Review of Old Information: None New Information: Bacteria Notes Basic Bacteria Facts Classification of Bacteria: Kingdom Archaebacteria

More information

A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems

A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems A Novel Ribosomal-based Method for Studying the Microbial Ecology of Environmental Engineering Systems Tao Yuan, Asst/Prof. Stephen Tiong-Lee Tay and Dr Volodymyr Ivanov School of Civil and Environmental

More information

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic

More information

Classification. Old 5 Kingdom system. New 3 Domain system. reflects a greater understanding of evolution & molecular evidence

Classification. Old 5 Kingdom system. New 3 Domain system. reflects a greater understanding of evolution & molecular evidence Classification Old 5 Kingdom system Monera, Protists, Plants, Fungi, Animals New 3 Domain system reflects a greater understanding of evolution & molecular evidence Prokaryote: Bacteria Prokaryote: Archaebacteria

More information

Ch 3. Bacteria and Archaea

Ch 3. Bacteria and Archaea Ch 3 Bacteria and Archaea SLOs for Culturing of Microorganisms Compare and contrast the overall cell structure of prokaryotes and eukaryotes. List structures all bacteria possess. Describe three basic

More information

Chapter 16: Reconstructing and Using Phylogenies

Chapter 16: Reconstructing and Using Phylogenies Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/

More information

Game plan Lecture Lab Prelabs

Game plan Lecture Lab Prelabs Game plan Lecture Binary fission Growth curves Physical requirements for growth Chemical requirements for growth Lab Lab Exam Prelabs Growth Curve Bring books and APO-3 for next class Microbial growth

More information

SPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together

SPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together SPECIATION Origin of new species=speciation -Process by which one species splits into two or more species, accounts for both the unity and diversity of life SPECIES BIOLOGICAL CONCEPT Population or groups

More information

Overview: Masters of Adaptation. Prokaryotes thrive almost everywhere, including places too acidic, salty, cold, or hot for most other organisms

Overview: Masters of Adaptation. Prokaryotes thrive almost everywhere, including places too acidic, salty, cold, or hot for most other organisms Chapter 27 Bacteria and Archaea Overview: Masters of Adaptation Prokaryotes thrive almost everywhere, including places too acidic, salty, cold, or hot for most other organisms They have an astonishing

More information

Chapter 21 PROKARYOTES AND VIRUSES

Chapter 21 PROKARYOTES AND VIRUSES Chapter 21 PROKARYOTES AND VIRUSES Bozeman Video classification of life http://www.youtube.com/watch?v=tyl_8gv 7RiE Impacts, Issues: West Nile Virus Takes Off Alexander the Great, 336 B.C., conquered a

More information

A. Correct! Taxonomy is the science of classification. B. Incorrect! Taxonomy is the science of classification.

A. Correct! Taxonomy is the science of classification. B. Incorrect! Taxonomy is the science of classification. DAT - Problem Drill 07: Diversity of Life Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. What is taxonomy? Question #01 (A) Taxonomy

More information

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics

Chapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus

More information

The Prokaryotes: Domains Bacteria and Archaea

The Prokaryotes: Domains Bacteria and Archaea PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 11 The Prokaryotes: Domains Bacteria and Archaea Table 11.1 Classification of Selected Prokaryotes*

More information

Characteristics. Nucleoid Region single circular chromosome plasmids mesosome

Characteristics. Nucleoid Region single circular chromosome plasmids mesosome Prokaryotes Characteristics Nucleoid Region single circular chromosome plasmids mesosome No membranebound organelles Ribosomes (70S) Plasma membrane Cell wall peptidoglycan Capsule glycocalyx Flagella

More information

Mid-Year Exam Review

Mid-Year Exam Review Biology 504 Mid-Year Exam Review Name: Spontaneous Generation Ch. 2 Heath Biology 1. What is meant by spontaneous generation? Give 3 examples of the appearance of living things that people believed were

More information

Biology 211 (2) Week 1 KEY!

Biology 211 (2) Week 1 KEY! Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of

More information

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan

Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes

More information

Chapters 25 and 26. Searching for Homology. Phylogeny

Chapters 25 and 26. Searching for Homology. Phylogeny Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The

More information

9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification

9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains and Kingdoms Click on a lesson name to select. Early Systems of Classification Biologists use a system of classification

More information

TRACING BACK TO THE BEGINNING

TRACING BACK TO THE BEGINNING BACTERIA! TRACING BACK TO THE BEGINNING PROKARYOTES KINGDOM EUBACTERIA KINGDOM ARCHAEBACTERIA CHARACTERISTICS: 1. NO NUCLEUS 2. NO MEMBRANE BOUND ORGANELLES 4. MOST ARE SMALLER THAN EUKARYOTES 5. ARE SINGLE-CELLED

More information

There are 5 kingdoms: Animalia multicellular animals, heterotrophic (eat other things), evolved 700,000,000 years ago (1,000,000 2,000,000 species)

There are 5 kingdoms: Animalia multicellular animals, heterotrophic (eat other things), evolved 700,000,000 years ago (1,000,000 2,000,000 species) Classification The modern system of naming gives each living thing 7 names. Each name is a little more specific than the one before it. The categories are (in order from least to most specific): Kingdom

More information

Phylogenetic Diversity of Coliform Isolates in USA. Phylogenetic Classification

Phylogenetic Diversity of Coliform Isolates in USA. Phylogenetic Classification Phylogenetic Diversity of Coliform Isolates in USA Ya Zhang and Wen Tso Liu University of Illinois at Urbana Champaign Mark LeChevallier American Water Inc. Nov 2011 Phylogenetic Classification group organisms

More information

016/03/11/world/bact eria-discoveryplastic/index.html

016/03/11/world/bact eria-discoveryplastic/index.html PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 11 Characterizing and Classifying Prokaryotes http://www.cnn.com/2 016/03/11/world/bact

More information

Phylogeny & Systematics

Phylogeny & Systematics Phylogeny & Systematics Phylogeny & Systematics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite

More information

Evolution Problem Drill 09: The Tree of Life

Evolution Problem Drill 09: The Tree of Life Evolution Problem Drill 09: The Tree of Life Question No. 1 of 10 Question 1. The age of the Earth is estimated to be about 4.0 to 4.5 billion years old. All of the following methods may be used to estimate

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

BACTERIA AND ARCHAEA 10/15/2012

BACTERIA AND ARCHAEA 10/15/2012 BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in

More information

Biol 1409: Study Guide for Exam I. Introduction to Diversity

Biol 1409: Study Guide for Exam I. Introduction to Diversity Biol 1409: Study Guide for Exam I Introduction to Diversity 1. Define Biosphere and describe where it is found 2. Describe why our planet is so hospitable to life 3. Name and briefly describe the major

More information

Characterizing and Classifying Prokaryotes

Characterizing and Classifying Prokaryotes PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 11 Characterizing and Classifying Prokaryotes Bacteria as Plastic Recyclers http://www.cnn.com/2016/03/11/world/b

More information

Phys 214. Planets and Life

Phys 214. Planets and Life Phys 214. Planets and Life Dr. Cristina Buzea Department of Physics Room 259 E-mail: cristi@physics.queensu.ca (Please use PHYS214 in e-mail subject) Lecture 16. Phylogenetic tree. Metabolism. Carbon and

More information

Prokaryotes Vs. Eukaryotes

Prokaryotes Vs. Eukaryotes The Microbial World Prokaryotes Vs. Eukaryotes Mircrobes of the Ocean Primary Producers Are the organisms that produce bio-mass from inorganic compounds (autotrophs). -Photosynthetic autotrophs Phytoplankton

More information