Horizontal transfer and pathogenicity
|
|
- Briana Dickerson
- 5 years ago
- Views:
Transcription
1 Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014
2 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT Examples Staphylococcus aureus Escherichia coli Conclusion References
3 Horizontal transfer Horizontal gene transfer is a process in which exogenic DNA is introduced and integrated into a recipient genome. The most transferred: transposable elements functional genes regulatory sequences All three domains: Archaea, Bacteria, and Eukarya
4 Importance Several novel multi-resistant and/or hyper-virulent superbugs emerged over the last years as a result of horizontal acquisition of antibiotic resistance and virulence genes, causing serious outbreaks. recognize and predict virulent strain emergence and epidemics formulate protective public health policies and maneuvers develop or modify vaccines
5 Horizontal gene transfer mechanisms A. Transformation B. Generalized transduction C. Conjugation
6 Detection methods (i) difference between gene trees derived from a limited number of gene families and the reference trees such as the small-subunit ribosomal RNA (SSU rrna) tree or whole genome tree; (ii) unexpectedly high sequence similarity of a gene from two distant genomes compared with those among homologous genes in closely related genomes; (iii) unusual nucleotide composition or codon usages of a gene compared with the rest of the genes within a genome.
7 Analyze of 116 prokaryotic complete genomes shows 46,759 ( 14%) of the total 324,653 ORFs were derived from recent horizontal transfers (Table 1). The average proportion of HT genes per genome was 12% of all ORFs, ranging from 0.5% to 25% depending on prokaryotic lineage. Nakamura et al. Nature Genetics 36, (2004)
8 4 main functional categories plasmid, phage and transposon functions (28.3%) cell envelope (13.8%) regulatory functions (11.0%) cellular processes (10.0%) Nakamura et al. Nature Genetics 36, (2004)
9 Pathogenicity islands Pathogenicity islands: a subset of genomic islands characterized by their capacity to encode virulence functions. adhesion and invasion type-iii secretion systems for altering host cell metabolism toxin production a host of metabolic capabilities (e. g. acquisition of phosphate and iron at low concentrations) Nakamura et al. Nature Genetics 36, (2004)
10 The pathway to pathogenicity While the introduction of pathogenicity islands by horizontal gene transfer is considered a hallmark in the evolution of pathogenic bacteria, this process represents only one step in a multifaceted and complex evolutionary process. Nakamura et al. Nature Genetics 36, (2004)
11 Staphylococcus aureus Has the potential to cause from benign skin infections to severe diseases, such as septicaemia, osteomyelitis and endocarditis. Genomic island responsible for the spread of methicillin resistance encoding gene meca among S. aureus is termed the staphylococcal cassette chromosome mec (SCCmec) It has been hypothesized that SCCmec island originated in Staphylococcus epidermidis and was acquired in the process of evolution of S. aureus by horizontal gene transfer Juhas, 2013 Informa Healthcare USA
12 Kriegeskorte et al. Nature Medicine 18, (2012)
13 Escherichia coli E. coli is an extremely versatile bacterium E. coli has the potential to cause life-threatening infections Genomes of pathogenic E. coli strains can be 1Mb larger than those of non-pathogenic strains due to horizontal acquisition of genomic islands The remarkable pathogenicity of the E. coli O104:H4 outbreak strain was the result of the combination of two horizontally acquired factors: increased Shiga toxin absorption and increased antibiotic resistance Juhas, 2013 Informa Healthcare USA
14 Conclusion Besides showing importance of novel technologies, the outbreaks also demonstrated the serious consequences of interspecies and intergenera horizontal transfer of virulence genes.
15 References Pathogen-origin horizontally transferred genes contribute to the evolution of Lepidopteran insects Zi-Wen Li, Yi- Hong Shen, Zhong-Huai Xiang and Ze Zhang. BMC Evolutionary Biology 2011, 11:356 Global extent of horizontal gene transfer In-Geol Choi and Sung-Hou Kim Proc Natl Acad Sci USA. Mar 13, 2007; 104(11): Biased biological functions of horizontally transferred genes in prokaryotic genomes Yoji Nakamura, Takeshi Itoh, Hideo Matsuda & Takashi Gojobori. Nature 2004 Horizontal Gene Transfer in Prokaryotes: Quantification and Classification Eugene V. Koonin, Kira S. Makarova, and L. Aravind. Annu. Rev. Microbiol : Horizontal and Vertical Gene Transfer : The Life History of Pathogens Jeffrey G. Lawrence, Contrib. Microbiol. Bsel, Karger, 2005 Evolutionary pathway to increased virulence and epidemic group A Streptococcus disease derived from 3,615 genome sequences Waleed Nasser, Stephen B. Beresa, Randall J. Olsen, Melissa A. Dean, Kelsey A. et al Staphylococcus aureus genomics and the impact of horizontal gene transfer Jodi A. Lindsay. International Journal of Medical Microbiology 304 (2014) Horizontal gene transfer in human pathogens Mario Juhas Informa Healthcare USA Horizontal gene transfer boosts MRSA spreading André Kriegeskorte & Georg Peters. Nature 2012.
Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationVital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
More informationGenetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
More informationBio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
More informationBiology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
More informationThe Evolution of Infectious Disease
The Evolution of Infectious Disease Why are some bacteria pathogenic to humans while other (closely-related) bacteria are not? This question can be approached from two directions: 1.From the point of view
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationCLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1
CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1 MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 2/13 2/14 - B 2/15 2/16 - B 2/17 2/20 Intro to Viruses Viruses VS Cells 2/21 - B Virus Reproduction Q 1-2 2/22 2/23
More informationDynamic optimisation identifies optimal programs for pathway regulation in prokaryotes. - Supplementary Information -
Dynamic optimisation identifies optimal programs for pathway regulation in prokaryotes - Supplementary Information - Martin Bartl a, Martin Kötzing a,b, Stefan Schuster c, Pu Li a, Christoph Kaleta b a
More informationIntroduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationIntroductory Microbiology Dr. Hala Al Daghistani
Introductory Microbiology Dr. Hala Al Daghistani Why Study Microbes? Microbiology is the branch of biological sciences concerned with the study of the microbes. 1. Microbes and Man in Sickness and Health
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationMicrobial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
More informationEvolution AP Biology
Darwin s Theory of Evolution How do biologists use evolutionary theory to develop better flu vaccines? Theory: Evolutionary Theory: Why do we need to understand the Theory of Evolution? Charles Darwin:
More informationHORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS
HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae
More informationModern cellular organisms. From
Modern cellular organisms From http://www.ucmp.berkeley.edu/exhibit/phylogeny.html Endothelial cell Lysosomes, mitochondria and nucleus See the cellular cytoskeleton, ER and nucleus Modern cells are complex
More informationOutline. Viruses, Bacteria, and Archaea. Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea
Viruses, Bacteria, and Archaea Chapter 21 Viruses Structure Classification Reproduction Prokaryotes Structure Reproduction Nutrition Bacteria Archaea Outline The Viruses The Viruses Viruses are noncellular
More informationA genomic insight into evolution and virulence of Corynebacterium diphtheriae
A genomic insight into evolution and virulence of Corynebacterium diphtheriae Vartul Sangal, Ph.D. Northumbria University, Newcastle vartul.sangal@northumbria.ac.uk @VartulSangal Newcastle University 8
More informationChapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
More informationNature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.
Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four
More information9/8/2017. Bacteria and Archaea. Three domain system: The present tree of life. Structural and functional adaptations contribute to prokaryotic success
5 m 2 m 9/8/2017 Three domain system: The present tree of life Bacteria and Archaea Chapter 27 Structural and functional adaptations contribute to prokaryotic success Unicellular Small Variety of shapes
More informationWhat can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationBACTERIA. CLS 212: Medical Microbiology Miss Zeina Alkudmani
BACTERIA CLS 212: Medical Microbiology Miss Zeina Alkudmani Prokaryotes Prokaryotic cells possess simpler structures than eukaryotic cells, since they do not have a nucleus or a lot of cytoplasmic organelles.
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationA pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa.
1 A pathogen is an agent or microrganism that causes a disease in its host. Pathogens can be viruses, bacteria, fungi or protozoa. Protozoa are single celled eukaryotic organisms. Some protozoa are pathogens.
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationProkaryotes & Viruses. Practice Questions. Slide 1 / 71. Slide 2 / 71. Slide 3 / 71. Slide 4 / 71. Slide 6 / 71. Slide 5 / 71
Slide 1 / 71 Slide 2 / 71 New Jersey Center for Teaching and Learning Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of
More informationEASTERN ARIZONA COLLEGE Microbiology
EASTERN ARIZONA COLLEGE Microbiology Course Design 2015-2016 Course Information Division Science Course Number BIO 205 (SUN# BIO 2205) Title Microbiology Credits 4 Developed by Ed Butler/Revised by Willis
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationno.1 Raya Ayman Anas Abu-Humaidan
no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationBIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
More informationUnit 1: DNA & the Genome. 1.7: Evolution. 1.7 Evolution
Unit 1: DNA & the Genome 1.7: Evolution 1.7 Evolution What you should already know from National 5 Mutations are random changes to genetic material and are the only source of new alleles. Mutation can
More informationClassifying Prokaryotes: Eubacteria Plasma Membrane. Ribosomes. Plasmid (DNA) Capsule. Cytoplasm. Outer Membrane DNA. Flagellum.
Bacteria The yellow band surrounding this hot spring is sulfur, a waste product of extremophilic prokaryotes, probably of the Domain Archaea, Kingdom Archaebacteria. Bacteria are prokaryotic cells (no
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationScientific names allow scientists to talk about particular species without confusion
Unit 9 Test Review KEY a. Explain the history, purpose, and methods of taxonomy What is taxonomy? the science of naming and classifying organisms Who came up with it? Linnaeus Why do we use taxonomy? Scientific
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationProkaryotes & Viruses. Multiple Choice Review. Slide 1 / 47. Slide 2 / 47. Slide 3 / 47
New Jersey enter for Teaching and Learning Slide 1 / 47 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and
More informationInstitute for Molecular Bioscience, The University of Queensland, Brisbane, QLD 4072,
JB Accepts, published online ahead of print on 27 May 2011 J. Bacteriol. doi:10.1128/jb.01524-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationProkaryotes & Viruses. Multiple Choice Review. Slide 1 / 47. Slide 2 / 47. Slide 3 / 47
New Jersey enter for Teaching and Learning Slide 1 / 47 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationProkaryotes & Viruses. Multiple Choice Review. Slide 2 / 47. Slide 1 / 47. Slide 3 (Answer) / 47. Slide 3 / 47. Slide 4 / 47. Slide 4 (Answer) / 47
Slide 1 / 47 Slide 2 / 47 New Jersey enter for Teaching and Learning Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of
More informationChapter 27: Bacteria and Archaea
Name Period Overview 1. The chapter opens with amazing tales of life at the extreme edge. What are the masters of adaptation? Describe the one case you thought most dramatic. Concept 27.1 Structural and
More informationVocabulary- Bacteria (34 words)
Biology II BACTERIA Vocabulary- Bacteria (34 words) 1. Prokaryote 21. phototroph 2. Peptidoglycan 22. chemotroph 3. Methanogen 23. obligate anaerobe 4. Halophile 24. facultative anaerobe 5. Thermoacidophile
More informationMultivariate analysis of genetic data: an introduction
Multivariate analysis of genetic data: an introduction Thibaut Jombart MRC Centre for Outbreak Analysis and Modelling Imperial College London XXIV Simposio Internacional De Estadística Bogotá, 25th July
More informationOrigins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
More informationComparison of simple sequence repeats in Staphylococcus strains using in-silico approach
www.bioinformation.net Hypothesis Volume 8(24) Comparison of simple sequence repeats in Staphylococcus strains using in-silico approach Sunil Thorat 1 * & Prashant Thakare 2 1Institute of Bioresources
More informationThe Minimal-Gene-Set -Kapil PHY498BIO, HW 3
The Minimal-Gene-Set -Kapil Rajaraman(rajaramn@uiuc.edu) PHY498BIO, HW 3 The number of genes in organisms varies from around 480 (for parasitic bacterium Mycoplasma genitalium) to the order of 100,000
More informationTHE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE 5/14/18
THE IDENTIFICATION OF TWO UNKNOWN BACTERIA AFUA WILLIAMS BIO 3302 TEST TUBE 3 PROF. N. HAQUE Introduction: The identification of bacteria is important in order for us to differentiate one microorganism
More informationFlow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
More informationThis is a repository copy of Microbiology: Mind the gaps in cellular evolution.
This is a repository copy of Microbiology: Mind the gaps in cellular evolution. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/114978/ Version: Accepted Version Article:
More informationdoi: / _25
Boc, A., P. Legendre and V. Makarenkov. 2013. An efficient algorithm for the detection and classification of horizontal gene transfer events and identification of mosaic genes. Pp. 253-260 in: B. Lausen,
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: https://digitalcontentmarket.org/download/test-bank-formicrobiology-a-systems-approach-3rd-edition-by-cowan Chapter
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationIntro to Prokaryotes Lecture 1 Spring 2014
Intro to Prokaryotes Lecture 1 Spring 2014 Meet the Prokaryotes 1 Meet the Prokaryotes 2 Meet the Prokaryotes 3 Why study prokaryotes? Deep Time 4 Fig. 25.7 Fossilized stromatolite (above) and living stromatolite
More informationGene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
More informationName: SAMPLE EOC PROBLEMS
Name: SAMPLE EOC PROBLEMS 1.Bromothymol blue (BTB) is a ph indicator that is also used to detect carbon dioxide (CO2). BTB is blue when ph is basic and CO2 is low. BTB is yellow when ph is acidic and CO2
More informationMicrobiology - Problem Drill 04: Prokayotic & Eukaryotic Cells - Structures and Functions
Microbiology - Problem Drill 04: Prokayotic & Eukaryotic Cells - Structures and Functions No. 1 of 10 1. Eukaryote is a word that describes one of two living cell classifications. The word comes from Greek
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationBiology 8 Learning Outcomes
Biology 8 Learning Outcomes CELLS (Bio 8-1) I can connect the names, diagrams, and functions of organelles in a cell I know the major differences between plant and animal cells I can explain cell theory
More informationTopology. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
Topology 1 Introduction 2 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 G+C content 7 Codon usage 27 marc.bailly-bechet@univ-lyon1.fr The big picture Eukaryota Bacteria Many linear chromosomes
More informationBioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
More informationCh. 19 Viruses & Bacteria: What Is a Virus?
Ch. 19 Viruses & Bacteria: What Is a Virus? Define virus. What are viruses? Define and translate bacteriophage. Review virus composition. What two classes of compounds are found in all viruses? Define
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More informationKingdom Monera(Archaebacteria & Eubacteria)
Kingdom Monera(Archaebacteria & All bacteria are prokaryotes Characteristics: 1. No nucleus Eubacteria) 2. No membrane bound organelles 3. Smaller & less ribosomes 4. Most are smaller than eukaryotes 5.
More informationBACTERIA AND ARCHAEA 10/15/2012
BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in
More informationGenome reduction in prokaryotic obligatory intracellular parasites of humans: a comparative analysis
International Journal of Systematic and Evolutionary Microbiology (2004), 54, 1937 1941 DOI 10.1099/ijs.0.63090-0 Genome reduction in prokaryotic obligatory intracellular parasites of humans: a comparative
More informationClassification. Old 5 Kingdom system. New 3 Domain system. reflects a greater understanding of evolution & molecular evidence
Classification Old 5 Kingdom system Monera, Protists, Plants, Fungi, Animals New 3 Domain system reflects a greater understanding of evolution & molecular evidence Prokaryote: Bacteria Prokaryote: Archaebacteria
More informationComputational approaches for functional genomics
Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding
More informationIntroduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1
Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationMicrobiology Helmut Pospiech
Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition
More informationBIO 101 INTRODUCTORY BIOLOGY PROF. ANI NKANG DEPT. OF BIOLOGICAL SCIENCES ARTHUR JARVIS UNIVERSITY
BIO 101 INTRODUCTORY BIOLOGY PROF. ANI NKANG DEPT. OF BIOLOGICAL SCIENCES ARTHUR JARVIS UNIVERSITY What does it mean to say that something is alive? An organism is a life form- a living entity made up
More informationBEFORE TAKING THIS MODULE YOU MUST ( TAKE BIO-4013Y OR TAKE BIO-
2018/9 - BIO-4001A BIODIVERSITY Autumn Semester, Level 4 module (Maximum 150 Students) Organiser: Dr Harriet Jones Timetable Slot:DD This module explores life on Earth. You will be introduced to the major
More informationSoftware review. Detecting horizontal gene transfer with T-REX and RHOM programs
Detecting horizontal gene transfer with T-REX and RHOM programs Keywords: horizontal gene transfer, lateral gene transfer, phylogeny, freeware Abstract As the Human Genome Project and other genome projects
More informationAmelioration of Bacterial Genomes: Rates of Change and Exchange
J Mol Evol (1997) 44:383 397 Springer-Verlag New York Inc. 1997 Amelioration of Bacterial Genomes: Rates of Change and Exchange Jeffrey G. Lawrence, 1, * Howard Ochman 2 1 Department of Biology, University
More informationTranslation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
More informationScience Online Instructional Materials Correlation to the 2010 Biology Standards of Learning and Curriculum Framework
and Curriculum Framework Provider York County School Divison Course Title Biology Last Updated 2010-11 Course Syllabus URL http://yorkcountyschools.org/virtuallearning/coursecatalog.aspx BIO.1 The student
More informationSec$on 9. Evolu$onary Rela$onships
Sec$on 9 Evolu$onary Rela$onships Sec$on 9 Learning Goals Explain why the ribosomal 16S gene is a good marker for molecular phylogene$c comparisons. Be able to interpret a phylogene$c tree. Explain the
More informationObligate anaerobes - cannot grow in the presence of oxygen Facultative anaerobes - can grow with or without oxygen Aerobic - require oxygen
PROKARYOTES *include bacteria and archaea *singular: bacterium / plural: bacteria PROPERTIES 1. Bacteria are classified into two kingdoms: Eubacteria (true bacteria) and Archaebacteria (Ancient Bacteria).
More informationChapter 21 PROKARYOTES AND VIRUSES
Chapter 21 PROKARYOTES AND VIRUSES Bozeman Video classification of life http://www.youtube.com/watch?v=tyl_8gv 7RiE Impacts, Issues: West Nile Virus Takes Off Alexander the Great, 336 B.C., conquered a
More informationChapters AP Biology Objectives. Objectives: You should know...
Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.
More information