BIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total)
|
|
- Victoria Park
- 5 years ago
- Views:
Transcription
1 BIMS 503 Exam I September 24, 2007 _ / Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) Questions 1-6 refer to this situation: You are able to partially purify an enzyme activity from the membrane fraction of the bacterium, Thermotoga maritima. The enzyme activity hydrolyzes phosphate from deoxyribonucleotides. Silver stained SDS-PAGE shows three distinct bands that have co-purified but you do not know which protein band(s) correspond(s) to your enzyme. 1. (10 pts) Give a strategy for identifying the complete primary structure of the unknown protein. Provide the names or descriptions of the biochemical manipulations and the analytical tools you would use to identify the protein. Specific names of the tools are not necessary but state their purpose and what information they provide. Give the expected results from each step and potential problems. The strategy should include more than one approach to demonstrate convincingly that a particular protein band is responsible for the deoxyribonucleotide phospho-hydrolase activity. You may assume that the complete Thermotoga maritima genomic sequence is known. 1
2 2. (5 points). Thermotoga maritima, as the name implies, is a thermophilic bacterium which normally lives at temperatures above 80 C. What structural features of this protein would you expect to allow it to remain folded and active at such high temperatures? Please explain your answers. 2
3 3. (3 pts) Now that you have the primary structure, you find there are no obvious stretches of hydrophobic amino acids that would indicate a transmembrane segment. Furthermore, hydropathy analyses also predict a low likelihood of an integral membrane protein. Suggest possible structural motifs that could explain association with the membrane. 4. (3 pts) In taking an absorbance spectrum of the purified protein, you find that there is an unexpectedly high absorbance in the range of wavelengths 270 to 295 nm. What amino acid(s) would you expect this protein to have in exceptional abundance? 5. (3 pts) Despite thermal stability, you find that the enzymatic activity is very sensitive to molecular oxygen or oxidative conditions. What amino acids may be involved in this oxidative inactivation? 6. (3 pts) What methods might you use to estimate the types of secondary structure that make up this protein? 3
4 7. (7 pts) In Anfinsen s classical protein folding experiment, what do you expect to be the results in Experiment A versus Experiment B? Please explain your answers. A B 8. (6 pts) In Anfinsen s experiment discussed on the previous question, the ribonuclease will fold properly even if kept in a reducing environment. What are the main driving forces that lead to the proper folding? 4
5 September 24, 2007 Name: / Questions from Sepideh Khorasanizadeh (60 pts. Total) Question 1 (10 pts): a) What is Stokes shift? b) What is fluorescence quantum yield? c) Tyrosine and tryptophan have similar values of quantum yield, why is the fluorescence sensitivity of tryptophan four times that of tyrosine? 5
6 Question 2 (10 pts): a) The Circular Dichroism bands of proteins occur in two distinct regions of the UV spectrum, name these regions? b) Draw hypothetical CD spectra for two types of protein secondary structure? c) Write the appropriate units on the x and y axes of the above CD spectra? d) How would you expect these spectra to change upon addition of 6 M guanidinium hydrochloride? 6
7 Question 3 (10 pts): a) Define NMR chemical shift. b) Draw a hypothetical 1D ^1 H NMR spectrum of a protein? c) Mark the expected locations for backbone amides and side chain methyl groups? d) Which coupling interactions are measured in 2D experiments ^1 H-^1 H NOESY and ^1 H-^1 H COSY? 7
8 Question 4 (10 pts): a) List three nuclei that are NMR active and useful for protein structure analysis? b) How may the HSQC experiment be used for analysis of protein structure and function? Question 5 (10 pts): a) What is the van der Waals radius? b) What is the length of the van der Waals radius associated with a methyl group? c) What is a hydrogen bond? d) Draw an example of a hydrogen bond occurring in protein structure and indicate the distance of this bond? 8
9 Question 6 (10 pts): a) How is NMR spectroscopy used to detect the dynamics of hydrogen bonds in a protein? b) Give two examples for ^15 N relaxation NMR measurements, and indicate what information is revealed from each experiment? 9
Spectroscopy Chapter 13
Spectroscopy Chapter 13 Electromagnetic Spectrum Electromagnetic spectrum in terms of wavelength, frequency and Energy c=λν c= speed of light in a vacuum 3x108 m/s v= frequency in Hertz (Hz s-1 ) λ= wavelength
More informationPrinciples of Physical Biochemistry
Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationNanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 40% midterm, 60% final report (oral + written)
Nanobiotechnology Place: IOP 1 st Meeting Room Time: 9:30-12:00 Reference: Review Papers Grade: 40% midterm, 60% final report (oral + written) Midterm: 5/18 Oral Presentation 1. 20 minutes each person
More informationContents. xiii. Preface v
Contents Preface Chapter 1 Biological Macromolecules 1.1 General PrincipIes 1.1.1 Macrornolecules 1.2 1.1.2 Configuration and Conformation Molecular lnteractions in Macromolecular Structures 1.2.1 Weak
More informationProtein folding. Today s Outline
Protein folding Today s Outline Review of previous sessions Thermodynamics of folding and unfolding Determinants of folding Techniques for measuring folding The folding process The folding problem: Prediction
More information2. In regards to the fluid mosaic model, which of the following is TRUE?
General Biology: Exam I Sample Questions 1. How many electrons are required to fill the valence shell of a neutral atom with an atomic number of 24? a. 0 the atom is inert b. 1 c. 2 d. 4 e. 6 2. In regards
More informationFluorescence and Nuclear Magnetic Resonance (NMR) Spectroscopy
Fluorescence and Nuclear Magnetic Resonance (NMR) Spectroscopy Murphy, B. (2017). Fluorescence and Nuclear Magnetic Resonance Spectroscopy: Lecture 3. Lecture presented at PHAR 423 Lecture in UIC College
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationAdvanced Certificate in Principles in Protein Structure. You will be given a start time with your exam instructions
BIRKBECK COLLEGE (University of London) Advanced Certificate in Principles in Protein Structure MSc Structural Molecular Biology Date: Thursday, 1st September 2011 Time: 3 hours You will be given a start
More informationBiochemistry Quiz Review 1I. 1. Of the 20 standard amino acids, only is not optically active. The reason is that its side chain.
Biochemistry Quiz Review 1I A general note: Short answer questions are just that, short. Writing a paragraph filled with every term you can remember from class won t improve your answer just answer clearly,
More informationProtein NMR. Bin Huang
Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for
More informationF. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1
Zhou Pei-Yuan Centre for Applied Mathematics, Tsinghua University November 2013 F. Piazza Center for Molecular Biophysics and University of Orléans, France Selected topic in Physical Biology Lecture 1
More informationCopyright Mark Brandt, Ph.D A third method, cryogenic electron microscopy has seen increasing use over the past few years.
Structure Determination and Sequence Analysis The vast majority of the experimentally determined three-dimensional protein structures have been solved by one of two methods: X-ray diffraction and Nuclear
More informationThe protein folding problem consists of two parts:
Energetics and kinetics of protein folding The protein folding problem consists of two parts: 1)Creating a stable, well-defined structure that is significantly more stable than all other possible structures.
More informationProblem Set 1
2006 7.012 Problem Set 1 Due before 5 PM on FRIDAY, September 15, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. For each of the following parts, pick
More informationNAME. EXAM I I. / 36 September 25, 2000 Biochemistry I II. / 26 BICH421/621 III. / 38 TOTAL /100
EXAM I I. / 6 September 25, 2000 Biochemistry I II. / 26 BIH421/621 III. / 8 TOTAL /100 I. MULTIPLE HOIE (6 points) hoose the BEST answer to the question by circling the appropriate letter. 1. An amino
More informationSection Week 3. Junaid Malek, M.D.
Section Week 3 Junaid Malek, M.D. Biological Polymers DA 4 monomers (building blocks), limited structure (double-helix) RA 4 monomers, greater flexibility, multiple structures Proteins 20 Amino Acids,
More information4 Proteins: Structure, Function, Folding W. H. Freeman and Company
4 Proteins: Structure, Function, Folding 2013 W. H. Freeman and Company CHAPTER 4 Proteins: Structure, Function, Folding Learning goals: Structure and properties of the peptide bond Structural hierarchy
More informationpyridoxal phosphate synthase
Supplementary Information 13 C-NMR snapshots of the complex reaction coordinate of pyridoxal phosphate synthase Jeremiah W. Hanes, Ivan Keresztes, and Tadhg P. Begley * Department of Chemistry and Chemical
More informationTHE UNIVERSITY OF MANITOBA. PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS
PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS EXAMINATION: Biochemistry of Proteins EXAMINER: J. O'Neil Section 1: You must answer all of
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationSecondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure
Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationPractice Midterm Exam 200 points total 75 minutes Multiple Choice (3 pts each 30 pts total) Mark your answers in the space to the left:
MITES ame Practice Midterm Exam 200 points total 75 minutes Multiple hoice (3 pts each 30 pts total) Mark your answers in the space to the left: 1. Amphipathic molecules have regions that are: a) polar
More informationNH 2. Biochemistry I, Fall Term Sept 9, Lecture 5: Amino Acids & Peptides Assigned reading in Campbell: Chapter
Biochemistry I, Fall Term Sept 9, 2005 Lecture 5: Amino Acids & Peptides Assigned reading in Campbell: Chapter 3.1-3.4. Key Terms: ptical Activity, Chirality Peptide bond Condensation reaction ydrolysis
More informationInverse Detection in Multinuclear NMR
Inverse Detection in Multinuclear NMR The HETCOR experiment is an example of a directly-detected heteronuclear experiment. The timing diagram for the most basic form of the HETCOR pulse sequence is shown
More informationA Thesis Presented to The Academic Faculty. Miranda McDaniel
Proton Coupled Electron Transfer as Explored by the Tryptophan Cation Radical Formation in Biomimetic Peptides A Thesis Presented to The Academic Faculty by Miranda McDaniel In Partial Fulfillment of the
More informationA prevalent intraresidue hydrogen bond stabilizes proteins
Supplementary Information A prevalent intraresidue hydrogen bond stabilizes proteins Robert W. Newberry 1 & Ronald T. Raines 1,2 * 1 Department of Chemistry and 2 Department of Biochemistry, University
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationFrom Amino Acids to Proteins - in 4 Easy Steps
From Amino Acids to Proteins - in 4 Easy Steps Although protein structure appears to be overwhelmingly complex, you can provide your students with a basic understanding of how proteins fold by focusing
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationBiomolecules: lecture 9
Biomolecules: lecture 9 - understanding further why amino acids are the building block for proteins - understanding the chemical properties amino acids bring to proteins - realizing that many proteins
More informationChemistry 416 Spectroscopy Winter Semester 1996 Dr. Rainer Glaser
Chemistry 416 Spectroscopy Winter Semester 1996 Dr. Rainer Glaser First 1-our Examination UV/Vis Spectroscopy Friday, February 9, 1996, 8:40-9:30 Name: Max Yours Question 1 10 Question 2 10 Question 3
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationShow all work. Remember: a point a minute! This exam is MUCH longer than the upcoming Final.
CEM 293 Sample Final Dr..M. Muchall Name Show all work. Remember: a point a minute! This exam is MUC longer than the upcoming Final. Textbook and calculator allowed. The textbook can be marked up, but
More informationBCH 4053 Exam I Review Spring 2017
BCH 4053 SI - Spring 2017 Reed BCH 4053 Exam I Review Spring 2017 Chapter 1 1. Calculate G for the reaction A + A P + Q. Assume the following equilibrium concentrations: [A] = 20mM, [Q] = [P] = 40fM. Assume
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationAP Biology Summer Assignment 2018/19 Mrs. Altergott, Modified from Kimberly Simons/Paul Picard LHS downloaded June 2017
1 AP Biology Summer Assignment 2018/19 Mrs. Altergott, jaltergott@stbernardhs.org Modified from Kimberly Simons/Paul Picard LHS downloaded June 2017 Welcome to AP Biology! Thank you for agreeing to take
More informationScience Science 249: Nature Struct. Biol. NSB l 3: NSB PNAS 96: NSB
Discussion Papers P16. Eriksson AE, Baase WA, Zhang X-J, Heinz DW, Blaber M, Baldwin EP, Matthews BW. (1992) Response of a protein structure to cavity-creating mutations and its relation to the hydrophobic
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More information(6 pts) List three general characteristics shared by stable secondary structures.
Biochemistry 461, Section I Your Name: March 19, 1998 Exam #2 Your SS#: Prof. Jason D. Kahn Your Signature: Please have photo ID available. You have 80 minutes for this exam. Exams written in pencil or
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationIndex. deuterium oxide as a solvent, 140, 152 isotope exchange induced shifts, 152 secondary structure contributions, 140 Amino acid analysis,
Index A Absorbance, 93 problems with measurement, 95 relation to optical density, 93 Accessible surface area, 13, 14, 17, 23 apolar hydrogen, 24 correlations, 14 hydrogen bond, 25 renormalization, 25 Activation
More informationTo be covered (and why) Spectroscopy of Proteins. UV-Vis Absorption. UV-Vis Absorption. Spectra
To be covered (and why) Spectroscopy of Proteins General considerations UV-Vis Absorption quantitation Fluorescence hydrophobicity Foldedness FT-Infrared Foldedness ircular Dichroism Foldedness NMR (a
More informationProf. Jason Kahn Your Signature: Exams written in pencil or erasable ink will not be re-graded under any circumstances.
1 Biochemistry 461 February 16, 1995 Exam #1 Prof. Jason Kahn Your Printed Name: Your SS#: Your Signature: You have 75 minutes for this exam. Exams written in pencil or erasable ink will not be re-graded
More informationBiochemistry - I SPRING Mondays and Wednesdays 9:30-10:45 AM (MR-1307) Lectures 3-4. Based on Profs. Kevin Gardner & Reza Khayat
Biochemistry - I Mondays and Wednesdays 9:30-10:45 AM (MR-1307) SPRING 2017 Lectures 3-4 Based on Profs. Kevin Gardner & Reza Khayat 1 Outline Overview of protein structure Peptide bonds Secondary structure
More informationTHE UNIVERSITY OF MANITOBA. PAPER NO: _1_ LOCATION: 173 Robert Schultz Theatre PAGE NO: 1 of 5 DEPARTMENT & COURSE NO: CHEM / MBIO 2770 TIME: 1 HOUR
THE UNIVERSITY OF MANITOBA 1 November 1, 2016 Mid-Term EXAMINATION PAPER NO: _1_ LOCATION: 173 Robert Schultz Theatre PAGE NO: 1 of 5 DEPARTMENT & COURSE NO: CHEM / MBIO 2770 TIME: 1 HOUR EXAMINATION:
More informationLecture 11: Protein Folding & Stability
Structure - Function Protein Folding: What we know Lecture 11: Protein Folding & Stability 1). Amino acid sequence dictates structure. 2). The native structure represents the lowest energy state for a
More informationProtein Folding & Stability. Lecture 11: Margaret A. Daugherty. Fall Protein Folding: What we know. Protein Folding
Lecture 11: Protein Folding & Stability Margaret A. Daugherty Fall 2003 Structure - Function Protein Folding: What we know 1). Amino acid sequence dictates structure. 2). The native structure represents
More informationSyllabus BINF Computational Biology Core Course
Course Description Syllabus BINF 701-702 Computational Biology Core Course BINF 701/702 is the Computational Biology core course developed at the KU Center for Computational Biology. The course is designed
More information1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.
Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the
More informationProtein Folding & Stability. Lecture 11: Margaret A. Daugherty. Fall How do we go from an unfolded polypeptide chain to a
Lecture 11: Protein Folding & Stability Margaret A. Daugherty Fall 2004 How do we go from an unfolded polypeptide chain to a compact folded protein? (Folding of thioredoxin, F. Richards) Structure - Function
More informationProtein Structure. W. M. Grogan, Ph.D. OBJECTIVES
Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate
More informationEnzymes. Lab Exercise 7. Introduction. Contents. Objectives
Lab Exercise Enzymes Contents Objectives 1 Introduction 1 Activity.1 Optimal ph 3 Activity.2 Optimal Temperature 4 Activity.3 Reaction Rates 4 Resutls Section 5 Objectives - Appreciate the sensitivity
More information2015 AP Biology Unit 2 PRETEST- Introduction to the Cell and Biochemistry
Name: Class: _ Date: _ 2015 AP Biology Unit 2 PRETEST- Introduction to the Cell and Biochemistry Multiple Choice Identify the choice that best completes the statement or answers the question. 1) In what
More informationOptical Spectroscopy 1 1. Absorption spectroscopy (UV/vis)
Optical Spectroscopy 1 1. Absorption spectroscopy (UV/vis) 2 2. Circular dichroism (optical activity) CD / ORD 3 3. Fluorescence spectroscopy and energy transfer Electromagnetic Spectrum Electronic Molecular
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. The asymmetric unit in para-iodio-phenylalanine crystal. The 50% probability ellipsoid representation was prepared using the Mercury Software. Colors are as
More informationChapter 6- An Introduction to Metabolism*
Chapter 6- An Introduction to Metabolism* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. The Energy of Life
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationFinal exam. Please write your name on the exam and keep an ID card ready. You may use a calculator (but no computer or smart phone) and a dictionary.
Biophysics of Macromolecules Prof. D. Braun and Prof. J. Lipfert SS 2015 Final exam Final exam Name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an ID card ready. You
More informationMBLG lecture 5. The EGG! Visualising Molecules. Dr. Dale Hancock Lab 715
MBLG lecture 5 Dr. Dale Hancock D.Hancock@mmb.usyd.edu.au Lab 715 The EGG! Visualising Molecules In molecular biology and biochemistry it is better to view molecules as killer pythons rather than smarties.
More informationLecture 14 - Cells. Astronomy Winter Lecture 14 Cells: The Building Blocks of Life
Lecture 14 Cells: The Building Blocks of Life Astronomy 141 Winter 2012 This lecture describes Cells, the basic structural units of all life on Earth. Basic components of cells: carbohydrates, lipids,
More informationMajor Types of Association of Proteins with Cell Membranes. From Alberts et al
Major Types of Association of Proteins with Cell Membranes From Alberts et al Proteins Are Polymers of Amino Acids Peptide Bond Formation Amino Acid central carbon atom to which are attached amino group
More informationPatrick: An Introduction to Medicinal Chemistry 5e Chapter 03
01) Which of the following statements is not true regarding the active site of an enzyme? a. An active site is normally on the surface of an enzyme. b. An active site is normally hydrophobic in nature.
More informationPrevious Class. Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements. Today
Previous Class Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements Today Spectrophotometry Spectrofluorimetry Radioactive Procedures ph dependency Spectrophotometry
More informationLAB. FACTORS INFLUENCING ENZYME ACTIVITY
AP Biology Date LAB. FACTORS INFLUENCING ENZYME ACTIVITY Background Enzymes are biological catalysts capable of speeding up chemical reactions by lowering activation energy. One benefit of enzyme catalysts
More informationBiochemistry 530: Introduction to Structural Biology. Autumn Quarter 2014 BIOC 530
Biochemistry 530: Introduction to Structural Biology Autumn Quarter 2014 Course Information Course Description Graduate-level discussion of the structure, function, and chemistry of proteins and nucleic
More informationSTUDY OF THE CONFORMATION OF MYOGLOBIN ADSORBED ON NANOPARTICLES USING HYDROGEN/DEUTERIUM EXCHANGE MASS SPECTROMETRY
STUDY OF THE CONFORMATION OF MYOGLOBIN ADSORBED ON NANOPARTICLES USING HYDROGEN/DEUTERIUM EXCHANGE MASS SPECTROMETRY By YAOLING LONG A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA
More informationDana Alsulaibi. Jaleel G.Sweis. Mamoon Ahram
15 Dana Alsulaibi Jaleel G.Sweis Mamoon Ahram Revision of last lectures: Proteins have four levels of structures. Primary,secondary, tertiary and quaternary. Primary structure is the order of amino acids
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationSyllabus of BIOINF 528 (2017 Fall, Bioinformatics Program)
Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program) Course Name: Structural Bioinformatics Course Description: Instructor: This course introduces fundamental concepts and methods for structural
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationChemistry of Life Essential Questions
Chemistry of Life Essential Questions VMHS Standards 8.6b; 8.6c; 1h; 4e; 4f; 5a;1b; 1. What is an atom? What are elements? An atom is the basic unit of o Consist of,, and An element is a type of atom o
More informationRelaxation, Multi pulse Experiments and 2D NMR
Relaxation, Multi pulse Experiments and 2D NMR To Do s Read Chapter 6 Complete the end of chapter problems; 6 1, 6 2, 6 3, 6 5, 6 9 and 6 10. Read Chapter 15 and do as many problems as you can. Relaxation
More informationNMR studies of protein folding
NMR studies of protein folding Juhi Juneja and Jayant B. Udgaonkar* National Centre for Biological Sciences, Tata Institute of Fundamental Research, GKVK Campus, Bangalore 560 065, India NMR spectroscopy
More informationion mobility spectrometry IR spectroscopy
Debasmita Gho 29.10.2016 Introducti on Owing to its accuracy, sensitivity, and speed, mass spectrometry (MS) coupled to fragmentation techniques is the method of choice for determining the primary structure
More informationConformational Geometry of Peptides and Proteins:
Conformational Geometry of Peptides and Proteins: Before discussing secondary structure, it is important to appreciate the conformational plasticity of proteins. Each residue in a polypeptide has three
More informationMolecular Basis of K + Conduction and Selectivity
The Structure of the Potassium Channel: Molecular Basis of K + Conduction and Selectivity -Doyle, DA, et al. The structure of the potassium channel: molecular basis of K + conduction and selectivity. Science
More informationOptical Activity as a Biosignature in the Search for Extraterrestrial Life
ptical Activity as a Biosignature in the Search for Extraterrestrial Life Andrew K. Boal AST740 21 April 2006 utline of this talk Science ow will we detect life on other planets? Some proposed biosignatures
More informationDihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769
Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral
More information4.3A: Electronic transitions
Ashley Robison My Preferences Site Tools Popular pages MindTouch User Guide FAQ Sign Out If you like us, please share us on social media. The latest UCD Hyperlibrary newsletter is now complete, check it
More informationPatrick: An Introduction to Medicinal Chemistry 5e Chapter 01
Questions Patrick: An Introduction to Medicinal Chemistry 5e 01) Which of the following molecules is a phospholipid? a. i b. ii c. iii d. iv 02) Which of the following statements is false regarding the
More informationHonors Biology Fall Final Exam Study Guide
Honors Biology Fall Final Exam Study Guide Helpful Information: Exam has 100 multiple choice questions. Be ready with pencils and a four-function calculator on the day of the test. Review ALL vocabulary,
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationBI/CH421 Biochemistry I Exam 1 09/29/2014
Part I: Multiple choice for each question, circle the choice that best answers the question. Do not write the letter in the margin to indicate your answer, circle it. 3 points each. 1. For a reaction with
More informationBasic structures of proteins
Basic structures of proteins Structural Hierarchy of Protein Primary structure Functional elements : α-helix, strands, β-sheet, loops.. - Structure, affinity, activity, specificity, stability etc. Secondary
More informationTamer Barakat. Razi Kittaneh. Mohammed Bio. Diala Abu-Hassan
14 Tamer Barakat Razi Kittaneh Mohammed Bio Diala Abu-Hassan Protein structure: We already know that when two amino acids bind, a dipeptide is formed which is considered to be an oligopeptide. When more
More informationChemistry 200: Basic Chemistry and Applications Course Syllabus: Spring
Chemistry 200: Basic Chemistry and Applications Course Syllabus: Spring 2017 2018 Course Instructors Faraj Hasanayn; Office of Faraj Hasanayn: Chem Bldg. Rm 522 Office Hours: TBA Email: fh19@aub.edu.lb.
More informationJBA 2018 Chemistry Exam 2. Name: Score: /100 = /80
JBA 2018 hemistry Exam 2 ame: Score: /100 = /80 Multiple choice questions are worth two points each. 1. onstitutional isomers are compounds that have a. the same chemical formulas and molecular structures
More informationCD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray
CD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray crystallography An example of the use of CD Modeling
More informationMODULE 2: BIOLOGICAL MOLECULES
PEER-LED TEAM LEARNING INTRDUCTRY BILGY MDULE 2: BILGICAL MLECULES JSEP GRISWLD, + DEAN STETLER,* AND MICAEL GAINES, ( + City College of New York, *University of Kansas, Univ. of Miami;) I. Introduction
More informationHomology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationUniversity of York. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Biochemical reaction mechanisms
Examination Candidate Number: Desk Number: University of York BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Biochemical reaction mechanisms Time Allowed: 1 hour Marking
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationBCMP 201 Protein biochemistry
BCMP 201 Protein biochemistry BCMP 201 Protein biochemistry with emphasis on the interrelated roles of protein structure, catalytic activity, and macromolecular interactions in biological processes. The
More informationMolecular Modelling. part of Bioinformatik von RNA- und Proteinstrukturen. Sonja Prohaska. Leipzig, SS Computational EvoDevo University Leipzig
part of Bioinformatik von RNA- und Proteinstrukturen Computational EvoDevo University Leipzig Leipzig, SS 2011 Protein Structure levels or organization Primary structure: sequence of amino acids (from
More information