Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al.

Size: px
Start display at page:

Download "Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al."

Transcription

1 Supplemental materials for Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al. 1. Table S1. Strains used in this study 2. Table S2. Plasmids used in this study 3. Table S1. Primers used in this study 4. Supplemental methods 5. Supplemental references

2 Table S1. Strains used in this study. strain genotype reference E. coli XL1 Blue an E. coli strain used for molecular cloning Invitrogen BTH101 an E. coli host strain for bacterial two hybrid assay (6) RL219 RL1927 RL1936 DH5α derivative containing the plasmid pdg268, Amp R, Cm R DH5α derivative containing the plasmid pdg1662, Amp R, Spc R DH5α derivative containing the plasmid pdg780, Amp R, Kan R (1) (5) Losick lab collection RL3002 RL3544 DH5α derivative containing the plasmid pdr111, Amp R, Spc R DH5α derivative containing the plasmid pah54, Amp R, Spc R (7) Losick lab collection RL3545 DH5α derivative containing the plasmid pah52, Amp R, Mls R Losick lab collection RL4505 DH5α derivative containing the plasmid pac225, Amp R, Cm R Losick lab collection B. subtilis PY79 laboratory strain used as a host for transformation 3610 undomesticated wild strain capable of forming robust biofilms (2) RL4620 spo0a in 3610, Kan R Losick lab collection RL4573 kina kinb in 3610, Mls R, Kan R (8) RL5273 kinc kind in 3610, Mls R, Tet R (8) YC110 amye::p epsa -lacz in 3610, Cm R (3) YC121 amye::p tapa -lacz in 3610, Cm R (4) CY3 ypfa in 3610, Kan R this study CY5 yhck in 3610, Mls R this study CY7 ytrp in 3610, Spec R this study CY8 yybt in 3610, Kan R this study CY9 yuxh in 3610, Mls R this study CY10 ykow in 3610, Mls R this study CY11 ykui in 3610, Cm R this study CY24 yybt yhck ytrp in 3610, Kan R, Mls R, Spec R this study CY25 yuxh ykui ykow in 3610, Spec R, Cm R, Mls R this study CY30 yuxh ypfa in 3610, Mls R, Kan R this study CY84 amye::p hyspank -ypfa in 3610, Spec R this study CY85 yuxh, amye::p hyspank -ypfa in 3610, Mls R, Spec R this study CY87 yuxh, amye::yuxh wt in 3610, Mls R, Cm R this study CY88 yuxh, amye::yuxh mut (ELL>AEL) in 3610, Mls R, Cm R this study CY89 yuxh, amye::yuxh mut (ELL>EDA) in 3610, Mls R, Cm R this study CY110 amye::p yuxh -lacz in 3610, Cm R this study CY121 spo0a, amye::p yuxh -lacz in 3610, Kan R, Cm R this study CY158 yuxh, ypfa, amye::p hyspank -gst-ypfa in 3610, Mls R, Kan R, Spec R this study CY182 yuxh, ypfa, amye::p hyspank -gst in 3610, Mls R, Kan R, Spec R this study CY230 kina kinb ypfa in 3610, Cm R, Mls R, Kan R this study CY231 kinc kind ypfa in 3610, Mls R, Tet R, Kan R this study CY301 ypfa-pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY302 ypfa-pknt25, flig-pch363 in BTH101, Kan R, Amp R this study CY303 yabk-pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY304 yabk-pknt25, flig-pch363 in BTH101, Kan R, Amp R this study CY305 ypfa-pknt25, pch363 in BTH101, Kan R, Amp R this study CY306 yabk-pknt25, pch363 in BTH101, Kan R, Amp R this study CY307 pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY308 pknt25, flig-pch363 in BTH101, Kan R, Amp R this study CY309 pknt25, pch363 in BTH101, Kan R, Amp R this study CY331 yuxh, amye::p hyspank -ypfa R100F in 3610, Mls R, Spec R this study CY332 yuxh, amye::p hyspank ypfa R104D in 3610, Mls R, Spec R this study CY357 ypfa R100F -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY358 ypfa R104D -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY372 ypfa K24D -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY373 ypfa N127A -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY375 ypfa G132A -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY396 yuxh, amye::p hyspank -ypfa K24D in 3610, Mls R, Spec R this study CY397 yuxh, amye::p hyspank -ypfa N127A in 3610, Mls R, Spec R this study CY399 yuxh, amye::p hyspank -ypfa G132A in 3610, Mls R, Spec R this study CY437 ypfa, amye::p epsa -lacz in 3610, Kan R,Cm R this study CY438 ypfa, amye:: P tapa -lacz in 3610, Kan R,Cm R this study

3 Table 2. Plasmids used in this study. pah52 a plasmid for the LHF PCR drug template, Amp R, MLS R Losick lab collection pah54 a pbskii (+) derivative as template for the LHF PCR mutagenesis, Amp R, Spec R Losick lab collection pdg268 pdg780 an amye integration vector that contains a promoter-less lacz, Cm R, Amp R a plasmid for Campbell integration in B. subtilis, Kan R, Amp R (1) Losick lab collection pdg1662 a plasmid for integration at amye in B. subtilis, Cm R, Amp R (5) pdr111 pch363 pknt25 an amye integration vector that contains P hyspank, Spec R, Amp R T18 adenylate cylcase domain, Amp R T25 adenylate cyclase domain, Kan R (7) (6) (6) pgex-2tk an expression vector for GST fusion proteins GE Healthcare pcy58 amye::yuxh mut ( 88 ELL 90 > 88 AEL 90 ) in pdg1662 this study pcy59 amye::yuxh mut ( 88 ELL 90 > 88 EDA 90 ) in pdg1662 this study pcy60 amye::yuxh wt in pdg1662 this study pcy83 amye::p hyspank -ypfa in pdr111 this study pcy88 amye::p hyspank -gst in pdr111 this study pcy100 amye::p yuxh -lacz in pdg268 this study pcy152 amye::p hyspank- gst-ypfa in pdr111 this study pcy283 ypfa cloned into pknt25 between BamHI and EcoRI this study pcy301 yabk cloned into pknt25 between BamHI and EcoRI this study pcy302 mota cloned into pch363 between BamHI and EcoRI this study pcy303 flig cloned into pch363 between KpnI and EcoRI this study

4 Table 3. Primers used in this study. yhck-ko-p1 yhck-ko-p2 yhck-ko-p3 yhck-ko-p4 ytrp-ko-p1 ytrp-ko-p2 ytrp-ko-p3 ytrp-ko-p4 ypfa-ko-p1 ypfa-ko-p2 ypfa-ko-p3 ypfa KO-P4 yybt-ko-p1 yybt-ko-p2 yybt-ko-p3 yybt-ko-p4 yuxh-ko-p1 yuxh-ko-p2 yuxh-ko-p3 yuxh-ko-p4 P yuxh -F1 P yuxh -R1 yuxh-m1-f yuxh-m1-r yuxh-m2-f yuxh-m2-r yuxh-r1 ypfa-f ypfa-r pgex-ypfa-f1 pgex-ypfa-r1 gst-ypfa-f3 gst-ypfa-r2 gst-ck-f1 gst-ck-r3 ypfa-mut K24D -F ypfa-mut K24D -R ypfa-mut R100F -F ypfa-mut R100F -R ypfa-mut R104D -F ypfa-mut R104D- R ypfa-mut N127A -F ypfa-mut N127A -R ypfa-mut G132V -F ypfa-mut G132V -R B 2 ypfa-f B 2 ypfa-r1 B 2 mota-f B 2 mota-r B 2 flig-f B 2 flig-r1 B 2 yabk-f B 2 yabk-r 5 -ATAAACATAGTGATTAACGCGGC-3 5 -CAATTCGCCCTATAGTGAGTCGTCAGTTCTTTCAGCAAATATT-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGAAGAATGAATTCAATGTTCGA-3 5 -GATAAGTAATAGGAATTGACAAC-3 5 -GATCATTGGGAGCAGCAGGCGCA-3 5 -CAATTCGCCCTATAGTGAGTCGTTTAGTTTGTTCTACCATGTT-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGGCTTGATGATTCATGACTCA-3 5 -TAATGTGGAGTCAATTGTGACTT-3 5 -ACCTTCGCTGGATGGACGTAGAA-3 5 -CAATTCGCCCTATAGTGAGTCGTTCTCCAATCTCTATCATTGAC-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGCGAATGGAATAAACATCGGC-3 5 -GTGGCATTTGCCATCCTCAGCGGG-3 5 -ATTCGTATGTTCAGGATGATACG-3 5 -CAATTCGCCCTATAGTGAGTCGTAGCTTGGCATTTCTATCACTC-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGGCGTACAGAGATGAAGGTTA-3 5 -CTTGTGCGTTCTGCTTCTCACAC-3 5 -ATGCGCATGCGCTTGTGCAGGCTT-3 5 -CAATTCGCCCTATAGTGAGTCGT CACCCTCATTGATTTATC-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGGACGCAAAATGATTGCGG-3 5 -CATTTATTGTATCGGTAGAAC-3 5 -GTACGAATTCGAAGAAGAGCTTGAGGAAGAA-3 5 -GTACGGATCCTTACAATACGCGCGGCTTTCA-3 5 -TGTTGCTTATGCAGAGCTGTATAGAGAAA-3 5 -TTTCTCTATACAGCTCTGCATAAGCAACA-3 5 -TTGTCATTGAAGACGCTGAAGATATAC-3 5 -GTATATCTTCAGCGTCTTCAATGACAA-3 5 -GTCAGGATCCTCATTTTGCGTCCATAAGATT-3 5 -GTACAAGCTTAAGGAGGAACTACTATGATAGAGATTGGAGAAAAT-3 5 -GACTGCTAGCTTATTCCATTCGGGCCTTTCT-3 5 -GTACGGATCCATGATAGAGATTGGAGAAAAT-3 5 -GTACGAATTCTTATTCCATTCGGGCCTTTCT-3 5 -GTACAAGCTTAAGGAGGAACTACTATGTCCCCTATACTAGGTTATTG-3 5 -GTACGCTAGCTTATTCCATTCGGGCCTTTCT-3 5 -GTACAAGCTTAAGGAGGAACTACTATGTCCCCTATACTAGGTTAT-3 5 -GTACGCTAGCTCAAACAGATGCACGACGAG-3 5 -TGAATTGAAAAAGGCAAAAAGCGATGCGGTCAGCATCGAAAACAATG-3 5 -CATTGTTTTCGATGCGACCGCATCGCTTTTTGCCTTTTTCAATTCA-3 5 -AAAATGAAAAGAATCCAGCGCTTCCAATATGTAAGAACTGATGCG-3 5 -CGCATCAGTTCTTACATATTGGAAGCGCTGGATTCTTTCATTTT-3 5 -ATCCAGCGCCGCCAATATGTAGACACTGATGCGGTATTAGATGTG-3 5 -CACATCTAATACCGCATCAGTGTCTACATATTGGCGGCGCTGGAT-3 5 -GAGATCCGCACACTATCCTATCTCATCAGTGCAGGCGGCATCGCC-3 5 -GGCGATGCCGCCTGCACTGATGAGATAGGATAGTGTGCGGATCTC-3 5 -ATCCTATAACATCAGTGCAGGCGTCATCGCCGTGGTTTTAGCTGATG-3 5 -CATCAGCTAAAACCACGGCGATGACGCCTGCACTGATGTTATAGGAT-3 5 -GTACGGATCCGATAGAGATTGGAGAAAATGTA-3 5 -GTACGAATTCCGTTCCATTCGGGCCTTTCTTCT-3 5 -GTACGGATCCGATGGATAAAACTTCGTTAATCG-3 5 -GTACGAATTCCGTGCTTCTTCTTCTTTTTTCTCGC-3 5 -GTACGGTACCGATGGCGAGACGTGATCAAGATAAG-3 5 -GTACGAATTCCGGACAATAATATCATCCCCTC-3 5 -GTACGGATCCGATGGCTTTGCATTATTATTGTC-3 5 -GTACGAATTCCGTTGAATAAATGTGTGATATTC-3

5 Supplemental methods Assays of swimming motility. The effect on swimming motility by overexpression of YpfA in B. subtilis was examined as follows. CY85 ( yuxh amye::p hyspank -ypfa) cells were grown in LB shaking culture to O.D. 600 about 0.3. IPTG was added to the culture at a final concentration of 50 µm. After 30 min of incubation at 37 C, 50 µl of cell suspension was quickly spotted on a cover slide and analyzed by time-lapse phasecontrast microscopy cells treated with IPTG and CY85 cells without IPTG treatment were used as controls. Cell movement in each sample was recorded for about 10 seconds.

6 Supplemental references 1. Antoniewski, C., B. Savelli, and P. Stragier The spoiij gene, which regulates early developmental steps in Bacillus subtilis, belongs to a class of environmentally responsive genes. J. Bacteriol. 172: Branda, S. S., J. E. Gonzalez-Pastor, S. Ben-Yehuda, R. Losick, and R. Kolter Fruiting body formation by Bacillus subtilis. Proc. Natl. Acad. Sci. USA 98: Chai, Y., F. Chu, R. Kolter, and R. Losick Bistability and biofilm formation in Bacillus subtilis. Mol. Microbiol. 67: Chai, Y., R. Kolter, and R. Losick Paralogous antirepressors acting on the master regulator for biofilm formation in Bacillus subtilis. Molecular Microbiology 74: Guérout-Fleury, A. M., N. Frandsen, and P. Stragier Plasmids for ectopic integration in Bacillus subtilis. Gene 180: Karimova, G., J. Pidoux, A. Ullmann, and D. Ladant A bacterial twohybrid system based on a reconstituted signal transduction pathway. Proc. Natl. Acad. Sci. USA 95: Kearns, D. B., and R. Losick Cell population heterogeneity during growth of Bacillus subtilis. Genes Dev. 19: McLoon, A. L., I. Kolodkin-Gal, S. M. Rubinstein, R. Kolter, and R. Losick Spatial regulation of histidine kinases governing biofilm formation in Bacillus subtilis. J. Bacteriol. 193:

Supporting Information

Supporting Information Supporting Information López et al. 10.1073/pnas.0810940106 1. Ivey DM, et al. (1993) Cloning and characterization of a putative Ca2 /H antiporter gene from Escherichia coli upon functional complementation

More information

Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation

Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation Nils Widderich 1,, Christopher D.A. Rodrigues 2,, Fabian M. Commichau

More information

Phosphorylation of Spo0A by the Histidine Kinase KinD Requires the Lipoprotein Med in Bacillus subtilis

Phosphorylation of Spo0A by the Histidine Kinase KinD Requires the Lipoprotein Med in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Aug. 2011, p. 3949 3955 Vol. 193, No. 15 0021-9193/11/$12.00 doi:10.1128/jb.05199-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Phosphorylation of

More information

Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A

Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A Masaya Fujita and Richard Losick 1 Department of Molecular

More information

kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051

kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051 Microbiology (2008), 154, 54 63 DOI 10.1099/mic.0.2007/011783-0 kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051 Kazuo Kobayashi, 1 Ritsuko Kuwana 2 and Hiromu

More information

Using Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus

Using Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus Microbiology tongbao@im.ac.cn MAR 20, 2009, 36(3): 345~349 2009 by Institute of Microbiology, CAS mini-tn10 1,2 1 1 1 1 1 1,2* (1. 300071) (2. 300071) :, mini-tn10 NK10.BAhjaWT 400, 90% 4, citbcitggpsa

More information

A Widely Conserved Gene Cluster Required for Lactate Utilization in Bacillus subtilis and Its Involvement in Biofilm Formation

A Widely Conserved Gene Cluster Required for Lactate Utilization in Bacillus subtilis and Its Involvement in Biofilm Formation JOURNAL OF BACTERIOLOGY, Apr. 2009, p. 2423 2430 Vol. 191, No. 8 0021-9193/09/$08.00 0 doi:10.1128/jb.01464-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. A Widely Conserved

More information

The Major Role of Spo0A in Genetic Competence Is To Downregulate abrb, an Essential Competence Gene

The Major Role of Spo0A in Genetic Competence Is To Downregulate abrb, an Essential Competence Gene JOURNAL OF BACTERIOLOGY, June 1995, p. 3601 3605 Vol. 177, No. 12 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology The Major Role of Spo0A in Genetic Competence Is To Downregulate

More information

MstX and a Putative Potassium Channel Facilitate Biofilm Formation in Bacillus subtilis

MstX and a Putative Potassium Channel Facilitate Biofilm Formation in Bacillus subtilis MstX and a Putative Potassium Channel Facilitate Biofilm Formation in Bacillus subtilis Matthew E. Lundberg 1,2, Eric C. Becker 2, Senyon Choe 1,2 * 1 Structural Biology Laboratory, The Salk Institute,

More information

YycH and YycI Interact To Regulate the Essential YycFG Two-Component System in Bacillus subtilis

YycH and YycI Interact To Regulate the Essential YycFG Two-Component System in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Apr. 2007, p. 3280 3289 Vol. 189, No. 8 0021-9193/07/$08.00 0 doi:10.1128/jb.01936-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. YycH and YycI Interact

More information

The Threshold Level of the Sensor Histidine Kinase KinA Governs Entry into Sporulation in Bacillus subtilis

The Threshold Level of the Sensor Histidine Kinase KinA Governs Entry into Sporulation in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Aug. 2010, p. 3870 3882 Vol. 192, No. 15 0021-9193/10/$12.00 doi:10.1128/jb.00466-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. The Threshold Level

More information

Cannibalism by Sporulating Bacteria

Cannibalism by Sporulating Bacteria Cannibalism by Sporulating Bacteria José E. González-Pastor, Erret C. Hobbs, Richard Losick 2003. Science 301:510-513 Introduction Some bacteria form spores. Scientist are intrigued by them. Bacillus subtilis

More information

JOHN R. LEDEAUX AND ALAN D. GROSSMAN* Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

JOHN R. LEDEAUX AND ALAN D. GROSSMAN* Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 JOURNAL OF BACTERIOLOGY, Jan. 1995, p. 166 175 Vol. 177, No. 1 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology Isolation and Characterization of kinc, a Gene That Encodes a Sensor

More information

Supporting Information

Supporting Information Supporting Information Espinar et al. 1.173/pnas.12169111 SI Materials and Methods Growth Conditions for Microscopy. For the experiments presented in the main text, Bacillus subtilis cells were grown at

More information

Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis

Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis RESEARCH ARTICLE Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis Yunrong Chai, a Pascale B. Beauregard, b Hera Vlamakis, b Richard Losick, a and Roberto Kolter b Department

More information

In vivo characterization of the scaffold activity of flotillin on the membrane kinase KinC of Bacillus subtilis

In vivo characterization of the scaffold activity of flotillin on the membrane kinase KinC of Bacillus subtilis Microbiology (215), 161, 1871 1888 DOI 1.199/mic..137 Editor s Choice Correspondence Daniel Lopez daniel.lopez@uni-wuerzburg.de or dlopez@cnb.csic.es In vivo characterization of the scaffold activity of

More information

A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis

A combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis JB Accepts, published online ahead of print on 5 April 2013 J. Bacteriol. doi:10.1128/jb.00028-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 A combination of glycerol and

More information

Supplemental Figure 1.

Supplemental Figure 1. A wt spoiiiaδ spoiiiahδ bofaδ B C D E spoiiiaδ, bofaδ Supplemental Figure 1. GFP-SpoIVFA is more mislocalized in the absence of both BofA and SpoIIIAH. Sporulation was induced by resuspension in wild-type

More information

Control of cell fate by the formation of an architecturally complex bacterial community

Control of cell fate by the formation of an architecturally complex bacterial community Control of cell fate by the formation of an architecturally complex bacterial community Hera Vlamakis, 1,3 Claudio Aguilar, 1,3 Richard Losick, 2 and Roberto Kolter 1,4 1 Department of Microbiology and

More information

Replication Initiation Proteins Regulate a Developmental Checkpoint in Bacillus subtilis

Replication Initiation Proteins Regulate a Developmental Checkpoint in Bacillus subtilis Cell, Vol. 104, 269 279, January 26, 2001, Copyright 2001 by Cell Press Replication Initiation Proteins Regulate a Developmental Checkpoint in Bacillus subtilis William F. Burkholder, Iren Kurtser, and

More information

Strain or plasmid Relevant characteristics Reference

Strain or plasmid Relevant characteristics Reference Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688

More information

SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis

SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis Leiman et al. BMC Microbiology 2014, 14:301 RESEARCH ARTICLE Open Access SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis Sara A Leiman 1,

More information

Supporting online material

Supporting online material Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins

More information

University of Dundee. Published in: Microbiology-SGM. DOI: /mic Publication date: 2014

University of Dundee. Published in: Microbiology-SGM. DOI: /mic Publication date: 2014 University of Dundee The protein tyrosine kinases EpsB and PtkA differentially affect biofilm formation in Bacillus subtilis Gerwig, Jan; Kiley, Taryn B.; Gunka, Katrin; Stanley-Wall, Nicola; Stülke, Jörg

More information

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for

Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI

More information

Characterization of sporulation histidine kinases of Paenibacillus polymyxa

Characterization of sporulation histidine kinases of Paenibacillus polymyxa Research in Microbiology 163 (2012) 272e278 www.elsevier.com/locate/resmic Characterization of sporulation histidine kinases of Paenibacillus polymyxa Soo-Young Park a, Seung-Hwan Park a,b, Soo-Keun Choi

More information

Supplementary Materials for

Supplementary Materials for www.advances.sciencemag.org/cgi/content/full/1/5/e1500358/dc1 Supplementary Materials for Transplantability of a circadian clock to a noncircadian organism Anna H. Chen, David Lubkowicz, Vivian Yeong,

More information

Supporting Information

Supporting Information 1 Supporting Information 5 6 7 8 9 10 11 1 1 1 15 16 17 Sequences: E. coli lysine riboswitch (ECRS): GTACTACCTGCGCTAGCGCAGGCCAGAAGAGGCGCGTTGCCCAAGTAACGGTGTTGGAGGAGCCAG TCCTGTGATAACACCTGAGGGGGTGCATCGCCGAGGTGATTGAACGGCTGGCCACGTTCATCATCGG

More information

Triggering sporulation in Bacillus subtilis with artificial two-component systems reveals the importance of proper Spo0A activation dynamics

Triggering sporulation in Bacillus subtilis with artificial two-component systems reveals the importance of proper Spo0A activation dynamics Molecular Microbiology (23) 9(), 8 94 doi:./mmi.2357 First published online 23 August 23 Triggering sporulation in Bacillus subtilis with artificial two-component systems reveals the importance of proper

More information

Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster.

Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster. Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster. a, Absorbance spectra of WhiB1 isolated from recombinant M. smegmatis

More information

Helical Macrofiber Formation in Bacillus subtilis: Inhibition by Penicillin G

Helical Macrofiber Formation in Bacillus subtilis: Inhibition by Penicillin G JOURNAL OF BACTERIOLOGY, June 1984, p. 1182-1187 0021-9193/84/061182-06$02.00/0 Copyright C 1984, American Society for Microbiology Vol. 158, No. 3 Helical Macrofiber Formation in Bacillus subtilis: Inhibition

More information

Role of Leucine Zipper Motifs in Association of the Escherichia coli Cell Division Proteins FtsL and FtsB

Role of Leucine Zipper Motifs in Association of the Escherichia coli Cell Division Proteins FtsL and FtsB JOURNAL OF BACTERIOLOGY, Sept. 2011, p. 4988 4992 Vol. 193, No. 18 0021-9193/11/$12.00 doi:10.1128/jb.00324-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Role of Leucine Zipper

More information

Analyses of mrp Genes during Myxococcus xanthus Development

Analyses of mrp Genes during Myxococcus xanthus Development JOURNAL OF BACTERIOLOGY, Dec. 2001, p. 6733 6739 Vol. 183, No. 23 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.23.6733 6739.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Analyses

More information

Microbes of many kinds enter complex pathways of development

Microbes of many kinds enter complex pathways of development Fruiting body formation by Bacillus subtilis Steven S. Branda*, José Eduardo González-Pastor, Sigal Ben-Yehuda, Richard Losick, and Roberto Kolter* *Department of Microbiology and Molecular Genetics, Harvard

More information

The master regulator for entry into sporulation in Bacillus subtilis becomes a cell-specific transcription factor after asymmetric division

The master regulator for entry into sporulation in Bacillus subtilis becomes a cell-specific transcription factor after asymmetric division The master regulator for entry into sporulation in Bacillus subtilis becomes a cell-specific transcription factor after asymmetric division Masaya Fujita and Richard Losick 1 Department of Molecular and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Results and Discussion General properties of L-form cells Phase contrast microscopy of L-form strain Bs115 sup21 revealed that cells were very heterogeneous in size (Fig. 1h) ranging from

More information

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli

Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4

More information

ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC

ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC

More information

CheX in the Three-Phosphatase System of Bacterial Chemotaxis

CheX in the Three-Phosphatase System of Bacterial Chemotaxis JOURNAL OF BACTERIOLOGY, Oct. 2007, p. 7007 7013 Vol. 189, No. 19 0021-9193/07/$08.00 0 doi:10.1128/jb.00896-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. CheX in the Three-Phosphatase

More information

Modulation of the ComA-Dependent Quorum Response in Bacillus subtilis by Multiple Rap Proteins and Phr Peptides

Modulation of the ComA-Dependent Quorum Response in Bacillus subtilis by Multiple Rap Proteins and Phr Peptides JOURNAL OF BACTERIOLOGY, July 2006, p. 5273 5285 Vol. 188, No. 14 0021-9193/06/$08.00 0 doi:10.1128/jb.00300-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Modulation of the

More information

Role of GerD in Germination of Bacillus subtilis Spores

Role of GerD in Germination of Bacillus subtilis Spores JOURNAL OF BACTERIOLOGY, Feb. 2007, p. 1090 1098 Vol. 189, No. 3 0021-9193/07/$08.00 0 doi:10.1128/jb.01606-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Role of GerD in Germination

More information

Regulation of Synthesis of the Bacillus subtilis Transition-Phase, Spore-Associated Antibacterial Protein TasA

Regulation of Synthesis of the Bacillus subtilis Transition-Phase, Spore-Associated Antibacterial Protein TasA JOURNAL OF BACTERIOLOGY, Oct. 1999, p. 5476 5481 Vol. 181, No. 17 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Regulation of Synthesis of the Bacillus subtilis

More information

2. Yeast two-hybrid system

2. Yeast two-hybrid system 2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates

More information

CodY Is Required for Nutritional Repression of Bacillus subtilis Genetic Competence

CodY Is Required for Nutritional Repression of Bacillus subtilis Genetic Competence JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5910 5915 Vol. 178, No. 20 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology CodY Is Required for Nutritional Repression of Bacillus subtilis

More information

Supporting Information

Supporting Information Supporting Information Sana et al. 10.1073/pnas.1608858113 Fig. S1. Representation of the SPI-6 type VI secretion system. (A) Representation of the SPI-6 genetic locus starting at STM0266 and ending at

More information

Role of CodY in Regulation of the Bacillus subtilis hut Operon

Role of CodY in Regulation of the Bacillus subtilis hut Operon JOURNAL OF BACTERIOLOGY, July 1996, p. 3779 3784 Vol. 178, No. 13 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology Role of CodY in Regulation of the Bacillus subtilis hut Operon

More information

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)

More information

SUPPLEMENTARY DATA - 1 -

SUPPLEMENTARY DATA - 1 - - 1 - SUPPLEMENTARY DATA Construction of B. subtilis rnpb complementation plasmids For complementation, the B. subtilis rnpb wild-type gene (rnpbwt) under control of its native rnpb promoter and terminator

More information

Received 12 June 1995/Accepted 10 August 1995

Received 12 June 1995/Accepted 10 August 1995 JOURNAL OF BACTERIOLOGY, Oct. 1995, p. 5906 5911 Vol. 177, No. 20 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology Use of Green Fluorescent Protein for Visualization of Cell-Specific

More information

A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum of toxic heavy metal ions

A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum of toxic heavy metal ions Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 SUPPORTING INFORMATION A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum

More information

Roles of hilc and hild in Regulation of hila Expression in Salmonella enterica Serovar Typhimurium

Roles of hilc and hild in Regulation of hila Expression in Salmonella enterica Serovar Typhimurium JOURNAL OF BACTERIOLOGY, May 2001, p. 2733 2745 Vol. 183, No. 9 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.9.2733 2745.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Roles

More information

Bacterial strains, plasmids, and growth conditions. Bacterial strains and

Bacterial strains, plasmids, and growth conditions. Bacterial strains and I Text I Materials and Methods acterial strains, plasmids, and growth conditions. acterial strains and plasmids used in this study are listed in I Table. almonella enterica serovar Typhimurium strains

More information

Autoregulation of swraa and Motility in Bacillus subtilis

Autoregulation of swraa and Motility in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Aug. 2008, p. 5720 5728 Vol. 190, No. 16 0021-9193/08/$08.00 0 doi:10.1128/jb.00455-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Autoregulation of

More information

Cyclic di-amp homeostasis in Bacillus subtilis: both lack and high-level accumulation of the nucleotide are detrimental for cell growth

Cyclic di-amp homeostasis in Bacillus subtilis: both lack and high-level accumulation of the nucleotide are detrimental for cell growth Cyclic di-amp homeostasis in Bacillus subtilis: both lack and high-level accumulation of the nucleotide are detrimental for cell growth Felix M. P. Mehne 1, Katrin Gunka 1, Hinnerk Eilers 1, Christina

More information

Processing of a Membrane Protein Required for Cell-to-Cell Signaling during Endospore Formation in Bacillus subtilis

Processing of a Membrane Protein Required for Cell-to-Cell Signaling during Endospore Formation in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Dec. 2008, p. 7786 7796 Vol. 190, No. 23 0021-9193/08/$08.00 0 doi:10.1128/jb.00715-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Processing of a Membrane

More information

Honors Thesis: Characterization of the Che7 System of Myxococcus xanthus through a Yeast Two-Hybrid Assay

Honors Thesis: Characterization of the Che7 System of Myxococcus xanthus through a Yeast Two-Hybrid Assay Honors Thesis: Characterization of the Che7 System of Myxococcus xanthus through a Yeast Two-Hybrid Assay By: Erin Epperson and John Kirby* Georgia Institute of Technology School of Biology Atlanta, GA

More information

Noise in a phosphorelay drives stochastic entry into sporulation in Bacillus subtilis

Noise in a phosphorelay drives stochastic entry into sporulation in Bacillus subtilis Article Noise in a phosphorelay drives stochastic entry into sporulation in Bacillus subtilis Jonathan R Russell 1, Matthew T Cabeen 1, Paul A Wiggins 2, Johan Paulsson 3 & Richard Losick 1,* Abstract

More information

Comparison of the expression patterns of several sox genes between Oryzias latipes and Danio rerio

Comparison of the expression patterns of several sox genes between Oryzias latipes and Danio rerio Urun 1 Comparison of the expression patterns of several sox genes between Oryzias latipes and Danio rerio Fatma Rabia URUN ilkent University, nkara - TURKEY High mobility group domain containing transcription

More information

Abh and AbrB Control of Bacillus subtilis Antimicrobial Gene Expression

Abh and AbrB Control of Bacillus subtilis Antimicrobial Gene Expression JOURNAL OF BACTERIOLOGY, Nov. 2007, p. 7720 7732 Vol. 189, No. 21 0021-9193/07/$08.00 0 doi:10.1128/jb.01081-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Abh and AbrB Control

More information

Multiple Interactions between the Transmembrane Division Proteins of Bacillus subtilis and the Role of FtsL Instability in Divisome Assembly

Multiple Interactions between the Transmembrane Division Proteins of Bacillus subtilis and the Role of FtsL Instability in Divisome Assembly JOURNAL OF BACTERIOLOGY, Nov. 2006, p. 7396 7404 Vol. 188, No. 21 0021-9193/06/$08.00 0 doi:10.1128/jb.01031-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Multiple Interactions

More information

Sporulation Phenotype of a Bacillus subtilis Mutant Expressing an Unprocessable but Active E Transcription Factor

Sporulation Phenotype of a Bacillus subtilis Mutant Expressing an Unprocessable but Active E Transcription Factor JOURNAL OF BACTERIOLOGY, Apr. 2004, p. 1999 2005 Vol. 186, No. 7 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.7.1999 2005.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Sporulation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Temporal competition between differentiation programs determines cell fate choice Anna Kuchina 1,2, Lorena Espinar 3, Tolga Çağatay 1,2, Alejandro O. Balbin 1,2, Fang Zhang 1,2,

More information

Zipper-like interaction between proteins in adjacent daughter cells mediates protein localization

Zipper-like interaction between proteins in adjacent daughter cells mediates protein localization Zipper-like interaction between proteins in adjacent daughter cells mediates protein localization Bill Blaylock, 2,3 Xin Jiang, 1,3 Aileen Rubio, 1 Charles P. Moran Jr., 2 and Kit Pogliano 1,4 1 Division

More information

Effects on Bacillus subtilis of a Conditional Lethal Mutation in

Effects on Bacillus subtilis of a Conditional Lethal Mutation in JOURNAL OF BACTERIOLOGY, Dec. 1994, P. 7155-716 21-9193/94/$4.+ Copyright 1994, American Society for Microbiology Vol. 176, No. 23 Effects on Bacillus subtilis of a Conditional Lethal Mutation in the Essential

More information

Supplementary Figure 1 Biochemistry of gene duplication

Supplementary Figure 1 Biochemistry of gene duplication Supplementary Figure 1 Biochemistry of gene duplication (a) (b) (c) (d) A B C A (e) Selection (f) reca KO Supplementary Figure 1: Tandem gene duplication: construction, amplification, and stabilization.

More information

Citation for published version (APA): Krom, B. P. (2002). Citrate transporters of Bacillus subtilis Groningen: s.n.

Citation for published version (APA): Krom, B. P. (2002). Citrate transporters of Bacillus subtilis Groningen: s.n. University of Groningen Citrate transporters of Bacillus subtilis Krom, Bastiaan Philip IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

More information

Mutation in yaat Leads to Significant Inhibition of Phosphorelay during Sporulation in Bacillus subtilis

Mutation in yaat Leads to Significant Inhibition of Phosphorelay during Sporulation in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Oct. 2002, p. 5545 5553 Vol. 184, No. 20 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.20.5545 5553.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Mutation

More information

DivIVA homologues constitute a group of highly conserved

DivIVA homologues constitute a group of highly conserved Protein-Protein Interaction Domains of Bacillus subtilis DivIVA Suey van Baarle, b,c Ilkay Nazli Celik, b Karan Gautam Kaval, a Marc Bramkamp, c,d Leendert W. Hamoen, b,e Sven Halbedel a,b Robert Koch

More information

Characterization of a novel inhibitory feedback of the anti-anti-sigma SpoIIAA on Spo0A activation during development in Bacillus subtilis

Characterization of a novel inhibitory feedback of the anti-anti-sigma SpoIIAA on Spo0A activation during development in Bacillus subtilis Molecular Microbiology (2003) 47(5), 1251 1263 Characterization of a novel inhibitory feedback of the anti-anti-sigma SpoIIAA on Spo0A activation during development in Bacillus subtilis Ana L. Arabolaza,

More information

Assembly Dynamics of FtsZ Rings in Bacillus subtilis and Escherichia coli and Effects of FtsZ-Regulating Proteins

Assembly Dynamics of FtsZ Rings in Bacillus subtilis and Escherichia coli and Effects of FtsZ-Regulating Proteins JOURNAL OF BACTERIOLOGY, Sept. 2004, p. 5775 5781 Vol. 186, No. 17 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.17.5775 5781.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Assembly

More information

Integration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome

Integration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome J. Gen. Appl. Microbiol., 44, 107 111 (1998) Short Communication Integration and amplification of the Bacillus sp. 79-23 cellulase gene in the Bacillus subtilis 168 chromosome Kyung Hwa Jung, Dae-Hee Lee,

More information

Supporting information

Supporting information Supporting information Synthesis of the compatible solute proline by Bacillus subtilis: point mutations rendering the osmotically controlled prohj promoter hyperactive Tamara Hoffmann 1*, Monika Bleisteiner

More information

Supplemental Data. Architecture-Dependent Noise. Discriminates Functionally Analogous. Differentiation Circuits SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Supplemental Data. Architecture-Dependent Noise. Discriminates Functionally Analogous. Differentiation Circuits SUPPLEMENTAL EXPERIMENTAL PROCEDURES Cell, Volume 139 Supplemental Data Architecture-Dependent Noise Discriminates Functionally Analogous Differentiation Circuits Tolga Çağatay, Marc Turcotte, Michael B. Elowitz, Jordi Garcia-Ojalvo, and

More information

Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing

Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing Ioan I. Ardelean Institute of Biology of the Romanian Academy Centre of Microbiology Splaiul Independentei

More information

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic

More information

Intercellular Nanotubes Mediate Bacterial Communication

Intercellular Nanotubes Mediate Bacterial Communication Intercellular Nanotubes Mediate Bacterial Communication Gyanendra P. Dubey 1 and Sigal Ben-Yehuda 1, * 1 Department of Microbiology and Molecular Genetics, Institute for Medical Research Israel-Canada

More information

BMC Microbiology. Open Access. Abstract

BMC Microbiology. Open Access. Abstract BMC Microbiology BioMed Central Research article DprA/Smf protein localizes at the DNA uptake machinery in competent Bacillus subtilis cells Serkalem Tadesse 1,2 and Peter L Graumann* 1 Open Access Address:

More information

The initiation of sporulation in the Gram-positive organism

The initiation of sporulation in the Gram-positive organism Bacillus subtilis RapA Phosphatase Domain Interaction with Its Substrate, Phosphorylated Spo0F, and Its Inhibitor, the PhrA Peptide Alejandra R. Diaz,* Leighton J. Core,* Min Jiang, Michela Morelli, Christina

More information

James B. Munro, Roger B. Altman, Nathan O Connor, and Scott C. Blanchard

James B. Munro, Roger B. Altman, Nathan O Connor, and Scott C. Blanchard Molecular Cell, Volume 25 Supplemental Data Identification of Two Distinct Hybrid State Intermediates on the Ribosome James B. Munro, Roger B. Altman, Nathan O Connor, and Scott C. Blanchard Wild-type

More information

DegU-P Represses Expression of the Motility fla-che Operon in Bacillus subtilis

DegU-P Represses Expression of the Motility fla-che Operon in Bacillus subtilis JOURNAL OF BACTERIOLOGY, Sept. 2004, p. 6003 6014 Vol. 186, No. 18 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.18.6003 6014.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. DegU-P

More information

Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk

Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk Molecular Microbiology (2002) 43(1), 15 26 Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk Tran Thu Hoa, Pablo Tortosa, Mark Albano and David Dubnau* Public Health

More information

University of Groningen

University of Groningen University of Groningen Visualization of differential gene expression by improved cyan fluorescent protein and yellow fluorescent protein production in Bacillus subtilis Veening, JW; Smits, WK; Hamoen,

More information

DegU-P Represses Expression of the

DegU-P Represses Expression of the DegU-P Represses Expression of the Motility fla-che Operon in Bacillus subtilis Giuseppe Amati, Paola Bisicchia and Alessandro Galizzi J. Bacteriol. 2004, 186(18):6003. DOI: 10.1128/JB.186.18.6003-6014.2004.

More information

A CsgD-Independent Pathway for Cellulose Production and Biofilm Formation in Escherichia coli

A CsgD-Independent Pathway for Cellulose Production and Biofilm Formation in Escherichia coli JOURNAL OF BACTERIOLOGY, Apr. 2006, p. 3073 3087 Vol. 188, No. 8 0021-9193/06/$08.00 0 doi:10.1128/jb.188.8.3073 3087.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. A CsgD-Independent

More information

Development of inducer free expression plasmids based on IPTG inducible promoters for Bacillus subtilis

Development of inducer free expression plasmids based on IPTG inducible promoters for Bacillus subtilis DOI 10.1186/s12934-017-0747-0 Microbial Cell Factories RESEARCH Open Access Development of inducer free expression plasmids based on IPTG inducible promoters for Bacillus subtilis Dinh Thi Minh Tran 1,3,

More information

PETER J. LEWIS, LING JUAN WU, AND JEFFERY ERRINGTON* Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom

PETER J. LEWIS, LING JUAN WU, AND JEFFERY ERRINGTON* Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom JOURNAL OF BACTERIOLOGY, July 1998, p. 3276 3284 Vol. 180, No. 13 0021-9193/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Establishment of Prespore-Specific Gene Expression

More information

CsoR regulates the copper efflux operon copza in Bacillus subtilis

CsoR regulates the copper efflux operon copza in Bacillus subtilis Microbiology (2007), 153, 4123 4128 DOI 10.1099/mic.0.2007/011742-0 CsoR regulates the copper efflux operon copza in Bacillus subtilis Gregory T. Smaldone and John D. Helmann Correspondence John D. Helmann

More information

Stochastic simulations

Stochastic simulations Stochastic simulations Application to molecular networks Literature overview Noise in genetic networks Origins How to measure and distinguish between the two types of noise (intrinsic vs extrinsic)? What

More information

VITTORIO L. KATIS AND R. GERRY WAKE* Department of Biochemistry, University of Sydney, Sydney, New South Wales 2006, Australia

VITTORIO L. KATIS AND R. GERRY WAKE* Department of Biochemistry, University of Sydney, Sydney, New South Wales 2006, Australia JOURNAL OF BACTERIOLOGY, May 1999, p. 2710 2718 Vol. 181, No. 9 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Membrane-Bound Division Proteins DivIB and

More information

Identification of a New Gene Essential for Germination of Bacillus subtilis Spores with Ca 2 -Dipicolinate

Identification of a New Gene Essential for Germination of Bacillus subtilis Spores with Ca 2 -Dipicolinate JOURNAL OF BACTERIOLOGY, Apr. 2003, p. 2315 2329 Vol. 185, No. 7 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.7.2315 2329.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Identification

More information

FEMS Microbiology Letters 173 (1999) 217^222

FEMS Microbiology Letters 173 (1999) 217^222 FEMS Microbiology Letters 173 (1999) 217^222 Expression of the genes for guanyl-speci c ribonucleases from Bacillus intermedius and Bacillus pumilus is regulated by the two component signal transduction

More information

The Bacillus subtilis SinR and RapA Developmental Regulators Are Responsible for Inhibition of Spore Development by Alcohol

The Bacillus subtilis SinR and RapA Developmental Regulators Are Responsible for Inhibition of Spore Development by Alcohol JOURNAL OF BACTERIOLOGY, Apr. 2005, p. 2662 2672 Vol. 187, No. 8 0021-9193/05/$08.00 0 doi:10.1128/jb.187.8.2662 2672.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. The Bacillus

More information

Coordinated c-di-gmp repression of Salmonella. motility through YcgR and cellulose

Coordinated c-di-gmp repression of Salmonella. motility through YcgR and cellulose JB Accepts, published online ahead of print on 16 November 2012 J. Bacteriol. doi:10.1128/jb.01789-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Coordinated c-di-gmp repression

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil

More information

Extracellular Proteolytic Activity Plays a Central Role in Swarming Motility in Bacillus subtilis

Extracellular Proteolytic Activity Plays a Central Role in Swarming Motility in Bacillus subtilis JOURNAL OF BACTERIOLOGY, July 2004, p. 4159 4167 Vol. 186, No. 13 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.13.4159 4167.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Extracellular

More information

Structural insights into bacterial flagellar hooks similarities and specificities

Structural insights into bacterial flagellar hooks similarities and specificities Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation:

More information

Natural Genetic Competence in Bacillus subtilis Natto OK2

Natural Genetic Competence in Bacillus subtilis Natto OK2 JOURNAL OF BACTERIOLOGY, May 2000, p. 2411 2415 Vol. 182, No. 9 0021-9193/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Natural Genetic Competence in Bacillus subtilis

More information

Fitness constraints on horizontal gene transfer

Fitness constraints on horizontal gene transfer Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:

More information

YodL and YisK possess shape-modifying activities that are suppressed by mutations in Bacillus subtilis mreb and mbl

YodL and YisK possess shape-modifying activities that are suppressed by mutations in Bacillus subtilis mreb and mbl JB Accepted Manuscript Posted Online 23 May 2016 J. Bacteriol. doi:10.1128/jb.00183-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 YodL and YisK possess shape-modifying

More information