Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al.
|
|
- Eustace Williams
- 5 years ago
- Views:
Transcription
1 Supplemental materials for Evidence for cyclic-di-gmp-mediated signaling pathway in Bacillus subtilis by Chen Y. et al. 1. Table S1. Strains used in this study 2. Table S2. Plasmids used in this study 3. Table S1. Primers used in this study 4. Supplemental methods 5. Supplemental references
2 Table S1. Strains used in this study. strain genotype reference E. coli XL1 Blue an E. coli strain used for molecular cloning Invitrogen BTH101 an E. coli host strain for bacterial two hybrid assay (6) RL219 RL1927 RL1936 DH5α derivative containing the plasmid pdg268, Amp R, Cm R DH5α derivative containing the plasmid pdg1662, Amp R, Spc R DH5α derivative containing the plasmid pdg780, Amp R, Kan R (1) (5) Losick lab collection RL3002 RL3544 DH5α derivative containing the plasmid pdr111, Amp R, Spc R DH5α derivative containing the plasmid pah54, Amp R, Spc R (7) Losick lab collection RL3545 DH5α derivative containing the plasmid pah52, Amp R, Mls R Losick lab collection RL4505 DH5α derivative containing the plasmid pac225, Amp R, Cm R Losick lab collection B. subtilis PY79 laboratory strain used as a host for transformation 3610 undomesticated wild strain capable of forming robust biofilms (2) RL4620 spo0a in 3610, Kan R Losick lab collection RL4573 kina kinb in 3610, Mls R, Kan R (8) RL5273 kinc kind in 3610, Mls R, Tet R (8) YC110 amye::p epsa -lacz in 3610, Cm R (3) YC121 amye::p tapa -lacz in 3610, Cm R (4) CY3 ypfa in 3610, Kan R this study CY5 yhck in 3610, Mls R this study CY7 ytrp in 3610, Spec R this study CY8 yybt in 3610, Kan R this study CY9 yuxh in 3610, Mls R this study CY10 ykow in 3610, Mls R this study CY11 ykui in 3610, Cm R this study CY24 yybt yhck ytrp in 3610, Kan R, Mls R, Spec R this study CY25 yuxh ykui ykow in 3610, Spec R, Cm R, Mls R this study CY30 yuxh ypfa in 3610, Mls R, Kan R this study CY84 amye::p hyspank -ypfa in 3610, Spec R this study CY85 yuxh, amye::p hyspank -ypfa in 3610, Mls R, Spec R this study CY87 yuxh, amye::yuxh wt in 3610, Mls R, Cm R this study CY88 yuxh, amye::yuxh mut (ELL>AEL) in 3610, Mls R, Cm R this study CY89 yuxh, amye::yuxh mut (ELL>EDA) in 3610, Mls R, Cm R this study CY110 amye::p yuxh -lacz in 3610, Cm R this study CY121 spo0a, amye::p yuxh -lacz in 3610, Kan R, Cm R this study CY158 yuxh, ypfa, amye::p hyspank -gst-ypfa in 3610, Mls R, Kan R, Spec R this study CY182 yuxh, ypfa, amye::p hyspank -gst in 3610, Mls R, Kan R, Spec R this study CY230 kina kinb ypfa in 3610, Cm R, Mls R, Kan R this study CY231 kinc kind ypfa in 3610, Mls R, Tet R, Kan R this study CY301 ypfa-pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY302 ypfa-pknt25, flig-pch363 in BTH101, Kan R, Amp R this study CY303 yabk-pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY304 yabk-pknt25, flig-pch363 in BTH101, Kan R, Amp R this study CY305 ypfa-pknt25, pch363 in BTH101, Kan R, Amp R this study CY306 yabk-pknt25, pch363 in BTH101, Kan R, Amp R this study CY307 pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY308 pknt25, flig-pch363 in BTH101, Kan R, Amp R this study CY309 pknt25, pch363 in BTH101, Kan R, Amp R this study CY331 yuxh, amye::p hyspank -ypfa R100F in 3610, Mls R, Spec R this study CY332 yuxh, amye::p hyspank ypfa R104D in 3610, Mls R, Spec R this study CY357 ypfa R100F -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY358 ypfa R104D -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY372 ypfa K24D -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY373 ypfa N127A -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY375 ypfa G132A -pknt25, mota-pch363 in BTH101, Kan R, Amp R this study CY396 yuxh, amye::p hyspank -ypfa K24D in 3610, Mls R, Spec R this study CY397 yuxh, amye::p hyspank -ypfa N127A in 3610, Mls R, Spec R this study CY399 yuxh, amye::p hyspank -ypfa G132A in 3610, Mls R, Spec R this study CY437 ypfa, amye::p epsa -lacz in 3610, Kan R,Cm R this study CY438 ypfa, amye:: P tapa -lacz in 3610, Kan R,Cm R this study
3 Table 2. Plasmids used in this study. pah52 a plasmid for the LHF PCR drug template, Amp R, MLS R Losick lab collection pah54 a pbskii (+) derivative as template for the LHF PCR mutagenesis, Amp R, Spec R Losick lab collection pdg268 pdg780 an amye integration vector that contains a promoter-less lacz, Cm R, Amp R a plasmid for Campbell integration in B. subtilis, Kan R, Amp R (1) Losick lab collection pdg1662 a plasmid for integration at amye in B. subtilis, Cm R, Amp R (5) pdr111 pch363 pknt25 an amye integration vector that contains P hyspank, Spec R, Amp R T18 adenylate cylcase domain, Amp R T25 adenylate cyclase domain, Kan R (7) (6) (6) pgex-2tk an expression vector for GST fusion proteins GE Healthcare pcy58 amye::yuxh mut ( 88 ELL 90 > 88 AEL 90 ) in pdg1662 this study pcy59 amye::yuxh mut ( 88 ELL 90 > 88 EDA 90 ) in pdg1662 this study pcy60 amye::yuxh wt in pdg1662 this study pcy83 amye::p hyspank -ypfa in pdr111 this study pcy88 amye::p hyspank -gst in pdr111 this study pcy100 amye::p yuxh -lacz in pdg268 this study pcy152 amye::p hyspank- gst-ypfa in pdr111 this study pcy283 ypfa cloned into pknt25 between BamHI and EcoRI this study pcy301 yabk cloned into pknt25 between BamHI and EcoRI this study pcy302 mota cloned into pch363 between BamHI and EcoRI this study pcy303 flig cloned into pch363 between KpnI and EcoRI this study
4 Table 3. Primers used in this study. yhck-ko-p1 yhck-ko-p2 yhck-ko-p3 yhck-ko-p4 ytrp-ko-p1 ytrp-ko-p2 ytrp-ko-p3 ytrp-ko-p4 ypfa-ko-p1 ypfa-ko-p2 ypfa-ko-p3 ypfa KO-P4 yybt-ko-p1 yybt-ko-p2 yybt-ko-p3 yybt-ko-p4 yuxh-ko-p1 yuxh-ko-p2 yuxh-ko-p3 yuxh-ko-p4 P yuxh -F1 P yuxh -R1 yuxh-m1-f yuxh-m1-r yuxh-m2-f yuxh-m2-r yuxh-r1 ypfa-f ypfa-r pgex-ypfa-f1 pgex-ypfa-r1 gst-ypfa-f3 gst-ypfa-r2 gst-ck-f1 gst-ck-r3 ypfa-mut K24D -F ypfa-mut K24D -R ypfa-mut R100F -F ypfa-mut R100F -R ypfa-mut R104D -F ypfa-mut R104D- R ypfa-mut N127A -F ypfa-mut N127A -R ypfa-mut G132V -F ypfa-mut G132V -R B 2 ypfa-f B 2 ypfa-r1 B 2 mota-f B 2 mota-r B 2 flig-f B 2 flig-r1 B 2 yabk-f B 2 yabk-r 5 -ATAAACATAGTGATTAACGCGGC-3 5 -CAATTCGCCCTATAGTGAGTCGTCAGTTCTTTCAGCAAATATT-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGAAGAATGAATTCAATGTTCGA-3 5 -GATAAGTAATAGGAATTGACAAC-3 5 -GATCATTGGGAGCAGCAGGCGCA-3 5 -CAATTCGCCCTATAGTGAGTCGTTTAGTTTGTTCTACCATGTT-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGGCTTGATGATTCATGACTCA-3 5 -TAATGTGGAGTCAATTGTGACTT-3 5 -ACCTTCGCTGGATGGACGTAGAA-3 5 -CAATTCGCCCTATAGTGAGTCGTTCTCCAATCTCTATCATTGAC-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGCGAATGGAATAAACATCGGC-3 5 -GTGGCATTTGCCATCCTCAGCGGG-3 5 -ATTCGTATGTTCAGGATGATACG-3 5 -CAATTCGCCCTATAGTGAGTCGTAGCTTGGCATTTCTATCACTC-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGGCGTACAGAGATGAAGGTTA-3 5 -CTTGTGCGTTCTGCTTCTCACAC-3 5 -ATGCGCATGCGCTTGTGCAGGCTT-3 5 -CAATTCGCCCTATAGTGAGTCGT CACCCTCATTGATTTATC-3 5 -CCAGCTTTTGTTCCCTTTAGTGAGGACGCAAAATGATTGCGG-3 5 -CATTTATTGTATCGGTAGAAC-3 5 -GTACGAATTCGAAGAAGAGCTTGAGGAAGAA-3 5 -GTACGGATCCTTACAATACGCGCGGCTTTCA-3 5 -TGTTGCTTATGCAGAGCTGTATAGAGAAA-3 5 -TTTCTCTATACAGCTCTGCATAAGCAACA-3 5 -TTGTCATTGAAGACGCTGAAGATATAC-3 5 -GTATATCTTCAGCGTCTTCAATGACAA-3 5 -GTCAGGATCCTCATTTTGCGTCCATAAGATT-3 5 -GTACAAGCTTAAGGAGGAACTACTATGATAGAGATTGGAGAAAAT-3 5 -GACTGCTAGCTTATTCCATTCGGGCCTTTCT-3 5 -GTACGGATCCATGATAGAGATTGGAGAAAAT-3 5 -GTACGAATTCTTATTCCATTCGGGCCTTTCT-3 5 -GTACAAGCTTAAGGAGGAACTACTATGTCCCCTATACTAGGTTATTG-3 5 -GTACGCTAGCTTATTCCATTCGGGCCTTTCT-3 5 -GTACAAGCTTAAGGAGGAACTACTATGTCCCCTATACTAGGTTAT-3 5 -GTACGCTAGCTCAAACAGATGCACGACGAG-3 5 -TGAATTGAAAAAGGCAAAAAGCGATGCGGTCAGCATCGAAAACAATG-3 5 -CATTGTTTTCGATGCGACCGCATCGCTTTTTGCCTTTTTCAATTCA-3 5 -AAAATGAAAAGAATCCAGCGCTTCCAATATGTAAGAACTGATGCG-3 5 -CGCATCAGTTCTTACATATTGGAAGCGCTGGATTCTTTCATTTT-3 5 -ATCCAGCGCCGCCAATATGTAGACACTGATGCGGTATTAGATGTG-3 5 -CACATCTAATACCGCATCAGTGTCTACATATTGGCGGCGCTGGAT-3 5 -GAGATCCGCACACTATCCTATCTCATCAGTGCAGGCGGCATCGCC-3 5 -GGCGATGCCGCCTGCACTGATGAGATAGGATAGTGTGCGGATCTC-3 5 -ATCCTATAACATCAGTGCAGGCGTCATCGCCGTGGTTTTAGCTGATG-3 5 -CATCAGCTAAAACCACGGCGATGACGCCTGCACTGATGTTATAGGAT-3 5 -GTACGGATCCGATAGAGATTGGAGAAAATGTA-3 5 -GTACGAATTCCGTTCCATTCGGGCCTTTCTTCT-3 5 -GTACGGATCCGATGGATAAAACTTCGTTAATCG-3 5 -GTACGAATTCCGTGCTTCTTCTTCTTTTTTCTCGC-3 5 -GTACGGTACCGATGGCGAGACGTGATCAAGATAAG-3 5 -GTACGAATTCCGGACAATAATATCATCCCCTC-3 5 -GTACGGATCCGATGGCTTTGCATTATTATTGTC-3 5 -GTACGAATTCCGTTGAATAAATGTGTGATATTC-3
5 Supplemental methods Assays of swimming motility. The effect on swimming motility by overexpression of YpfA in B. subtilis was examined as follows. CY85 ( yuxh amye::p hyspank -ypfa) cells were grown in LB shaking culture to O.D. 600 about 0.3. IPTG was added to the culture at a final concentration of 50 µm. After 30 min of incubation at 37 C, 50 µl of cell suspension was quickly spotted on a cover slide and analyzed by time-lapse phasecontrast microscopy cells treated with IPTG and CY85 cells without IPTG treatment were used as controls. Cell movement in each sample was recorded for about 10 seconds.
6 Supplemental references 1. Antoniewski, C., B. Savelli, and P. Stragier The spoiij gene, which regulates early developmental steps in Bacillus subtilis, belongs to a class of environmentally responsive genes. J. Bacteriol. 172: Branda, S. S., J. E. Gonzalez-Pastor, S. Ben-Yehuda, R. Losick, and R. Kolter Fruiting body formation by Bacillus subtilis. Proc. Natl. Acad. Sci. USA 98: Chai, Y., F. Chu, R. Kolter, and R. Losick Bistability and biofilm formation in Bacillus subtilis. Mol. Microbiol. 67: Chai, Y., R. Kolter, and R. Losick Paralogous antirepressors acting on the master regulator for biofilm formation in Bacillus subtilis. Molecular Microbiology 74: Guérout-Fleury, A. M., N. Frandsen, and P. Stragier Plasmids for ectopic integration in Bacillus subtilis. Gene 180: Karimova, G., J. Pidoux, A. Ullmann, and D. Ladant A bacterial twohybrid system based on a reconstituted signal transduction pathway. Proc. Natl. Acad. Sci. USA 95: Kearns, D. B., and R. Losick Cell population heterogeneity during growth of Bacillus subtilis. Genes Dev. 19: McLoon, A. L., I. Kolodkin-Gal, S. M. Rubinstein, R. Kolter, and R. Losick Spatial regulation of histidine kinases governing biofilm formation in Bacillus subtilis. J. Bacteriol. 193:
Supporting Information
Supporting Information López et al. 10.1073/pnas.0810940106 1. Ivey DM, et al. (1993) Cloning and characterization of a putative Ca2 /H antiporter gene from Escherichia coli upon functional complementation
More informationSalt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation
Salt-sensitivity of SigH and Spo0A prevents Bacillus subtilis sporulation at high osmolarity avoiding death during cellular differentiation Nils Widderich 1,, Christopher D.A. Rodrigues 2,, Fabian M. Commichau
More informationPhosphorylation of Spo0A by the Histidine Kinase KinD Requires the Lipoprotein Med in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Aug. 2011, p. 3949 3955 Vol. 193, No. 15 0021-9193/11/$12.00 doi:10.1128/jb.05199-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Phosphorylation of
More informationEvidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A
Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A Masaya Fujita and Richard Losick 1 Department of Molecular
More informationkina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051
Microbiology (2008), 154, 54 63 DOI 10.1099/mic.0.2007/011783-0 kina mrna is missing a stop codon in the undomesticated Bacillus subtilis strain ATCC 6051 Kazuo Kobayashi, 1 Ritsuko Kuwana 2 and Hiromu
More informationUsing Mini-Tn10 Transposon System to Research the Genes Involved in Biofilm Formation in Bacillus
Microbiology tongbao@im.ac.cn MAR 20, 2009, 36(3): 345~349 2009 by Institute of Microbiology, CAS mini-tn10 1,2 1 1 1 1 1 1,2* (1. 300071) (2. 300071) :, mini-tn10 NK10.BAhjaWT 400, 90% 4, citbcitggpsa
More informationA Widely Conserved Gene Cluster Required for Lactate Utilization in Bacillus subtilis and Its Involvement in Biofilm Formation
JOURNAL OF BACTERIOLOGY, Apr. 2009, p. 2423 2430 Vol. 191, No. 8 0021-9193/09/$08.00 0 doi:10.1128/jb.01464-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. A Widely Conserved
More informationThe Major Role of Spo0A in Genetic Competence Is To Downregulate abrb, an Essential Competence Gene
JOURNAL OF BACTERIOLOGY, June 1995, p. 3601 3605 Vol. 177, No. 12 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology The Major Role of Spo0A in Genetic Competence Is To Downregulate
More informationMstX and a Putative Potassium Channel Facilitate Biofilm Formation in Bacillus subtilis
MstX and a Putative Potassium Channel Facilitate Biofilm Formation in Bacillus subtilis Matthew E. Lundberg 1,2, Eric C. Becker 2, Senyon Choe 1,2 * 1 Structural Biology Laboratory, The Salk Institute,
More informationYycH and YycI Interact To Regulate the Essential YycFG Two-Component System in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Apr. 2007, p. 3280 3289 Vol. 189, No. 8 0021-9193/07/$08.00 0 doi:10.1128/jb.01936-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. YycH and YycI Interact
More informationThe Threshold Level of the Sensor Histidine Kinase KinA Governs Entry into Sporulation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Aug. 2010, p. 3870 3882 Vol. 192, No. 15 0021-9193/10/$12.00 doi:10.1128/jb.00466-10 Copyright 2010, American Society for Microbiology. All Rights Reserved. The Threshold Level
More informationCannibalism by Sporulating Bacteria
Cannibalism by Sporulating Bacteria José E. González-Pastor, Erret C. Hobbs, Richard Losick 2003. Science 301:510-513 Introduction Some bacteria form spores. Scientist are intrigued by them. Bacillus subtilis
More informationJOHN R. LEDEAUX AND ALAN D. GROSSMAN* Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
JOURNAL OF BACTERIOLOGY, Jan. 1995, p. 166 175 Vol. 177, No. 1 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology Isolation and Characterization of kinc, a Gene That Encodes a Sensor
More informationSupporting Information
Supporting Information Espinar et al. 1.173/pnas.12169111 SI Materials and Methods Growth Conditions for Microscopy. For the experiments presented in the main text, Bacillus subtilis cells were grown at
More informationGalactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis
RESEARCH ARTICLE Galactose Metabolism Plays a Crucial Role in Biofilm Formation by Bacillus subtilis Yunrong Chai, a Pascale B. Beauregard, b Hera Vlamakis, b Richard Losick, a and Roberto Kolter b Department
More informationIn vivo characterization of the scaffold activity of flotillin on the membrane kinase KinC of Bacillus subtilis
Microbiology (215), 161, 1871 1888 DOI 1.199/mic..137 Editor s Choice Correspondence Daniel Lopez daniel.lopez@uni-wuerzburg.de or dlopez@cnb.csic.es In vivo characterization of the scaffold activity of
More informationA combination of glycerol and manganese promotes biofilm formation in Bacillus subtilis
JB Accepts, published online ahead of print on 5 April 2013 J. Bacteriol. doi:10.1128/jb.00028-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 A combination of glycerol and
More informationSupplemental Figure 1.
A wt spoiiiaδ spoiiiahδ bofaδ B C D E spoiiiaδ, bofaδ Supplemental Figure 1. GFP-SpoIVFA is more mislocalized in the absence of both BofA and SpoIIIAH. Sporulation was induced by resuspension in wild-type
More informationControl of cell fate by the formation of an architecturally complex bacterial community
Control of cell fate by the formation of an architecturally complex bacterial community Hera Vlamakis, 1,3 Claudio Aguilar, 1,3 Richard Losick, 2 and Roberto Kolter 1,4 1 Department of Microbiology and
More informationReplication Initiation Proteins Regulate a Developmental Checkpoint in Bacillus subtilis
Cell, Vol. 104, 269 279, January 26, 2001, Copyright 2001 by Cell Press Replication Initiation Proteins Regulate a Developmental Checkpoint in Bacillus subtilis William F. Burkholder, Iren Kurtser, and
More informationStrain or plasmid Relevant characteristics Reference
Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688
More informationSinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis
Leiman et al. BMC Microbiology 2014, 14:301 RESEARCH ARTICLE Open Access SinR is a mutational target for fine-tuning biofilm formation in laboratory-evolved strains of Bacillus subtilis Sara A Leiman 1,
More informationSupporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
More informationUniversity of Dundee. Published in: Microbiology-SGM. DOI: /mic Publication date: 2014
University of Dundee The protein tyrosine kinases EpsB and PtkA differentially affect biofilm formation in Bacillus subtilis Gerwig, Jan; Kiley, Taryn B.; Gunka, Katrin; Stanley-Wall, Nicola; Stülke, Jörg
More informationMini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for
Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI
More informationCharacterization of sporulation histidine kinases of Paenibacillus polymyxa
Research in Microbiology 163 (2012) 272e278 www.elsevier.com/locate/resmic Characterization of sporulation histidine kinases of Paenibacillus polymyxa Soo-Young Park a, Seung-Hwan Park a,b, Soo-Keun Choi
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/5/e1500358/dc1 Supplementary Materials for Transplantability of a circadian clock to a noncircadian organism Anna H. Chen, David Lubkowicz, Vivian Yeong,
More informationSupporting Information
1 Supporting Information 5 6 7 8 9 10 11 1 1 1 15 16 17 Sequences: E. coli lysine riboswitch (ECRS): GTACTACCTGCGCTAGCGCAGGCCAGAAGAGGCGCGTTGCCCAAGTAACGGTGTTGGAGGAGCCAG TCCTGTGATAACACCTGAGGGGGTGCATCGCCGAGGTGATTGAACGGCTGGCCACGTTCATCATCGG
More informationTriggering sporulation in Bacillus subtilis with artificial two-component systems reveals the importance of proper Spo0A activation dynamics
Molecular Microbiology (23) 9(), 8 94 doi:./mmi.2357 First published online 23 August 23 Triggering sporulation in Bacillus subtilis with artificial two-component systems reveals the importance of proper
More informationSupplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster.
Supplementary Figure 1 Mycobacterium tuberculosis WhiB1 expressed in Mycobacterium smegmatis possesses an O 2 -stable [4Fe-4S] cluster. a, Absorbance spectra of WhiB1 isolated from recombinant M. smegmatis
More informationHelical Macrofiber Formation in Bacillus subtilis: Inhibition by Penicillin G
JOURNAL OF BACTERIOLOGY, June 1984, p. 1182-1187 0021-9193/84/061182-06$02.00/0 Copyright C 1984, American Society for Microbiology Vol. 158, No. 3 Helical Macrofiber Formation in Bacillus subtilis: Inhibition
More informationRole of Leucine Zipper Motifs in Association of the Escherichia coli Cell Division Proteins FtsL and FtsB
JOURNAL OF BACTERIOLOGY, Sept. 2011, p. 4988 4992 Vol. 193, No. 18 0021-9193/11/$12.00 doi:10.1128/jb.00324-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Role of Leucine Zipper
More informationAnalyses of mrp Genes during Myxococcus xanthus Development
JOURNAL OF BACTERIOLOGY, Dec. 2001, p. 6733 6739 Vol. 183, No. 23 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.23.6733 6739.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Analyses
More informationMicrobes of many kinds enter complex pathways of development
Fruiting body formation by Bacillus subtilis Steven S. Branda*, José Eduardo González-Pastor, Sigal Ben-Yehuda, Richard Losick, and Roberto Kolter* *Department of Microbiology and Molecular Genetics, Harvard
More informationThe master regulator for entry into sporulation in Bacillus subtilis becomes a cell-specific transcription factor after asymmetric division
The master regulator for entry into sporulation in Bacillus subtilis becomes a cell-specific transcription factor after asymmetric division Masaya Fujita and Richard Losick 1 Department of Molecular and
More informationSUPPLEMENTARY INFORMATION
Supplementary Results and Discussion General properties of L-form cells Phase contrast microscopy of L-form strain Bs115 sup21 revealed that cells were very heterogeneous in size (Fig. 1h) ranging from
More informationOptimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli
Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4
More informationydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
More informationCheX in the Three-Phosphatase System of Bacterial Chemotaxis
JOURNAL OF BACTERIOLOGY, Oct. 2007, p. 7007 7013 Vol. 189, No. 19 0021-9193/07/$08.00 0 doi:10.1128/jb.00896-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. CheX in the Three-Phosphatase
More informationModulation of the ComA-Dependent Quorum Response in Bacillus subtilis by Multiple Rap Proteins and Phr Peptides
JOURNAL OF BACTERIOLOGY, July 2006, p. 5273 5285 Vol. 188, No. 14 0021-9193/06/$08.00 0 doi:10.1128/jb.00300-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Modulation of the
More informationRole of GerD in Germination of Bacillus subtilis Spores
JOURNAL OF BACTERIOLOGY, Feb. 2007, p. 1090 1098 Vol. 189, No. 3 0021-9193/07/$08.00 0 doi:10.1128/jb.01606-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Role of GerD in Germination
More informationRegulation of Synthesis of the Bacillus subtilis Transition-Phase, Spore-Associated Antibacterial Protein TasA
JOURNAL OF BACTERIOLOGY, Oct. 1999, p. 5476 5481 Vol. 181, No. 17 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Regulation of Synthesis of the Bacillus subtilis
More information2. Yeast two-hybrid system
2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates
More informationCodY Is Required for Nutritional Repression of Bacillus subtilis Genetic Competence
JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5910 5915 Vol. 178, No. 20 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology CodY Is Required for Nutritional Repression of Bacillus subtilis
More informationSupporting Information
Supporting Information Sana et al. 10.1073/pnas.1608858113 Fig. S1. Representation of the SPI-6 type VI secretion system. (A) Representation of the SPI-6 genetic locus starting at STM0266 and ending at
More informationRole of CodY in Regulation of the Bacillus subtilis hut Operon
JOURNAL OF BACTERIOLOGY, July 1996, p. 3779 3784 Vol. 178, No. 13 0021-9193/96/$04.00 0 Copyright 1996, American Society for Microbiology Role of CodY in Regulation of the Bacillus subtilis hut Operon
More informationcote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work
SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)
More informationSUPPLEMENTARY DATA - 1 -
- 1 - SUPPLEMENTARY DATA Construction of B. subtilis rnpb complementation plasmids For complementation, the B. subtilis rnpb wild-type gene (rnpbwt) under control of its native rnpb promoter and terminator
More informationReceived 12 June 1995/Accepted 10 August 1995
JOURNAL OF BACTERIOLOGY, Oct. 1995, p. 5906 5911 Vol. 177, No. 20 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology Use of Green Fluorescent Protein for Visualization of Cell-Specific
More informationA sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum of toxic heavy metal ions
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 SUPPORTING INFORMATION A sensitive whole-cell biosensor for the simultaneous detection of a broad-spectrum
More informationRoles of hilc and hild in Regulation of hila Expression in Salmonella enterica Serovar Typhimurium
JOURNAL OF BACTERIOLOGY, May 2001, p. 2733 2745 Vol. 183, No. 9 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.9.2733 2745.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Roles
More informationBacterial strains, plasmids, and growth conditions. Bacterial strains and
I Text I Materials and Methods acterial strains, plasmids, and growth conditions. acterial strains and plasmids used in this study are listed in I Table. almonella enterica serovar Typhimurium strains
More informationAutoregulation of swraa and Motility in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Aug. 2008, p. 5720 5728 Vol. 190, No. 16 0021-9193/08/$08.00 0 doi:10.1128/jb.00455-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Autoregulation of
More informationCyclic di-amp homeostasis in Bacillus subtilis: both lack and high-level accumulation of the nucleotide are detrimental for cell growth
Cyclic di-amp homeostasis in Bacillus subtilis: both lack and high-level accumulation of the nucleotide are detrimental for cell growth Felix M. P. Mehne 1, Katrin Gunka 1, Hinnerk Eilers 1, Christina
More informationProcessing of a Membrane Protein Required for Cell-to-Cell Signaling during Endospore Formation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Dec. 2008, p. 7786 7796 Vol. 190, No. 23 0021-9193/08/$08.00 0 doi:10.1128/jb.00715-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Processing of a Membrane
More informationHonors Thesis: Characterization of the Che7 System of Myxococcus xanthus through a Yeast Two-Hybrid Assay
Honors Thesis: Characterization of the Che7 System of Myxococcus xanthus through a Yeast Two-Hybrid Assay By: Erin Epperson and John Kirby* Georgia Institute of Technology School of Biology Atlanta, GA
More informationNoise in a phosphorelay drives stochastic entry into sporulation in Bacillus subtilis
Article Noise in a phosphorelay drives stochastic entry into sporulation in Bacillus subtilis Jonathan R Russell 1, Matthew T Cabeen 1, Paul A Wiggins 2, Johan Paulsson 3 & Richard Losick 1,* Abstract
More informationComparison of the expression patterns of several sox genes between Oryzias latipes and Danio rerio
Urun 1 Comparison of the expression patterns of several sox genes between Oryzias latipes and Danio rerio Fatma Rabia URUN ilkent University, nkara - TURKEY High mobility group domain containing transcription
More informationAbh and AbrB Control of Bacillus subtilis Antimicrobial Gene Expression
JOURNAL OF BACTERIOLOGY, Nov. 2007, p. 7720 7732 Vol. 189, No. 21 0021-9193/07/$08.00 0 doi:10.1128/jb.01081-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Abh and AbrB Control
More informationMultiple Interactions between the Transmembrane Division Proteins of Bacillus subtilis and the Role of FtsL Instability in Divisome Assembly
JOURNAL OF BACTERIOLOGY, Nov. 2006, p. 7396 7404 Vol. 188, No. 21 0021-9193/06/$08.00 0 doi:10.1128/jb.01031-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Multiple Interactions
More informationSporulation Phenotype of a Bacillus subtilis Mutant Expressing an Unprocessable but Active E Transcription Factor
JOURNAL OF BACTERIOLOGY, Apr. 2004, p. 1999 2005 Vol. 186, No. 7 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.7.1999 2005.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Sporulation
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Temporal competition between differentiation programs determines cell fate choice Anna Kuchina 1,2, Lorena Espinar 3, Tolga Çağatay 1,2, Alejandro O. Balbin 1,2, Fang Zhang 1,2,
More informationZipper-like interaction between proteins in adjacent daughter cells mediates protein localization
Zipper-like interaction between proteins in adjacent daughter cells mediates protein localization Bill Blaylock, 2,3 Xin Jiang, 1,3 Aileen Rubio, 1 Charles P. Moran Jr., 2 and Kit Pogliano 1,4 1 Division
More informationEffects on Bacillus subtilis of a Conditional Lethal Mutation in
JOURNAL OF BACTERIOLOGY, Dec. 1994, P. 7155-716 21-9193/94/$4.+ Copyright 1994, American Society for Microbiology Vol. 176, No. 23 Effects on Bacillus subtilis of a Conditional Lethal Mutation in the Essential
More informationSupplementary Figure 1 Biochemistry of gene duplication
Supplementary Figure 1 Biochemistry of gene duplication (a) (b) (c) (d) A B C A (e) Selection (f) reca KO Supplementary Figure 1: Tandem gene duplication: construction, amplification, and stabilization.
More informationCitation for published version (APA): Krom, B. P. (2002). Citrate transporters of Bacillus subtilis Groningen: s.n.
University of Groningen Citrate transporters of Bacillus subtilis Krom, Bastiaan Philip IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationMutation in yaat Leads to Significant Inhibition of Phosphorelay during Sporulation in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Oct. 2002, p. 5545 5553 Vol. 184, No. 20 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.20.5545 5553.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Mutation
More informationDivIVA homologues constitute a group of highly conserved
Protein-Protein Interaction Domains of Bacillus subtilis DivIVA Suey van Baarle, b,c Ilkay Nazli Celik, b Karan Gautam Kaval, a Marc Bramkamp, c,d Leendert W. Hamoen, b,e Sven Halbedel a,b Robert Koch
More informationCharacterization of a novel inhibitory feedback of the anti-anti-sigma SpoIIAA on Spo0A activation during development in Bacillus subtilis
Molecular Microbiology (2003) 47(5), 1251 1263 Characterization of a novel inhibitory feedback of the anti-anti-sigma SpoIIAA on Spo0A activation during development in Bacillus subtilis Ana L. Arabolaza,
More informationAssembly Dynamics of FtsZ Rings in Bacillus subtilis and Escherichia coli and Effects of FtsZ-Regulating Proteins
JOURNAL OF BACTERIOLOGY, Sept. 2004, p. 5775 5781 Vol. 186, No. 17 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.17.5775 5781.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Assembly
More informationIntegration and amplification of the Bacillus sp cellulase gene in the Bacillus subtilis 168 chromosome
J. Gen. Appl. Microbiol., 44, 107 111 (1998) Short Communication Integration and amplification of the Bacillus sp. 79-23 cellulase gene in the Bacillus subtilis 168 chromosome Kyung Hwa Jung, Dae-Hee Lee,
More informationSupporting information
Supporting information Synthesis of the compatible solute proline by Bacillus subtilis: point mutations rendering the osmotically controlled prohj promoter hyperactive Tamara Hoffmann 1*, Monika Bleisteiner
More informationSupplemental Data. Architecture-Dependent Noise. Discriminates Functionally Analogous. Differentiation Circuits SUPPLEMENTAL EXPERIMENTAL PROCEDURES
Cell, Volume 139 Supplemental Data Architecture-Dependent Noise Discriminates Functionally Analogous Differentiation Circuits Tolga Çağatay, Marc Turcotte, Michael B. Elowitz, Jordi Garcia-Ojalvo, and
More informationCommunication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing
Communication and Stochastic Processes in Some Bacterial Populations: Significance for Membrane Computing Ioan I. Ardelean Institute of Biology of the Romanian Academy Centre of Microbiology Splaiul Independentei
More informationthe noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
More informationIntercellular Nanotubes Mediate Bacterial Communication
Intercellular Nanotubes Mediate Bacterial Communication Gyanendra P. Dubey 1 and Sigal Ben-Yehuda 1, * 1 Department of Microbiology and Molecular Genetics, Institute for Medical Research Israel-Canada
More informationBMC Microbiology. Open Access. Abstract
BMC Microbiology BioMed Central Research article DprA/Smf protein localizes at the DNA uptake machinery in competent Bacillus subtilis cells Serkalem Tadesse 1,2 and Peter L Graumann* 1 Open Access Address:
More informationThe initiation of sporulation in the Gram-positive organism
Bacillus subtilis RapA Phosphatase Domain Interaction with Its Substrate, Phosphorylated Spo0F, and Its Inhibitor, the PhrA Peptide Alejandra R. Diaz,* Leighton J. Core,* Min Jiang, Michela Morelli, Christina
More informationJames B. Munro, Roger B. Altman, Nathan O Connor, and Scott C. Blanchard
Molecular Cell, Volume 25 Supplemental Data Identification of Two Distinct Hybrid State Intermediates on the Ribosome James B. Munro, Roger B. Altman, Nathan O Connor, and Scott C. Blanchard Wild-type
More informationDegU-P Represses Expression of the Motility fla-che Operon in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, Sept. 2004, p. 6003 6014 Vol. 186, No. 18 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.18.6003 6014.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. DegU-P
More informationRok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk
Molecular Microbiology (2002) 43(1), 15 26 Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comk Tran Thu Hoa, Pablo Tortosa, Mark Albano and David Dubnau* Public Health
More informationUniversity of Groningen
University of Groningen Visualization of differential gene expression by improved cyan fluorescent protein and yellow fluorescent protein production in Bacillus subtilis Veening, JW; Smits, WK; Hamoen,
More informationDegU-P Represses Expression of the
DegU-P Represses Expression of the Motility fla-che Operon in Bacillus subtilis Giuseppe Amati, Paola Bisicchia and Alessandro Galizzi J. Bacteriol. 2004, 186(18):6003. DOI: 10.1128/JB.186.18.6003-6014.2004.
More informationA CsgD-Independent Pathway for Cellulose Production and Biofilm Formation in Escherichia coli
JOURNAL OF BACTERIOLOGY, Apr. 2006, p. 3073 3087 Vol. 188, No. 8 0021-9193/06/$08.00 0 doi:10.1128/jb.188.8.3073 3087.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. A CsgD-Independent
More informationDevelopment of inducer free expression plasmids based on IPTG inducible promoters for Bacillus subtilis
DOI 10.1186/s12934-017-0747-0 Microbial Cell Factories RESEARCH Open Access Development of inducer free expression plasmids based on IPTG inducible promoters for Bacillus subtilis Dinh Thi Minh Tran 1,3,
More informationPETER J. LEWIS, LING JUAN WU, AND JEFFERY ERRINGTON* Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom
JOURNAL OF BACTERIOLOGY, July 1998, p. 3276 3284 Vol. 180, No. 13 0021-9193/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Establishment of Prespore-Specific Gene Expression
More informationCsoR regulates the copper efflux operon copza in Bacillus subtilis
Microbiology (2007), 153, 4123 4128 DOI 10.1099/mic.0.2007/011742-0 CsoR regulates the copper efflux operon copza in Bacillus subtilis Gregory T. Smaldone and John D. Helmann Correspondence John D. Helmann
More informationStochastic simulations
Stochastic simulations Application to molecular networks Literature overview Noise in genetic networks Origins How to measure and distinguish between the two types of noise (intrinsic vs extrinsic)? What
More informationVITTORIO L. KATIS AND R. GERRY WAKE* Department of Biochemistry, University of Sydney, Sydney, New South Wales 2006, Australia
JOURNAL OF BACTERIOLOGY, May 1999, p. 2710 2718 Vol. 181, No. 9 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Membrane-Bound Division Proteins DivIB and
More informationIdentification of a New Gene Essential for Germination of Bacillus subtilis Spores with Ca 2 -Dipicolinate
JOURNAL OF BACTERIOLOGY, Apr. 2003, p. 2315 2329 Vol. 185, No. 7 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.7.2315 2329.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Identification
More informationFEMS Microbiology Letters 173 (1999) 217^222
FEMS Microbiology Letters 173 (1999) 217^222 Expression of the genes for guanyl-speci c ribonucleases from Bacillus intermedius and Bacillus pumilus is regulated by the two component signal transduction
More informationThe Bacillus subtilis SinR and RapA Developmental Regulators Are Responsible for Inhibition of Spore Development by Alcohol
JOURNAL OF BACTERIOLOGY, Apr. 2005, p. 2662 2672 Vol. 187, No. 8 0021-9193/05/$08.00 0 doi:10.1128/jb.187.8.2662 2672.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. The Bacillus
More informationCoordinated c-di-gmp repression of Salmonella. motility through YcgR and cellulose
JB Accepts, published online ahead of print on 16 November 2012 J. Bacteriol. doi:10.1128/jb.01789-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Coordinated c-di-gmp repression
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationExtracellular Proteolytic Activity Plays a Central Role in Swarming Motility in Bacillus subtilis
JOURNAL OF BACTERIOLOGY, July 2004, p. 4159 4167 Vol. 186, No. 13 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.13.4159 4167.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Extracellular
More informationStructural insights into bacterial flagellar hooks similarities and specificities
Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation:
More informationNatural Genetic Competence in Bacillus subtilis Natto OK2
JOURNAL OF BACTERIOLOGY, May 2000, p. 2411 2415 Vol. 182, No. 9 0021-9193/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Natural Genetic Competence in Bacillus subtilis
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationYodL and YisK possess shape-modifying activities that are suppressed by mutations in Bacillus subtilis mreb and mbl
JB Accepted Manuscript Posted Online 23 May 2016 J. Bacteriol. doi:10.1128/jb.00183-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 YodL and YisK possess shape-modifying
More information