(starvation). Description a. Predicted operon members b. Gene no. a. Relative change in expression (n-fold) mutant vs. wild type.
|
|
|
- Leonard Holmes
- 5 years ago
- Views:
Transcription
1 1 Table S1. Genes whose expression differ in the phyr mutant 8402 and/or in the ecfg mutant 8404 compared with the wild type when grown to the mid-exponential phase (OD ) in rich medium (PSY) or to late exponential phase (OD600 1) and stressed for 24 h by incubating cells in minimal medium lacking a carbon source (starvation). Gene no. a Predicted operon members b Gene name Relative change in expression (n-fold) mutant vs. wild type Description a PSY Starvation phyr ecfg phyr ecfg blr putative transposase Putative EcfG -dependent promoters associated with the genes listed in colum 1 c bll0322 otsa probable trehalose-6-phosphate synthase gacaggaaccatattgatg-aacgccagttaaac 13 bll putative sugar transport protein tgctggaaccggcgcttgc-cgcagacgttgtcg 33 bll unknown protein tcccggaacctttggttcc-cccgcgcgtcatgt 8 bll hypothetical protein bsr hypothetical protein gcaaggaacatcggcgcgg-catcgccgttgttg 26 blr unknown protein blr hypothetical protein blr transcriptional regulatory protein Crp family tcccggaacgaaactcaccacagaacagttttga 47 blr putative methyl-accepting chemotaxis protein blr unknown protein bll unknown protein bsl unknown protein bll probable amino acid binding protein blr1183 rimj 2.0 ribosomal-protein-alanine N-acetyltransferase bsl unknown protein blr unknown protein bsl hypothetical protein gcacggaacccgaagcgcg-ggcgtccgttcaat 79 bsl hypothetical protein cgggggaaccggcgcgcgg-gttcccggttagag 38 bll hypothetical protein bll unknown protein cgatggaaccgcagcaccc-ctccggcgtttcct 13 bll hypothetical protein blr hypothetical protein cggcggaacttgagtcggcccggctgcgtttgtt 38 blr hypothetical protein bsr hypothetical protein gggtggaaccgtcgcgcga-gacaggcgttaggt 39 bsl hypothetical protein aggaggaacggctgcgcac-cgctcgcgttgtcg 24 blr sulfate ABC transporter permease protein agaaggaacattttgccga-cggcggcattttcg 62 Distance to start codon (bp) d
2 2 blr unknown protein gattggaactgcgctgcgc-ctgatcggttactc 29 blr putative cyclopropane-fatty-acyl-phospholipid synthase (EC ) bll two-component hybrid sensor and regulator gtacggaacaatcccgcatccaaatacgttgaac 99 blr hypothetical protein ccggggaaccctgcacggg-agcagaagtttcca 47 blr two-component hybrid sensor and regulator bll hypothetical protein bll unknown protein bsr unknown protein caggggaacaagcgcaatt-gggccgcgttgacc 10 bsl hypothetical protein bll unknown protein bll hypothetical protein ttccggaacatcgcgcgcg-tcgcagcattggca 36 bsl hypothetical protein cttcggaaccatgcctgtg-tcgaatggttttct 26 bsl unknown protein gccgggaactcctgcggcg-aatggcagttggct 39 bll two-component response regulator gtttggaaccaatcggctt-tttcttcgttgctg 139 bll two-component hybrid sensor and regulator bll unknown protein tcagggaaccttgcacgcc-atcggtcattgata 8 bsl hypothetical protein ctgtggaactcgcggcaag-ttggccggtttagc 73 blr hypothetical protein atttggaacgatcacaatc-ggaaccggttggtc 32 bll probable glycosyl transferase gagaggaacttcgcaagtg-cgggaacgttccct 20 blr ABC transporter HlyB-MsbA family gaagggaacgttcccgcac-ttgcgaagttcctc gcccggaacccgggcgaagcggtcgatgttcagt bsl hypothetical protein bll hypothetical protein aagaggaacgccgtccgca-gtgggatgttgacg 33 bsr hypothetical protein cttaggaacaaattgccatttgttcccgttcaag 47 bll unknown protein bll probable 6-phosphofructokinase (EC ) bll hypothetical protein gcgtggaacctatcggagc-gacggacgtttttg 74 bll hypothetical protein blr ABC transporter permease protein bll hypothetical protein blr hypothetical protein blr probable cellulase bll unknown protein ccaaggaacaagtgcctcc-tgtaacagttgcca 86 blr hypothetical protein bll hypothetical protein acgcggaacccgcccccgt-caggaggattattt 15 blr3802 kup1-2.3 potassium uptake protein bsr hypothetical protein
3 3 blr unknown protein bll unknown protein blr hypothetical protein blr unknown protein blr unknown protein aggaggaacgctcgttcct-tctgcgcgttccga 26 bsr unknown protein bll two-component sensor histidine kinase ccgtggaaccctctcgccc CAATCGCGTTctgg 66 bll hypothetical protein ttccggaacaaccgatatc-tcctttcgttgttg 46 blr4307 mrca 2.3 penicillin-binding protein blr hypothetical protein bsr unknown protein bsl unknown protein bsr hypothetical protein gcgcgcaaccatcaaacgg-cactcgcgttgtca 23 blr unknown protein bsl unknown protein bll unknown protein bsr unknown protein bsl unknown protein tttcggaacccgggcgatc-gtcggacgtttccg 34 blr putative soluble lytic transglycosylase bll hypothetical protein bll hypothetical protein blr hypothetical protein bll unknown protein bsl hypothetical protein bsl hypothetical protein gggtggaaccggagcccgg-tatcgccgttagtt 299 bll two-component response regulator bll oxidoreductase bll unknown protein gtcaggaacgttcccagta-ccgtctcgttgtcc 118 bsl hypothetical protein bll unknown protein blr oxidoreductase blr unknown protein blr two-component hybrid sensor and regulator gccaggaaccaaacgactt-attcagcgtttgca 19 bll unknown protein cgcgggaaccttagttcgt-ctcccggattaagg 11 blr hypothetical protein gggcggaacagaatctcgcatctatgggttgtcc blr unknown protein bll unknown protein
4 4 blr hypothetical protein ccgcggaacgactaccaga-tgccgcacttagca 28 bsr hypothetical protein ggccggaacccctcgccat-tgaagtcgttaacg 26 bsr unknown protein blr hypothetical protein blr hypothetical protein tattggaaccttacctgcc-gaagtgcgtttgtc 97 bll hypothetical protein blr hypothetical protein bsr unknown protein blr unknown protein bll hypothetical protein ttttggaacgtcgatgccg-cgtgcccgttagcg 94 bsl hypothetical protein tttaggaacggcgcgccga-tgacgacgtttccc 31 blr putative manganese transport protein bsl unknown protein aggcggaactcgcgggacg-tcattgaattaacc 34 blr unknown protein tcccggaacaaaatcccgc-gcgccgcatttccc blr hypothetical protein gcgaggaacatttgccctc-gcagagtcttggtc 126 bll6262 osmc -3.0 hypothetical protein cgacggaaccgctgcggcgttcggccggttggaa 82 bll probable osmotically inducible protein bsr unknown protein gccgggaaccttttcccgg-ccgccgcgttggga 89 bll unknown protein bsl hypothetical protein ggcaggaaccatcgttcccgcgtcgagattgtct 64 bsl6587 pila 2.4 components of type IV pilus, pilin subunit blr putative cytochrome C ccccggaacccaccggggc-cgttttcgttggcc 45 bll hypothetical protein CTTAGGAACTGCGCGTGAT-CGGCGCTGTTCTCT 38 bll transcriptional regulatory protein AraC family bll hypothetical protein cgcgggaacgttcgttgctcggcgggagttagtc 32 blr hypothetical protein blr trehalose synthase blr hypothetical protein AACCGGAACTTTAAAACCT-GCGGCAAGTTGCCC blr hypothetical protein atccggaaccaaaacccga-cgcgccggttggag 38 bll hypothetical protein bsr hypothetical protein cgggggaacaagtggcaag-gcgacgagttcaga 15 bsr unknown protein blr hypothetical protein bll two-component response regulator blr hypothetical protein bll DNA-binding stress response protein, Dps family bll hypothetical protein
5 5 blr hypothetical protein bsr unknown protein gcccggaacgcatccccgg-accggctgttgccc 18 bll hypothetical exported glutamine-rich protein aaaaggaaccgcgtgccgc-atcggaggttgatc 29 bsr hypothetical protein aaacggaacttcagtcaaa-ccacgccgttggca 40 bll hypothetical protein ttcaggaacaagtggcagc-cccgggcgttggcg 49 bll hypothetical protein cggaggaacaaggttcgca-agcgcgcgttccca 30 blr oxidoreductase catgggaacgcgcgcttgc-gaaccttgttcctc 99 blr hypothetical protein bll putative phosphoglycolate phosphatase bll two-component response regulator bll hypothetical protein gaacggaacctgggattcccgaatcgcgtttacg gccaggaacggcgccatcg-tcctcccgttgact bsr unknown protein ccgaggaacatctccgcgc-gcggtcggttggcc 7 bll unknown protein blr hypothetical protein gcgaggaactgtgcgccggacggacgcgttggat 203 bsr unknown protein bll hypothetical protein gccgagaacccccgctcct-cggctgcgttgttc 33 bll similar to PEP2 protein bll7795 phyr two-component response regulator ctgcggaacttttcttgcc-ctgaggcgtagtca 68 bsr7796 nepr Putative anti-sigma factor cggcggaactttttctcga-acctggaattgtgc 71 blr7797 ecfg RNA polymerase sigma-e factor (Sigma-24) protein bll putative nitroreductase blr unknown protein bsr hypothetical protein aactggaacaattgtccaagcgatctaattgaag 70 blr similar to DNA ligase bll hypothetical protein bll hypothetical protein bll unknown protein bll putative phosphoglycolate phosphatase (EC ) bsr unknown protein bll unknown protein blr unknown protein bll similar to LpqO protein v00618aphii aphii control_aphii a Gene numbers and descriptions are according to Rhizobase ( 31 genes highlighted in column 1 with bold face letters and dark grey shading correspond to those included in Table 1 ( 2-fold reduced expression in the phyr mutant 8402 and in the ecfg mutant 8404 compared with the wild type when grown in PSY rich medium). For 38 additional genes emphasized with light grey shading a putative EcfG -dependent promoter was predicted as described in footnote c (see second column from right).
6 6 b Putative operons as described by Hauser et al or proposed in this work on the basis of the close proximity of co-regulated genes and occurrence of a putative EcfG -dependent promoter upstream of the first gene. C Candidate promoters of 31 genes highlighted with dark grey in column 1 were identified with PATSCAN and manual inspection using the mapped EcfG -dependent promoter of phyr (Fig. 6) used as query (see Table 1). All other putative promoters were predicted by the genome-scale DNA pattern program included in the RSA tools ( The consensus sequence (GGAAC nt RTT) derived from the 31 reference promoters (see Fig. 5) was used as a query to interrogate the upstream regions of the genes listed in column 1 (position -400 to -1 relative to the start codon defined in Nucleotides matching the -35 and -10 query sequence are highlighted. Note that two predictions were made for blr2753 and bll7659. d Indicated is the distance (in bp) of the 3' nucleotide of the predicted promoter sequence indicated in the adjacent column to the start codon of the gene indicated in the first column. Note that the start codon of blr5341, blr6123 and blr6772 as defined in is located within or upstream the predicted promoter.
7 Table S2. Oligonucleotides. Designation Nucleotide sequence (5' to 3') a, b AACTGCAGGGCATTAATCCCTCCCATTG 8'546' GCTCTAGAATCACCGAGCATGGCTTCC 8'545' CACACATATGTCCCGTTCACAGCTTGTCGCTG 8'545' TTGTCGACCGCCGCGGGCGCCTTGGGCGT 8'544' CGGCGCAACAACGGCAAGTGTTCAG 8'545' TGCCCGTCAGGGCGCGTGCATACC 8'545' GGAATTCACGCAGGGAGTCCGTGAGAGG 8'546' GGATATCGGAACAGATTGCGCAGGATCGTGAAC 8'546'254 bsr7796 F2 GGAATTCCATATGAAAGATCTCAAGTCTC 8' bsr7796 R1 AAACTCGAGTTAATCCCTCCCATTGTTG 8'546'057 blr7797 F1 GGAATTCCATATGCCTCTCACGGACTCC 8'546'092 blr7797 R1 AAAGGATCCCTACCCGCCGCTGCCG 8'546'608 a Nucleotide positions in the B. japonicum genome are indicated by subscript numbers at the 3' end of oligonucleotides. b Nucleotides shown in italics belong to restriction sites.
Translation and Operons
Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of
Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
Introduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
Table 5. Genes unique to G. thermodenitrificans NG80-2 Gene ID Gene name Gene product COG functional category
Table 5. Genes unique to G. thermodenitrificans NG80-2 GT0030 gt30 Methionine--tRNA ligase/methionyl-trna synthetase COG0143, Translation GT0033 gt33 Unknown GT0106 gt106 Ribosomal protein L3 COG0087,
Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
RNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
12-5 Gene Regulation
12-5 Gene Regulation Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 1 of 26 12-5 Gene Regulation Gene Regulation: An Example Gene
1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
Old FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.
Old FINAL EXAM BIO409/509 NAME Please number your answers and write them on the attached, lined paper. Gene expression can be regulated at several steps. Describe one example for each of the following:
Topic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
Gene regulation II Biochemistry 302. Bob Kelm February 28, 2005
Gene regulation II Biochemistry 302 Bob Kelm February 28, 2005 Catabolic operons: Regulation by multiple signals targeting different TFs Catabolite repression: Activity of lac operon is restricted when
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
Transmembrane Domains (TMDs) of ABC transporters
Transmembrane Domains (TMDs) of ABC transporters Most ABC transporters contain heterodimeric TMDs (e.g. HisMQ, MalFG) TMDs show only limited sequence homology (high diversity) High degree of conservation
GO ID GO term Number of members GO: translation 225 GO: nucleosome 50 GO: calcium ion binding 76 GO: structural
GO ID GO term Number of members GO:0006412 translation 225 GO:0000786 nucleosome 50 GO:0005509 calcium ion binding 76 GO:0003735 structural constituent of ribosome 170 GO:0019861 flagellum 23 GO:0005840
BME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
Strain or plasmid Relevant characteristics Reference
Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688
Molecular Biology, Genetic Engineering & Biotechnology Operons ???
1 Description of Module Subject Name?? Paper Name Module Name/Title XV- 04: 2 OPERONS OBJECTIVES To understand how gene is expressed and regulated in prokaryotic cell To understand the regulation of Lactose
Prokaryotic Regulation
Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory
Computational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
Supplementary Figure 1. The proportion S. aureus CFU of the total CFU (S. aureus + E. faecalis CFU) per host in worms
Supplementary Figure 1. The proportion S. aureus CFU of the total CFU (S. aureus + E. faecalis CFU) per host in worms alive or dead at 24 hours of exposure. Two sample t-test: t = 1.22, df = 10, P= 0.25.
Welcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
Genetics 304 Lecture 6
Genetics 304 Lecture 6 00/01/27 Assigned Readings Busby, S. and R.H. Ebright (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79:743-746. Reed, W.L. and
Population transcriptomics uncovers the regulation of gene. expression variation in adaptation to changing environment
Supplementary information Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment Qin Xu 1, Caiyun Zhu 2,4, Yangyang Fan 1,4, Zhihong Song
A genome sequence based discriminator for vancomycin intermediate Staphyolococcus aureus Supplementary Methods
1 Journal of Bacteriology Computational Biology Section 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Supplementary Information for: A genome sequence based discriminator
Gene regulation II Biochemistry 302. February 27, 2006
Gene regulation II Biochemistry 302 February 27, 2006 Molecular basis of inhibition of RNAP by Lac repressor 35 promoter site 10 promoter site CRP/DNA complex 60 Lewis, M. et al. (1996) Science 271:1247
Chapter 20. Initiation of transcription. Eukaryotic transcription initiation
Chapter 20. Initiation of transcription Eukaryotic transcription initiation 2003. 5.22 Prokaryotic vs eukaryotic Bacteria = one RNA polymerase Eukaryotes have three RNA polymerases (I, II, and III) in
UNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
Biology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
Regulation of Gene Expression in Bacteria and Their Viruses
11 Regulation of Gene Expression in Bacteria and Their Viruses WORKING WITH THE FIGURES 1. Compare the structure of IPTG shown in Figure 11-7 with the structure of galactose shown in Figure 11-5. Why is
What is an enzyme? Lecture 12: Enzymes & Kinetics I Introduction to Enzymes and Kinetics. Margaret A. Daugherty Fall General Properties
Lecture 12: Enzymes & Kinetics I Introduction to Enzymes and Kinetics Margaret A. Daugherty Fall 2003 ENZYMES: Why, what, when, where, how? All but the who! What: proteins that exert kinetic control over
A Microfluidic Platform Enables Large-Scale Single-Cell Screening to Identify Genes Involved in Bacterial Persistence
A Microfluidic Platform Enables Large-Scale Single-Cell Screening to Identify Genes Involved in Bacterial Persistence THÈSE N O 7641 (2017) PRÉSENTÉE LE 31 MARS 2017 À LA FACULTÉ DES SCIENCES DE LA VIE
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
GCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
Chapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
Chapter 12. Genes: Expression and Regulation
Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
Development Team. Regulation of gene expression in Prokaryotes: Lac Operon. Molecular Cell Biology. Department of Zoology, University of Delhi
Paper Module : 15 : 23 Development Team Principal Investigator : Prof. Neeta Sehgal Department of Zoology, University of Delhi Co-Principal Investigator : Prof. D.K. Singh Department of Zoology, University
REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
PROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
32 Gene regulation, continued Lecture Outline 11/21/05
32 Gene regulation, continued Lecture Outline 11/21/05 Review the operon concept Repressible operons (e.g. trp) Inducible operons (e.g. lac) Positive regulation of lac () Practice applying the operon concept
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
Quiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Quiz answers Kinase: An enzyme
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
Regulation of Gene Expression at the level of Transcription
Regulation of Gene Expression at the level of Transcription (examples are mostly bacterial) Diarmaid Hughes ICM/Microbiology VT2009 Regulation of Gene Expression at the level of Transcription (examples
Name Period The Control of Gene Expression in Prokaryotes Notes
Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression
S1 Gene ontology (GO) analysis of the network alignment results
1 Supplementary Material for Effective comparative analysis of protein-protein interaction networks by measuring the steady-state network flow using a Markov model Hyundoo Jeong 1, Xiaoning Qian 1 and
REGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
Controlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
Boolean models of gene regulatory networks. Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016
Boolean models of gene regulatory networks Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016 Gene expression Gene expression is a process that takes gene info and creates
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
Regulation of gene Expression in Prokaryotes & Eukaryotes
Regulation of gene Expression in Prokaryotes & Eukaryotes 1 The trp Operon Contains 5 genes coding for proteins (enzymes) required for the synthesis of the amino acid tryptophan. Also contains a promoter
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Gene regulation I Biochemistry 302. Bob Kelm February 25, 2005
Gene regulation I Biochemistry 302 Bob Kelm February 25, 2005 Principles of gene regulation (cellular versus molecular level) Extracellular signals Chemical (e.g. hormones, growth factors) Environmental
Translation - Prokaryotes
1 Translation - Prokaryotes Shine-Dalgarno (SD) Sequence rrna 3 -GAUACCAUCCUCCUUA-5 mrna...ggagg..(5-7bp)...aug Influences: Secondary structure!! SD and AUG in unstructured region Start AUG 91% GUG 8 UUG
Control of Gene Expression in Prokaryotes
Why? Control of Expression in Prokaryotes How do prokaryotes use operons to control gene expression? Houses usually have a light source in every room, but it would be a waste of energy to leave every light
Translation. A ribosome, mrna, and trna.
Translation The basic processes of translation are conserved among prokaryotes and eukaryotes. Prokaryotic Translation A ribosome, mrna, and trna. In the initiation of translation in prokaryotes, the Shine-Dalgarno
The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
What is an enzyme? Lecture 12: Enzymes & Kinetics I Introduction to Enzymes and Kinetics. Margaret A. Daugherty Fall 2004 KEY FEATURES OF ENZYMES
Lecture 12: Enzymes & Kinetics I Introduction to Enzymes and Kinetics Margaret A. Daugherty Fall 2004 What is an enzyme? General Properties Mostly proteins, but some are actually RNAs Biological catalysts
From Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
Supplementary Information. Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression
Supplementary Information Drought response transcriptomics are altered in poplar with reduced tonoplast sucrose transporter expression Liang Jiao Xue, Christopher J. Frost, Chung Jui Tsai, Scott A. Harding
Molecular Biology of the Cell
Alberts Johnson Lewis Morgan Raff Roberts Walter Molecular Biology of the Cell Sixth Edition Chapter 6 (pp. 333-368) How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2015 Genetic
Lecture 7 Cell Biolog y ٢٢٢ ١
Lecture 7 ١ Mitochondria ٢ Mitochondria Mitochondria are the energy factories of the cells. The energy currency for the work that animals must do is the energy-rich molecule adenosine triphosphate (ATP).
GENETICS - CLUTCH CH.12 GENE REGULATION IN PROKARYOTES.
GEETICS - CLUTCH CH.12 GEE REGULATIO I PROKARYOTES!! www.clutchprep.com GEETICS - CLUTCH CH.12 GEE REGULATIO I PROKARYOTES COCEPT: LAC OPERO An operon is a group of genes with similar functions that are
Three types of RNA polymerase in eukaryotic nuclei
Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive
Motifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1.
Motifs and Logos Six Discovering Genomics, Proteomics, and Bioinformatics by A. Malcolm Campbell and Laurie J. Heyer Chapter 2 Genome Sequence Acquisition and Analysis Sami Khuri Department of Computer
Bacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
Supplemental Materials
JOURNAL OF MICROBIOLOGY & BIOLOGY EDUCATION, May 2013, p. 107-109 DOI: http://dx.doi.org/10.1128/jmbe.v14i1.496 Supplemental Materials for Engaging Students in a Bioinformatics Activity to Introduce Gene
Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
Ch 10, 11 &14 Preview
Ch 10, 11 &14 Preview Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Why did the original one-gene, one-enzyme hypothesis have to be modified? a. Some
DNA Structure. Voet & Voet: Chapter 29 Pages Slide 1
DNA Structure Voet & Voet: Chapter 29 Pages 1107-1122 Slide 1 Review The four DNA bases and their atom names The four common -D-ribose conformations All B-DNA ribose adopt the C2' endo conformation All
Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
Genomic insights into high exopolysaccharide-producing dairy starter. bacterium Streptococcus thermophilus ASCC 1275
Supplementary information of Genomic insights into high exopolysaccharide-producing dairy starter bacterium Streptococcus thermophilus ASCC 1275 Qinglong Wu, Hein Min Tun, Frederick Chi-Ching Leung, Nagendra
Topology. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
Topology 1 Introduction 2 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 G+C content 7 Codon usage 27 marc.bailly-bechet@univ-lyon1.fr The big picture Eukaryota Bacteria Many linear chromosomes
Laith AL-Mustafa. Protein synthesis. Nabil Bashir 10\28\ First
Laith AL-Mustafa Protein synthesis Nabil Bashir 10\28\2015 http://1drv.ms/1gigdnv 01 First 0 Protein synthesis In previous lectures we started talking about DNA Replication (DNA synthesis) and we covered
Lecture 7: Simple genetic circuits I
Lecture 7: Simple genetic circuits I Paul C Bressloff (Fall 2018) 7.1 Transcription and translation In Fig. 20 we show the two main stages in the expression of a single gene according to the central dogma.
The Making of the Fittest: Evolving Switches, Evolving Bodies
INTRODUCTION MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH The types and amounts of proteins produced by a given cell in the body are very important and carefully regulated. Transcribing
Molecular Biology of the Cell
Alberts Johnson Lewis Raff Roberts Walter Molecular Biology of the Cell Fifth Edition Chapter 6 How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2008 Figure 6-1 Molecular Biology
Biophysics Lectures Three and Four
Biophysics Lectures Three and Four Kevin Cahill cahill@unm.edu http://dna.phys.unm.edu/ 1 The Atoms and Molecules of Life Cells are mostly made from the most abundant chemical elements, H, C, O, N, Ca,
AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
Eukaryotic Gene Expression
Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes
Eukaryotic vs. Prokaryotic genes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,
Controllo dell espressione genica: procarioti
Controllo dell espressione genica: procarioti 1. Operon Regolazione dell espressione nei procarioti 2. Regulation mostly on the transcriptional level. POSITIVE: energy saving, regulation of only one mrna
23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
Gene Regulation and Expression
THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.
Biochemistry Prokaryotic translation
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 2. Understand the concept of genetic code 3. Understand the concept of wobble hypothesis
Initiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5
Biological Process Term Enrichment
Biological Process Term Enrichment cellular protein localization cellular macromolecule localization intracellular protein transport intracellular transport generation of precursor metabolites and energy
Chapter 10, 11, 14: Gene Expression, Regulation, and Development Exam
Chapter 10, 11, 14: Gene Expression, Regulation, and Development Exam Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Why did the original one-gene, one-enzyme
Prokaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control