Characterization of sporulation histidine kinases of Paenibacillus polymyxa

Transcription

1 Research in Microbiology 163 (2012) 272e278 Characterization of sporulation histidine kinases of Paenibacillus polymyxa Soo-Young Park a, Seung-Hwan Park a,b, Soo-Keun Choi a,b, * a Systems and Synthetic Biology Research Center, KRIBB, 125 Gwahak-ro, Yuseong-gu, Daejeon , Republic of Korea b Biosystems and Bioengineering Program, University of Science and Technology (UST), 217 Gajung-ro, Yuseong-gu, Daejeon , Republic of Korea Received 2 September 2011; accepted 3 February 2012 Available online 23 February 2012 Abstract Sporulation histidine kinases, which sense sporulation-specific signals and initiate phosphorelay reactions, are poorly conserved among Bacillus species. We found several putative genes for sporulation histidine kinases in the genome sequence of Paenibacillus polymyxa E681 and assayed the genes for complementation of sporulation mutants of Bacillus subtilis. One of these genes, Kin1377, significantly restored the sporulation deficiency of kina kinb double mutant of B. subtilis, but not of B. subtilis spo0b mutant. These results indicated that Kin1377 requires B. subtilis Spo0B and possibly Spo0F to transfer phosphate to B. subtilis Spo0A. Another putative kinase, Kin1038, slightly restored the sporulation deficiencies of both kina kinb double mutant and spo0b mutant of B. subtilis. However the sporulation deficiency of the B. subtilis spo0b mutant was significantly restored in the presence of both Kin1038 and P. polymyxa Spo0A. These results indicate that the overexpressed Kin1038 is able to interact directly with and activate P. polymyxa Spo0A, and that Spo0A can support spore formation in B. subtilis. Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Keywords: Paenibacillus polymyxa; Sporulation; Histidine kinase; Phosphorelay 1. Introduction The initiation of sporulation in Bacillus species is regulated by the phosphorelay signal transduction pathway. Phosphorelay is initiated by autophosphorylation of multiple sensor histidine kinases in response to sporulation-specific signals. The kinase phosphoryl group is subsequently transferred to Spo0F, then to Spo0B, and finally to Spo0A (Burbulys et al., 1991). Phosphorylated Spo0A can regulate transcriptional activation or repression of genes related to cell development (Fawcett et al., 2000; Molle et al., 2003). The phosphorelay components Spo0A and Spo0F are highly conserved, while Spo0B is less well conserved and histidine kinases are poorly conserved among Bacillus species (Stephenson and Hoch, 2002). This poor conservation of histidine kinases among species complicates ortholog identification. * Corresponding author. Systems and Synthetic Biology Research Center, KRIBB, 125 Gwahak-ro, Yuseong-gu, Daejeon , Republic of Korea. Tel.: þ ; fax: þ address: sookeun@kribb.re.kr (S.-K. Choi). Paenibacillus polymyxa, which is the type species of the genus Paenibacillus, is a spore-forming Gram-positive bacterium that is well known to produce polymyxin antibiotics active against gram-negative bacteria (Choi et al., 2009; Kim et al., 2010). The clinical value of polymyxin is currently being reconsidered, even though it carries serious side effects such as nephrotoxicity and neurotoxicity, because it is sometimes the only active antibiotic available to treat multidrugresistant gram-negative bacteria such as Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumonia (Landman et al., 2008; Li et al., 2006). Moreover, P. polymyxa has been shown to be a promising biocontrol agent for the suppression of plant pathogens through the production of antimicrobial substances such as polymyxin and fusaricidin (Choi et al., 2008, 2009). In addition, this organism has plant growth-promotion activity related to its ability to produce plant growth-enhancing substances such as auxin (Phi et al., 2008) and cytokinin (Timmuska et al., 1999). However, to date, the various characteristics of this versatile microorganism have been poorly understood, especially the mechanism of sporulation initiation. In the present study, we /$ - see front matter Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. doi: /j.resmic

2 S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e identified genes responsible for initiation of sporulation in the P. polymyxa genome and characterized the function of sporulation histidine kinases by heterologous expression in Bacillus subtilis. The results showed that two P. polymyxa histidine kinases complemented the histidine kinase mutant of B. subtilis. 2. Materials and methods 2.1. Bacterial strains and culture condition The B. subtilis strains used in this study are listed in Table 1. Escherichia coli DH5a was used for construction of recombinant plasmids. The spo0b mutant was selected from colonies grown on spizizen minimal salts medium (SMM) agar plates supplemented with tryptophan (50 mg/ml) and without phenylalanine (Harwood and Cutting, 1990). Schaeffer s sporulation medium (DSM) was used for the sporulation assay (Harwood and Cutting, 1990). Transformations of E. coli DH5a and B. subtilis were conducted as described by Inoue et al. (Inoue et al., 1990) and using a previously reported method (Harwood and Cutting, 1990), respectively. When required, medium was supplemented with chloramphenicol (5 mg/ml), erythromycin (1 mg/ml), spectinomycin (100 mg/ml), neomycin (8 mg/ml) or ampicillin (100 mg/ml) Bioinformatics A basic survey of the genome structure was conducted using the Artemis program (Rutherford et al., 2000) and a functional domain and homology search was conducted using the blast program available at the NCBI web site ( ClustalW was used for sequence alignment. Prediction of the transmembrane segment (TMS) was conducted using web tools, WHAT 2.0 and HMMTOP in TCDB ( (Saier et al., 2009; Tusnady and Simon, 2001; Zhai and Saier, 2001), and the TMHMM program provided by CBS Prediction Severs ( dtu.dk) (Krogh et al., 2001). The 0A box sequence was searched by DBTBS tool ( The domain structures of histidine kinases were predicted using Pfam (Bateman et al., 2000) ( Heterologous expression of P. polymyxa histidine kinases in B. subtilis The PCR primers used in this study are listed in Table 2. The putative P. polymyxa histidine kinase genes kin99, kin689, kin1038, kin1377 and kin3851 were amplified by PCR from the chromosome of P. polymyxa E681 with the primer pairs ppkin99f/ppkin99r, ppkin689f/ppkin689r, ppkin1038f/ ppkin1038r, ppkin1377f/ppkin1377r and ppkin3851f/ ppkin3851r, respectively. The PCR products were then digested with BamHI and SmaI, after which they were cloned into the corresponding sites of plasmid phcmc05 (Nguyen et al., 2005) obtained from the Bacillus Genetic Stock Center (BGSC), Ohio. The resulting plasmids were introduced into a kina kinb double mutant of B. subtilis. The expression of the kinases was induced by the addition of IPTG at 1 mm. The spo0a gene of P. polymyxa was amplified from E681 DNA using the primers PP0AF and PP0AR, by PCR. The amplified fragments were digested with HindIII/BamHI and cloned into the same site of an integration vector pdg1731 (Guerout-Fleury et al., 1996) to construct plasmid pdg-ppoa. The resulting plasmid was introduced into the B. subtilis spo0b mutant (JHOB), or spo0a mutant (JHPP0A) for singlecopy integration of the P. polymyxa spo0a into the thrc locus Spore assays Overnight cultures grown in DSM were diluted 100 fold into fresh DSM and grown at 37 C with shaking at 200 rpm. 1 mm IPTG was added in culture 1 h before the onset of the Table 1 B. subtilis strains used in this study. Strain Relevant genotype Source a and reference JH642 trpc2 phe-1 Laboratory stock AG676 spo0b::phea (Weir et al., 1991) AG522 kina::tn917 erm (Rudner et al., 1991) NY120 kinb kapb::spc (LeDeaux et al., 1995) MO699 spo0a::erm (Shin et al., 1999) JH0B spo0b::phea AG676 tf JH642 JH0A spo0a::erm MO699 tf JH642 JHPP0A spo0a::erm, thr::spo0a PP pdg-pp0a tf JH0A JHKA kina::tn917 erm AG522 tf JH642 JHKAB kina::tn917 erm, kinb kapb::spc NY120 tf JHKA JH811 spo0b::phea, thr::spo0a PP pdg-pp0a tf JH0B JH-IIAgus trpc2 phe-1, amye::pspoiia-gusa-neo pmlk-iia tf JH641 JHKAB-IIAgus kina::tn917 erm, kinb kapb::spc, amye::pspoiia-gusa-neo pmlk-iia tf JHKAB JH0B-IIAgus spo0b::phea, amye::pspoiia-gusa-neo pmlk-iia tf JH0B JH811-IIAgus spo0b::phea, thr::spo0a PP, amye::pspoiia-gusa-neo pmlk-iia tf JH811 a tf, the indicated chromosomal DNA or plasmid was used to transform the indicated recipient strain.

3 274 S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278 Table 2 Plasmids and primers used in this study. Short description a Source Plasmid phcmc05 IPTG inducible expression vector (Nguyen et al., 2005) pdg1731 Integrative plasmid into amye locus (Guerout-Fleury et al., 1996) pdg-pp0a pdg1731-spo0a pp This study pmc99 phcmc05-kin99 This study pmc689 phcmc05-kin689 This study pmc1038 phcmc05-kin1038 This study pmc1377 phcmc05-kin1377 This study pmc3851 phcmc05-kin3851 This study pmlk83 Gus reporter, amye integrative plasmid (Karow and Piggot, 1995) pmlk-iia pmlk83-p spoiia -gusa This study Primer pp0af 5 0 -AAGCTTGCGAGTGAAGTAAAAGAAGGAC-3 0 pp0ar 5 0 -GGATCCGGATAAAATCTACGGGTTAGCAG-3 0 ppkin99f 5 0 -GGATCCTGCCAGTAATCGCCAGCATAC-3 0 ppkin99r 5 0 -CCCGGGACCTGTGTACCCTCCATTTC-3 0 ppkin689f 5 0 -GGATCCACTAACGGCGTCAAGGAAAG-3 0 ppkin689r 5 0 -CCCGGGGCCGTAGTAAAGGCATGGAC-3 0 ppkin1038f 5 0 -GGATCCCGTATACAAACTTGTAAATC-3 0 ppkin1038r 5 0 -CCCGGGCGCTGCATCCCAGAAACCTC-3 0 ppkin1377f 5 0 -GGATCCTACGCGTCCGAAACGGCCAG-3 0 ppkin1377r 5 0 -CCCGGGAACATAAAAGAAATAGTATG-3 0 ppkin3851f 5 0 -GGATCCTACGTAGTCATTATCACTTG-3 0 ppkin3851r 5 0 -CCCGGGCTCTTGTGAATCACACTTCG-3 0 BSIIAF 5 0 -GCCAAGCTTCAGTAGCAAAAGTAAAGGTC-3 0 BSIIAR 5 0 -GCCGGATCCATATGATCGGATAATGAGTG-3 0 a The underlined sequences indicate the synthetic restriction sites. stationary phase. After culturing for 36 h, serially diluted cultures were plated on LB agar plates with or without heat treatment (80 C, 15 min) and cultured overnight, after which the sporulation efficiency was determined as the ratio of heatresistant spores per milliliter to viable cells per milliliter Enzyme assays For the b-glucuronidase (Gus) assay, spoiia promoter was amplified by PCR from the chromosome of B. subtilis JH642 using the BSIIAF and BSIIAR primers (Table 2). The PCR product was digested with HindIII and BamHI, after which it was inserted into the corresponding site of plasmid pmlk83 (Karow and Piggot, 1995). The resulting plasmid, pmlk-iia was introduced into several B. subtilis mutant strains. The B. subtilis cells were cultured in DSM medium and collected at hourly intervals for determination of the optical density at 600 nm. A Gus assay was conducted using a method that has been described elsewhere (Karow and Piggot, 1995) Nucleotide sequence accession number P. polymyxa spo0a, spo0f, spo0b and the five putative histidine kinases were assigned the following GenBank accession numbers: HM191685, HM191688, HM191687, HM (kin99), HM (kin689), HM (kin1038), HM (kin1377) and HM (kin3851), respectively. 3. Results and discussion 3.1. P. polymyxa Spo0A, Spo0B and Spo0F Signal transduction for sporulation is mediated by the phosphorelay system, which is highly conserved in sporeforming Bacillus species (Stephenson and Hoch, 2002). In the system, histidine kinase phosphorylates Spo0F, and the phosphate group from the Spo0F is transferred to Spo0A by Spo0B. Spo0F and Spo0A are very highly conserved in the amino acid sequence, while Spo0B is less well conserved and histidine kinases are poorly conserved among Bacillus species. The amino acid sequences of P. polymyxa Spo0A (Spo0A PP ) and Spo0F (Spo0F PP ) were found to share 68 and 73% homology with those of B. subtilis, respectively, while the P. polymyxa Spo0B (Spo0B PP ) shared only 14% identity with that of B. subtilis (Fig. 1B). Due to the highly conserved amino acid sequence of Spo0B PP around the phosphorylatable histidine residue (HXRHDWXN, amino acids 74-81) and the downstream location of the obg gene in the operon structure, which are conserved in the Spo0B family, it was annotated spo0b. Interestingly, Spo0B PP has extended N-terminal sequences (49 amino acids) when compared to that of B. subtilis, and the extended region has two transmembrane (TM) domains (Fig. 1D). Similarly, the putative Spo0Bs of Paenibacillus sp. JDR-2 (accession number YP_ ), Paenibacillus sp. Oral taxon 786 str. D14 (ZP_ ), P. larvae subsp. larvae B-3650 (ZP_ ), P.

4 S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e Fig. 1. Amino acid sequence alignment of Spo0A (A), Spo0B (B) and Spo0F (C)_from Bacillus subtilis and Paenibacillus polymyxa E681. (D) Analysis of Spo0B PP by What 2.0 program. Blue and red lines denote hydropathy and amphipathicity, respectively. Orange bars mark transmembrane segments as predicted by HMMTOP. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) curdlanolyticus YK9 (ZP_ ) and P. polymyxa SC2 (YP_ ) have extended N-terminal sequences with the TM domains. Most Bacillus Spo0Bs do not contain an extended N-terminal sequence and are not membrane-bound forms. Therefore, it seems that the extended N-terminal sequence of the Spo0B may be a distinctive feature of Paenibacillus species. To examine whether the Spo0A PP can function in B. subtilis, the spo0a PP gene was introduced in B. subtilis spo0a mutant (JH0A) to construct JHPP0A strain. Spore assay showed that the Spo0A PP partially recovered the sporulation defect of the B. subtilis spo0a mutant (Table 4). Alignment of amino acid sequences of Spo0A BS and Spo0A PP revealed that C-terminal DNA binding domains were highly conserved while N-terminal response regulator domains were relatively less conserved (Fig. 1A). As mentioned above, Spo0Bs of two species were poorly conserved (Fig. 1B). Many studies have reported that Spo0A-P can regulate target gene expression by binding to specific DNA sequences, called 0A boxes (TGTCGAA) in B. subtilis (Liu et al., 2003). The 0A box sequences were successfully detected in promoter regions of spo0a PP and abrb PP by DBTBS search tool (Fig. 2). The Table 3 Alignment of histidine sensor kinase (HisKA) domains between B. subtilis and P. polymyxa.

5 276 S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278 Table 4 Complementation of sporulation in B. subtilis histidine kinase mutant by P. polymyxa histidine kinases. Strain Relevant genotype Sporulation a (%) JH642 Wild type (1.62) JHPP0A spo0a::erm, thr::spo0a pp 0.78 (0.13) JHKAB (phcmc05) kina kinb phcmc05 0 JHKAB (pmc99) kina kinb pmc99 0 JHKAB (pmc689) kina kinb pmc689 0 JHKAB (pmc1038) kina kinb pmc (0.23) JHKAB (pmc1377) kina kinb pmc (5.03) JHKAB (pmc3851) kina kinb pmc a Spore assays were conducted in triplicate and the results were averaged. Standard deviations are presented in parenthesis. A value of 0% indicates that the efficiency was less than result suggests that DNA binding mode of Spo0A PP may be similar to the case of Spo0A BS. Thus, the partial complementation of the B. subtilis spo0a mutant with Spo0A PP might be due to poor transferring phosphate from Spo0B BS to Spo0A PP Identification of putative sporulation histidine kinases in the P. polymyxa E681 genome Bacteria contain many histidine kinases. For example, E. coli and B. subtilis contain 28 and 36 histidine kinases, respectively (Fabret et al., 1999; Kanehisa et al., 2006). Most of these kinases are a component of the two-component signal transduction system. The kinases sense environmental signals and autophosphorylate, after which they transfer the phosphate to the cognate response regulators. The genes encoding histidine kinase and its cognate response regulator are usually located within the same operon, enabling their coordinated expression. However, sporulation kinase genes are usually present on the chromosome without linked response regulator genes. In this study, we screened the orphan kinases of the P. polymyxa E681 genome by BLAST analysis using the histidine kinase A phospho-acceptor (HisKA) domains of KinA A tggccgtggccttaagatttttttgtcgaaaagcaggggaataactcataattgcaagataaataattaattataatagaaa ctctaaaaaaaataaataaaaataattttcgacagaaggaattcataattcgatgtcgaaatcatatactccgacaagaaat atttatatactgtaaacagatatcacaatggaatatcactcaatgaggaggaagtacattg and KinB in B. subtilis, and five putative sporulation histidine kinases were selected. These were denoted as PPE00099, PPE00689, PPE01038, PPE01377 and PPE03851 (hereafter referred to as Kin99, Kin689, Kin1038, Kin1377 and Kin3851, respectively) (Table 3). Among these kinases, only Kin1377 does not contain a transmembrane segment in its N-terminal (Fig. 3). Similarly, the sporulation histidine kinase KinA, a major histidine kinase involved in sporulation of B. subtilis, is found in the cytoplasm of the cell (Stephens, 1998) Characterization of P. polymyxa sporulation histidine kinases by complementation of sporulation in B. subtilis To analyze the function of the putative histidine kinases in P. polymyxa, we tried to construct knockout mutants of the kinase genes, but we failed to obtain any mutant strains. The failure might be due to poor transformation efficiency of P. polymyxa E681. Thus, the functional analysis of the kinases was conducted by complementation of sporulation in B. subtilis. The putative P. polymyxa sporulation histidine kinase genes were cloned into the plasmid phcmc05 under the control of IPTG-inducible promoter, after which the resulting plasmids were introduced into kina kinb double mutant strains of B. subtilis JH642. The spore assay results are shown in Table 4. Kin99, Kin689 and Kin3851 showed no change in sporulation efficiency, and Kin1038 had slightly recovered spore formation. However, Kin1377 could efficiently restore the sporulation defect of the kina kinb double mutant, suggesting that the Kin1377 is able to interact and transfer phosphate to B. subtilis Spo0F (Spo0F BS ) Complementation of sporulation in B. subtilis spo0b mutant by Kin1038 It has been reported that B. subtilis KinC likely phosphorylates Spo0A directly in vivo, and both KinC and KinD were weakly active on Spo0A in vitro even though they are more active when Spo0F is used as a substrate (Jiang et al., 2000). To determine whether P. polymyxa histidine kinases can activate Spo0A directly, plasmids pmc1038 and pmc1377 containing kinase genes kin1038 and kin1377, respectively, were B spo0a gatatcagctcctttaatattcggaataatggattaaaatacaataaaatcctaaatgatttccctcattcgacattctttgtcg taatatgtcgaattatagtttttcgacatttccaaatcgacaaactgaataaatcgtcaatatgataaggcaatacacatgag taaagctctctaatctaaatacttttgcataatcagactgttactacatttttaaggttgactgttttgggaatcgttggtatagt aaatatcagaaaagagaaaattttgtcgaatcatgacacttatattattttaaacggcgagaggagcctgatttattatg abrb Fig. 2. Prediction of putative 0A boxes by DBTBS search tool from promoter regions of Paenibacillus polymyxa spo0a (A) and abrb (B). The underlines and filled diamond symbols indicate putative 0A boxes. Translational start codons are in bold. Fig. 3. Domain organization of Paenibacillus polymyxa histidine sensor kinases (HisKA). Transmembrane segments of sensor kinases (white boxes) were predicted by HMMTOP. The domain organization and the presence of putative PAS, HAMP, HisKA and HATPase domains were predicted using Pfam.

6 S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e introduced into B. subtilis spo0b (spo0b BS ) mutant. The sporulation assay results showed that Kin1377 could not restore the sporulation defect of the spo0b BS mutant, indicating that the phosphorelay from Kin1377 to Spo0A BS requires Spo0B BS and possibly Spo0F BS (Table 5). In Bacillus species, Spo0F accepts a phosphoryl group from histidine kinase and transfers it to Spo0B, and finally to Spo0A. Therefore, Kin1377 may also transfer the phosphate to Spo0A PP in a Spo0B PP - and possibly Spo0F PP -dependent manner in P. polymyxa. The Kin1377 did not restore sporulation of the spo0b BS mutant in the presence of the Spo0A PP, indicating that Kin1377 is not able to directly phosphorylate Spo0A PP (Table 5). The Kin1038 partially recovered sporulation of the B. subtilis spo0b mutant, suggesting that Kin1038 might activate Spo0A BS directly (Table 5). We predicted that Kin1038 would interact more efficiently with its own partner, Spo0A PP, than with Spo0A BS. To test this prediction, the spo0a PP with its own promoter was integrated into the thrc locus on the chromosome of the B. subtilis spo0b mutant. Sporulation assay showed that Kin1038 highly restored sporulation of the mutant containing Spo0A PP (Table 5). In addition, the expression of B. subtilis spoiia, which is controlled by phosphorylated Spo0A BS,inspo0B mutant was highly upregulated in the presence of both Kin1038 and Spo0A PP (Fig. 4). The results suggested that Kin1038 can interact with and directly phosphorylate Spo0A PP, and the phosphorylated Spo0A PP can regulate Spo0A BS regulon genes to support spore formation in B. subtilis. To support the direct interaction between Kin1038 and Spo0A PP by in vitro biochemical experiment, we tried to purify the Kin1038 and Spo0A PP in E. coli. However, we failed to obtain a Kin1038-overexpressing E. coli clone. B. subtilis KinC and KinD may be able to interact directly with wild-type Spo0A and produce sufficient levels of phosphorylated Spo0A (Jiang et al., 2000). However, direct phosphorylation of Spo0A by KinC or KinD may not be sufficient to initiate sporulation because sporulation efficiency decreased to almost zero in spo0f or spo0b mutants, even though KinC was highly expressed by IPTG-inducible spac promoter (LeDeaux and Grossman, 1995; Quisel et al., 2001). These Table 5 Complementation of sporulation in B. subtilis spo0b mutant by P. polymyxa histidine kinases. Strain Relevant genotype Sporulation a (%) JHOB spo0b::phea 0 JHOB (phcmc05) spo0b::phea, phcmc05 0 JHOB (pmc1038) spo0b::phea, pmc (0.08) JHOB (pmc1377) spo0b::phea, pmc JH811 spo0b::phea, thrc::spo0a PP 0 JH811 (pmc1377) spo0b::phea, thrc::spo0a PP, 0 pmc1377 JH811 (pmc1038) spo0b::phea, thrc::spo0a PP, pmc (4.45) a Spore assays were conducted in triplicate and the results were averaged. Standard deviation values are shown in parenthesis. A value of 0% indicates that the efficiency was below Fig. 4. Expression of spoiia-gus in wild-type B. subtilis and mutants. IPTG was added at the time indicated by the arrow. All experiments were conducted in triplicate, and the results shown are the averages. Error bars represent the standard deviation. Symbols: A, wild type; :, JH811 (pmc1038); -, JH0B (pmc1038); C, JH811;, JH0B. findings indicate that the alternative phosphate-transferring system for sporulation to bypass Spo0F and Spo0B does not work in B. subtilis. The phosphorelay system of the genus Clostridium was somewhat different from that of Bacillus group. There were no Spo0F and Spo0B homologues in the genome of Clostridium species. The phosphorelay system of Clostridium is dependent on two-component system which involves direct transferring phosphate from several histidine kinases to Spo0A (Worner et al., 2006). Here we demonstrated that introduction of P. polymyxa Kin1038 and Spo0A PP into B. subtilis could bypass the requirement for Spo0B. The results indicated that Kin1038 can directly interact and activate Spo0A PP in B. subtilis. However, it remains to be elucidated whether multiple phosphorelay systems such as Kin-Spo0F- Spo0B-Spo0A and Kin-Spo0A pathways, exist or not for sporulation in P. polymyxa. Acknowledgements This study was supported by the 21C Frontier Microbial Genomics and Applications Center Program of the Ministry of Education, Science and Technology, and the Technology Development Program for Agriculture and Forestry, Ministry for Agriculture, Forestry and Fisheries, and the KRIBB Research Initiative Program, Republic of Korea. References Bateman, A., Birney, E., Durbin, R., Eddy, S.R., Howe, K.L., Sonnhammer, E.L., The Pfam protein families database. Nucleic Acids Res. 28, 263e266. Burbulys, D., Trach, K.A., Hoch, J.A., Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64, 545e552. Choi, S.K., Park, S.Y., Kim, R., Lee, C.H., Kim, J.F., Park, S.H., Identification and functional analysis of the fusaricidin biosynthetic gene

7 278 S.-Y. Park et al. / Research in Microbiology 163 (2012) 272e278 of Paenibacillus polymyxa E681. Biochem. Biophys. Res. Commun. 365, 89e95. Choi, S.K., Park, S.Y., Kim, R., Kim, S.B., Lee, C.H., Kim, J.F., Park, S.H., Identification of a polymyxin synthetase gene cluster of Paenibacillus polymyxa and heterologous expression of the gene in Bacillus subtilis. J. Bacteriol. 191, 3350e3358. Fabret, C., Feher, V.A., Hoch, J.A., Two-component signal transduction in Bacillus subtilis: how one organism sees its world. J. Bacteriol. 181, 1975e1983. Fawcett, P., Eichenberger, P., Losick, R., Youngman, P., The transcriptional profile of early to middle sporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 97, 8063e8068. Guerout-Fleury, A.M., Frandsen, N., Stragier, P., Plasmids for ectopic integration in Bacillus subtilis. Gene 180, 57e61. Harwood, C.R., Cutting, S.M. (Eds.), Molecular Biological Methods for Bacillus. John Wiley & Sons, Inc, New York. Inoue, H., Nojima, H., Okayama, H., High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23e28. Jiang, M., Shao, W., Perego, M., Hoch, J.A., Multiple histidine kinases regulate entry into stationary phase and sporulation in Bacillus subtilis. Mol. Microbiol. 38, 535e542. Kanehisa, M., Goto, S., Hattori, M., Aoki-Kinoshita, K.F., Itoh, M., Kawashima, S., Katayama, T., Araki, M., Hirakawa, M., From genomics to chemical genomics: new developments in KEGG. Nucleic Acids Res. 34, D354eD357. Karow, M.L., Piggot, P.J., Construction of gusa transcriptional fusion vectors for Bacillus subtilis and their utilization for studies of spore formation. Gene 163, 69e74. Kim, J.F., Jeong, H., Park, S.Y., Kim, S.B., Park, Y.K., Choi, S.K., Ryu, C.M., Hur, C.G., Ghim, S.Y., Oh, T.K., Kim, J.J., Park, C.S., Park, S.H., Genome sequence of the polymyxin-producing plant-probiotic rhizobacterium Paenibacillus polymyxa E681. J. Bacteriol. 192, 6103e6104. Krogh, A., Larsson, B., von Heijne, G., Sonnhammer, E.L., Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305, 567e580. Landman, D., Georgescu, C., Martin, D.A., Quale, J., Polymyxins revisited. Clin. Microbiol. Rev. 21, 449e465. LeDeaux, J.R., Grossman, A.D., Isolation and characterization of kinc, a gene that encodes a sensor kinase homologous to the sporulation sensor kinases KinA and KinB in Bacillus subtilis. J. Bacteriol. 177, 166e175. LeDeaux, J.R., Yu, N., Grossman, A.D., Different roles for KinA, KinB, and KinC in the initiation of sporulation in Bacillus subtilis. J. Bacteriol. 177, 861e863. Li, J., Nation, R.L., Turnidge, J.D., Milne, R.W., Coulthard, K., Rayner, C.R., Paterson, D.L., Colistin: the re-emerging antibiotic for multidrugresistant Gram-negative bacterial infections. Lancet Infect. Dis. 6, 589e601. Liu, J., Tan, K., Stormo, G.D., Computational identification of the Spo0A-phosphate regulon that is essential for the cellular differentiation and development in Gram-positive spore-forming bacteria. Nucleic Acids Res. 31, 6891e6903. Molle, V., Fujita, M., Jensen, S.T., Eichenberger, P., Gonzalez-Pastor, J.E., Liu, J.S., Losick, R., The Spo0A regulon of Bacillus subtilis. Mol. Microbiol. 50, 1683e1701. Nguyen, H.D., Nguyen, Q.A., Ferreira, R.C., Ferreira, L.C., Tran, L.T., Schumann, W., Construction of plasmid-based expression vectors for Bacillus subtilis exhibiting full structural stability. Plasmid 54, 241e248. Phi, Q.T., Oh, S.H., Park, Y.M., Park, S.H., Ryu, C.M., Ghim, S.Y., Isolation and characterization of transposon-insertional mutants from Paenibacillus polymyxa E681 altering the biosynthesis of indole-3-acetic acid. Curr. Microbiol. 56, 524e530. Quisel, J.D., Burkholder, W.F., Grossman, A.D., In vivo effects of sporulation kinases on mutant Spo0A proteins in Bacillus subtilis. J. Bacteriol. 183, 6573e6578. Rudner, D.Z., LeDeaux, J.R., Ireton, K., Grossman, A.D., The spo0k locus of Bacillus subtilis is homologous to the oligopeptide permease locus and is required for sporulation and competence. J. Bacteriol. 173, 1388e1398. Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M.A., Barrell, B., Artemis: sequence visualization and annotation. Bioinformatics 16, 944e945. Saier, M.H., Yen, M.R., Nato, K., Tamang, D.G., Elkan, C., The trnasporter classification database: recent advances. Nucleic Acids Res. 37, D274eD278. Shin, B.-S., Choi, S.-K., Park, S.-H., Regulation of the Bacillus subtilis phosphotransacetylase gene. J. Biochem. 126, 333e339. Stephens, C., Bacterial sporulation: a question of commitment? Curr. Biol. 8, R45eR48. Stephenson, K., Hoch, J.A., Evolution of signalling in the sporulation phosphorelay. Mol. Microbiol. 46, 297e304. Timmuska, S., Nicandera, B., Granhallb, U., Tillberga, E., Cytokinin production by P. polymyxa. Soil Biol. Biochem. 31, 1847e1852. Tusnady, G.E., Simon, I., The HMMTOP transmembrane topology prediction server. Bioinformatics 17, 849e850. Weir, J., Predich, M., Dubnau, E., Nair, G., Smith, I., Regulation of spo0h, a gene coding for the Bacillus subtilis sigma H factor. J. Bacteriol. 173, 521e529. Worner, K., Szurmant, H., Chiang, C., Hoch, J.A., Phosphorylation and functional analysis of the sporulation initiation factor Spo0A from Clostridium botulinum. Mol. Microbiol. 59, 1000e1012. Zhai, Y., Saier Jr., M.H., A web-based program (WHAT) for the simultaneous prediction of hydropathy, amphipathicity, secondary structure and transmembrane topology for a single protein sequence. J. Mol. Microbiol. Biotechnol. 3, 501e502.