Essentiality in B. subtilis
|
|
- Doris Nelson
- 5 years ago
- Views:
Transcription
1 Essentiality in B. subtilis 100% 75% Essential genes Non-essential genes Lagging 50% 25% Leading 0% non-highly expressed highly expressed non-highly expressed highly expressed 1 adanchin@pasteur.fr
2 Distribution of highly expressed genes Fast growers Slow growers 70% 60% 50% B. subtilis E. coli C. crescentus M. tuberculosis Highly expressed genes cluster near the origin in fast-growing bacteria 40% 30% 20% Origin Middle Ori 10% Terminus 0% Ter E. Rocha 2 adanchin@pasteur.fr
3 . E. Rocha Gene order conservation Buchnera Bp Chlamydia muridarum 16S:.076 Buchnera Ap nt-1 Chlamydia pneumoniae 16S:.071 nt -1 Escherichia coli origin terminus Bacillus subtilis 16S:.063 nt -1 Yersinia Genetics pestisof Bacterial Genomes Institut Pasteur Bacillus halodurans 3 adanchin@pasteur.fr 16S:.051 nt -1
4 Exploring neighborhoods Genes do not operate in isolation Proteins are part of complexes, as are parts in an engine It is important to understand their relationships, as those in the planks which make a boat 4 adanchin@pasteur.fr
5 Exploring neighborhoods To make discoveries we explore the general «neighborhoods» of genes of interest: proximity in the chromosome, in evolution, in the literature, in biochemical complexes, in metabolism etc. Comparative genomics is essential, hence the launching of several parallel genome programs 5 adanchin@pasteur.fr
6 Gene vicinity: synteny C. Médigue 6 adanchin@pasteur.fr
7 What is Life? Three processes are needed for Life: Information transfer: groups of co-variant gene expression Driving force for a coupling between the genome structure and the structure of the cell: Metabolism (Internal organisation) Compartmentalization (General structure) 7 adanchin@pasteur.fr
8 Co-variation of gene expression Collecting data using large scale genomics techniques : DNA chips and protein fingerprinting 8 adanchin@pasteur.fr
9 Expression neighborhood: all genes on a chip Green: First condition Red: Second condition Yellow: no difference Two conditions are compared on the same chip 9 adanchin@pasteur.fr
10 Protein fingerprinting A technique named «twodimensional gel electrophoresis» allows one to separate all the proteins of a cell, and to color them. Once colored, proteins are sorted and identified by «mass spectrometry». Different cells or cells in different environments have a different pattern, exactly as individuals have different fingerprints adanchin@pasteur.fr
11 What is Life? Three processes are needed for Life: Information transfer Driving force for a coupling between the genome structure and the structure of the cell: Metabolism (Internal organisation) Compartmentalization (General structure) 11 adanchin@pasteur.fr
12 Metabolic neighborhoods: Chemical pathways Often, drug targets are found in metabolic pathways. The idea is to mimick a normal molecule in the cell and to replace it by a similar one which kills the activity of some protein: this is exactly what poisons do! Antibiotics are poisons of a special kind, which act against microbes: to discover a new antibiotic is to discover a self-consistent pathway 12 adanchin@pasteur.fr
Comparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationAround the dynamics of bacterial genomes
Around the dynamics of bacterial genomes Eduardo P. C. Rocha erocha@pasteur.fr Unité Génétique des Génomes Bactériens, CNRS URA2171,Institut Pasteur Atelier de BioInformatique, Université Pierre et Marie
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationAP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
More informationThe Minimal-Gene-Set -Kapil PHY498BIO, HW 3
The Minimal-Gene-Set -Kapil Rajaraman(rajaramn@uiuc.edu) PHY498BIO, HW 3 The number of genes in organisms varies from around 480 (for parasitic bacterium Mycoplasma genitalium) to the order of 100,000
More informationObligate anaerobes - cannot grow in the presence of oxygen Facultative anaerobes - can grow with or without oxygen Aerobic - require oxygen
PROKARYOTES *include bacteria and archaea *singular: bacterium / plural: bacteria PROPERTIES 1. Bacteria are classified into two kingdoms: Eubacteria (true bacteria) and Archaebacteria (Ancient Bacteria).
More informationGenetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
More informationIntroduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
More information2 Genome evolution: gene fusion versus gene fission
2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,
More informationpglo/amp R Bacterial Transformation Lab
pglo/amp R Bacterial Transformation Lab Name: Date: Purpose: To gain an understanding of the techniques of culturing E. coli bacteria and transforming E. coli bacteria using genetic engineering. Introduction:
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationBacteria are very small
BACTERIA BACTERIA Bacteria are very small Bacteria are very small compared to cells with nuclei This is a pore in human skin and the yellow spheres are bacteria BACTERIA LIVE ALMOST EVERYWHERE Hot springs
More informationBacteria are very small
BACTERIA BACTERIA Bacteria are very small Bacteria are very small compared to cells with nuclei (Eukaryotic cells) This is a pore in human skin and the yellow spheres are bacteria CLASSIFICATION OF BACTERIA
More informationSupplementary Information
Supplementary Information 1 List of Figures 1 Models of circular chromosomes. 2 Distribution of distances between core genes in Escherichia coli K12, arc based model. 3 Distribution of distances between
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationthe noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
More informationTopic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
More informationMicrobe Mission B Test
Microbe Mission B Test Science Olympiad North Regional Tournament at the University of Florida Rank: Points: Name(s): Team Name: School Name: Team Number: Part 1: Microscopes Names the following structures
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationElectrochemical Potential and the Thermodynamic Basis of Solute Transport Mechanisms
Electrochemical Potential and the Thermodynamic Basis of Solute Transport Mechanisms A. Electrochemical Potential The electrochemical potential arising from the distribution of a solute A across a membrane
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationName: SAMPLE EOC PROBLEMS
Name: SAMPLE EOC PROBLEMS 1.Bromothymol blue (BTB) is a ph indicator that is also used to detect carbon dioxide (CO2). BTB is blue when ph is basic and CO2 is low. BTB is yellow when ph is acidic and CO2
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationWHAT DO CELLS DO? CHALLENGE QUESTION. What are the functions of the structures inside of cells?
WHAT DO CELLS DO? CHALLENGE QUESTION What are the functions of the structures inside of cells? WHAT DO CELLS DO? Understanding normal cell structures and their functions help scientists understand how
More informationBACTERIA. CLS 212: Medical Microbiology Miss Zeina Alkudmani
BACTERIA CLS 212: Medical Microbiology Miss Zeina Alkudmani Prokaryotes Prokaryotic cells possess simpler structures than eukaryotic cells, since they do not have a nucleus or a lot of cytoplasmic organelles.
More informationBasic modeling approaches for biological systems. Mahesh Bule
Basic modeling approaches for biological systems Mahesh Bule The hierarchy of life from atoms to living organisms Modeling biological processes often requires accounting for action and feedback involving
More informationMolecular and cellular biology is about studying cell structure and function
Chapter 1 Exploring the World of the Cell In This Chapter Discovering the microscopic world Getting matter and energy Reading the genetic code Molecular and cellular biology is about studying cell structure
More informationMicrobe Mission C Test
Microbe Mission C Test Science Olympiad North Regional Tournament at the University of Florida Rank: Points: Name(s): Team Name: School Name: Team Number: Page 2 Part 1: Microscopes Names the following
More informationMicrobial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationPrinciples of Biotechnology Lectures of week 4 MICROBIOLOGY AND BIOTECHNOLOGY
Principles of Biotechnology Lectures of week 4 MICROBIOLOGY AND BIOTECHNOLOGY INTRODUCTION TO MICROBIOLOGY What are microbes? Germs, microbe s s microorganisms are minute living things that individually
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationThe two daughter cells are genetically identical to each other and the parent cell.
Prokaryote Growth and Reproduction This micrograph shows a bacillus bacteria (probably E. coli) undergoing binary fission. This is a form of asexual reproduction. During prokaryotic binary fission, as
More informationCreating a Dichotomous Key
Dichotomous Keys A tool used that allows users to determine the identity of unknown species Keys consist of a series of choices, where the user selects from a series of connected pairs Each pair of choices
More informationTER 26. Preview for 2/6/02 Dr. Kopeny. Bacteria and Archaea: The Prokaryotic Domains. Nitrogen cycle
Preview for 2/6/02 Dr. Kopeny Bacteria and Archaea: The Prokaryotic Domains TER 26 Nitrogen cycle Mycobacterium tuberculosis Color-enhanced images shows rod-shaped bacterium responsible for tuberculosis
More informationThe EcoCyc Database. January 25, de Nitrógeno, UNAM,Cuernavaca, A.P. 565-A, Morelos, 62100, Mexico;
The EcoCyc Database Peter D. Karp, Monica Riley, Milton Saier,IanT.Paulsen +, Julio Collado-Vides + Suzanne M. Paley, Alida Pellegrini-Toole,César Bonavides ++, and Socorro Gama-Castro ++ January 25, 2002
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More informationComputational approaches for functional genomics
Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding
More informationHigh-resolution 3D models of Caulobacter crescentus chromosome reveal genome structural variability and organization
Published online 26 February 2018 Nucleic Acids Research, 2018, Vol. 46, No. 8 3937 3952 doi: 10.1093/nar/gky141 High-resolution 3D models of Caulobacter crescentus chromosome reveal genome structural
More informationMICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012
MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular
More informationSubsystem: Succinate dehydrogenase
Subsystem: Succinate dehydrogenase Olga Vassieva Fellowship for Interpretation of Genomes The super-macromolecular respiratory complex II (succinate:quinone oxidoreductase) couples the oxidation of succinate
More informationBiology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationA pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa.
1 A pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa. Protozoa are single celled eukaryotic organisms. Some protozoa are pathogens.
More informationBacteria and Viruses. 1 Bacteria CHAPTER 18. MAINIDEA Bacteria are prokaryotic cells.
CHAPTER 18 Bacteria and Viruses 1 Bacteria 7(F), 8(B), 8(C), 11(C), 12(A) Before You Read When you hear the word bacteria, what comes to mind? On the lines below, describe places you think bacteria might
More informationKingdom Monera Bacteria
Kingdom Monera Bacteria Common bacteria Prokaryotes Strep throat Anthrax Chlamydia E. coli Meningitis Salmonella Micrococcus(intestinal) Streptococcus mutans Haemophilusinfluenzae Cellphonious bacterious
More informationStreptomyces Linear Plasmids: Their Discovery, Functions, Interactions with Other Replicons, and Evolutionary Significance
Microbiol Monogr (7) F. Meinhardt R. Klassen: Microbial Linear Plasmids DOI 10.1007/7171_2007_097/Published online: 27 June 2007 Springer-Verlag Berlin Heidelberg 2007 Streptomyces Linear Plasmids: Their
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationProteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
More informationKingdom Monera(Archaebacteria & Eubacteria)
Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationTHE EDIBLE OPERON David O. Freier Lynchburg College [BIOL 220W Cellular Diversity]
THE EDIBLE OPERON David O. Freier Lynchburg College [BIOL 220W Cellular Diversity] You have the following resources available to you: Short bread cookies = DNA / genetic elements Fudge Mint cookies = RNA
More informationINTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA
INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA XIUFENG WAN xw6@cs.msstate.edu Department of Computer Science Box 9637 JOHN A. BOYLE jab@ra.msstate.edu Department of Biochemistry and Molecular Biology
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More informationMolecular evolution - Part 1. Pawan Dhar BII
Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationPlant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
More informationDesign of an Enterobacteriaceae Pan-genome Microarray Chip
Design of an Enterobacteriaceae Pan-genome Microarray Chip Oksana Lukjancenko and David W. Ussery DTU CBS 2010 2 Background Pan-genome complete collection of variuos genes located within populations at
More informationIstituto di Microbiologia. Università Cattolica del Sacro Cuore, Roma. Gut Microbiota assessment and the Meta-HIT program.
Istituto di Microbiologia Università Cattolica del Sacro Cuore, Roma Gut Microbiota assessment and the Meta-HIT program Giovanni Delogu 1 Most of the bacteria species living in the gut cannot be cultivated
More informationMicrobial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
More informationBiology. Revisiting Booklet. 6. Inheritance, Variation and Evolution. Name:
Biology 6. Inheritance, Variation and Evolution Revisiting Booklet Name: Reproduction Name the process by which body cells divide:... What kind of cells are produced this way? Name the process by which
More informationChapter 21 PROKARYOTES AND VIRUSES
Chapter 21 PROKARYOTES AND VIRUSES Bozeman Video classification of life http://www.youtube.com/watch?v=tyl_8gv 7RiE Impacts, Issues: West Nile Virus Takes Off Alexander the Great, 336 B.C., conquered a
More informationTopology. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
Topology 1 Introduction 2 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 G+C content 7 Codon usage 27 marc.bailly-bechet@univ-lyon1.fr The big picture Eukaryota Bacteria Many linear chromosomes
More informationThe percentage of bacterial genes on leading versus lagging strands is influenced by multiple balancing forces
The percentage of bacterial genes on leading versus lagging strands is influenced by multiple balancing forces Xizeng Mao 1, Han Zhang 1,4, Yanbin Yin 1, 2 1, 2, 3, Ying Xu 1 Computational Systems Biology
More informationNOTES - Ch. 16 (part 1): DNA Discovery and Structure
NOTES - Ch. 16 (part 1): DNA Discovery and Structure By the late 1940 s scientists knew that chromosomes carry hereditary material & they consist of DNA and protein. (Recall Morgan s fruit fly research!)
More information15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
More informationNotes - Microbiology Monera
Notes - Microbiology Monera Part 1 Classification - Kingdom moneran is more commonly known as bacteria. This is the largest kingdom with inhabitants covering almost every square metre of the planet! -
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationVital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
More informationTeacher s Guide For. Core Biology: Microbiology and Genetics
Teacher s Guide For Core Biology: Microbiology and Genetics For grade 7 - College Programs produced by Centre Communications, Inc. for Ambrose Video Publishing, Inc. Executive Producer William V. Ambrose
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationBACTERIA AND ARCHAEA 10/15/2012
BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in
More informationPlease complete the Participant Card
Flower Forensics 1 Please complete the Participant Card 2 Put your student hat on Experience the kit Put your teacher hat on Envision classroom use Curriculum integration Support for students 3 Flower
More informationAnnouncements KEY CONCEPTS
What do these things have in common? Announcements Lab this week: bring textbook and photo atlas. Relevant reading BEFORE lab: Ch. 30 http://i.cnn.net/cnn/specials/2001/trade.center/images/anthrax.jpg
More informationEvaluation of the relative contribution of each STRING feature in the overall accuracy operon classification
Evaluation of the relative contribution of each STRING feature in the overall accuracy operon classification B. Taboada *, E. Merino 2, C. Verde 3 blanca.taboada@ccadet.unam.mx Centro de Ciencias Aplicadas
More informationName Period The Control of Gene Expression in Prokaryotes Notes
Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationExhaustive search. CS 466 Saurabh Sinha
Exhaustive search CS 466 Saurabh Sinha Agenda Two different problems Restriction mapping Motif finding Common theme: exhaustive search of solution space Reading: Chapter 4. Restriction Mapping Restriction
More informationMining Infrequent Patterns of Two Frequent Substrings from a Single Set of Biological Sequences
Mining Infrequent Patterns of Two Frequent Substrings from a Single Set of Biological Sequences Daisuke Ikeda Department of Informatics, Kyushu University 744 Moto-oka, Fukuoka 819-0395, Japan. daisuke@inf.kyushu-u.ac.jp
More informationLECTURE 13. THE BACTERIA (cont.) Photosynthetic Bacteria, phylogenetically widespread. And many Proteobacteria. Photosynthetic Bacteria
Photosynthetic Bacteria, phylogenetically widespread LECTURE 13 THE BACTERIA (cont.) And many Proteobacteria Photosynthetic Bacteria > Green Sulfur > Green Nonsulfur > Purple Sulfur > Purple Nonsulfur
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationAntimicrobial peptides
Název: Školitel: Antimicrobial peptides Zbyněk Heger Datum: 2. 8. 2013 Reg.č.projektu: CZ.1.07/2.4.00/31.0023 Název projektu: Partnerská síť centra excelentního bionanotechnologického výzkumu 2 Content
More informationUnit 3: Control and regulation Higher Biology
Unit 3: Control and regulation Higher Biology To study the roles that genes play in the control of growth and development of organisms To be able to Give some examples of features which are controlled
More informationCells & Bacteria Notes
Cells & Bacteria Notes 4 Major Macromolecules Macromolecules are large molecules. The four groups of macromolecules are essential to the structure and function of a cell. Group Building Block Large Molecule
More informationClassifying Prokaryotes: Eubacteria Plasma Membrane. Ribosomes. Plasmid (DNA) Capsule. Cytoplasm. Outer Membrane DNA. Flagellum.
Bacteria The yellow band surrounding this hot spring is sulfur, a waste product of extremophilic prokaryotes, probably of the Domain Archaea, Kingdom Archaebacteria. Bacteria are prokaryotic cells (no
More informationSystems biology and complexity research
Systems biology and complexity research Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Interdisciplinary Challenges for
More informationBioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More informationGenetic Material Uptake in E. Coli
Genetic Material Uptake in E. Coli Christine Watkins 31 March 2015 Lab Group Number: 7 Taylor BIOL 1111: General Biology I Lab Spring 2015 Lab Section: 103 Lab Instructor: Alex Aitken Genetic Material
More information1. Which of the following species have strains that are capable of undergoing the process of conjugation?
Biology 3340 Summer 2005 Second Examination Version A Name Be sure to put your name on the mark-sense sheet as well Directions: Write your name in the correct space on the mark-sense sheet and the exam
More informationLecture 3: A basic statistical concept
Lecture 3: A basic statistical concept P value In statistical hypothesis testing, the p value is the probability of obtaining a result at least as extreme as the one that was actually observed, assuming
More informationLeeuwenhoek s Animacules
Leeuwenhoek s Animacules Early History of Microbiology: 1668 Francesco Redi disproves spontaneous generation 1676 Antony van Leeuwenhoek first observes microbes 1861 Louis Pasteur disproves spontaneous
More informationLeeuwenhoek s Animacules. Early History of Microbiology: Fig. 1.4
Leeuwenhoek s Animacules Early History of Microbiology: 1668 Francesco Redi disproves spontaneous generation 1676 Antony van Leeuwenhoek first observes microbes 1861 Louis Pasteur disproves spontaneous
More informationThis document describes the process by which operons are predicted for genes within the BioHealthBase database.
1. Purpose This document describes the process by which operons are predicted for genes within the BioHealthBase database. 2. Methods Description An operon is a coexpressed set of genes, transcribed onto
More information