Isolation and identif ication of a phenol2degrading bacterial stra in

Transcription

1 ACTA SCIEN TIAE CIRCUMSTAN TIAE Vol. 20,No. 4 J uly,2000 : (2000) :X172 :A 1,2,3, 3, 3, 3 3, 2, 1 (1., ; 2., ; 3., ) : PHEA22,, 394 nmol/ (mg min). Biolog, ( Acinetobacter calcoaceti2 cus). PCR 16 S rdna,, 16 S rdna 98 %.,PHEA22 : ; ; 16 S rdna ; Isolation and identif ication of a phenol2degrading bacterial stra in XU Yuquan 1,2,3, ZHAN G Wei 3, CHEN Ming 3, L IN Min 3, L I J unming 2, FAN G Xuanjun 1 (1. Institute of Biotechnology Reseach Center, CAAS, Beijing ; 2. College of Biology, CAU, Beijing ; 3. Institute for Application of Atomic Energy, CAAS, Beijing ) Abstract :A strain that can grow with phenol as the sole source of carbon and energy, PHEA22, was isolated from the wastewater dis2 charged by an oil refinery. The maximum rate of phenol degradation of PHEA22 is 394 nanomoles per minute per milligram of pro2 tein. Biolog Microstation Identification System was used to identify the PHEA22 as Acinetobacter Calcoaceticus. The sequence analy2 sis of a 1500 bp 16 S rdna fragment amplified from total DNA of PHEA22 strain by PCR showed that PHEA2shares 98 % 16 S 4DNA sequence homology with typical A. Calcoaceticus strain. In phylogenetic framework of bacterial classification, PHEA22 be2 longs to proteobacteria ; gamma subdivision : Acinetobacter, A. Calcoaceticus. Keywords :phenol ; biodegradation ; 16 S rdna ; Acinetobacter calcoaceticus 65, [1 ]. :, [2 4 ]., Biolog 16 S rdna Biolog 1500, Biolog 95, 16 S rdna, [5 ]. 16 S rdna, 16 S rdna, [6 ]. : ; : : (863) : (1971 ),, 3

2 4 : 451,, ( mg/ L) LB (10 g,5 g,10 gnacl,15 g, 1000 ml,p H 618). A15 ( K 2 HPO g KH 2 PO g NaCl 0. 1 g MgSO 4 7H 2 O 0. 2 g MnSO 4 H 2 O g Fe 2 ( SO 4 ) 3 H 2 O g NaMoO 4 2H 2 O g (N H 4 ) 2 SO g 15 g,015 g, 1000 ml p H 618), A [7 ]. : r/ min 10 min, 100 L 10 ml, 5 ml, 100 L 0. 5 mol/ L N H 4 OH, p H 618 p H 719, 50 L 2 % 42,, 50 L 8 %,,15 min, 510 nm 113 Folsom [8 ] Bradford [9 ], : 100 ml,12000 r/ min 10 min, 20 ml, r/ min, 114 Biolog 96,, tetrazolium violet,, 24 h Biolog 115 DNA SDS2 K, (CTAB), DNA [10 ]. 116 PCR 16 S rdna F27 (5 2A GA GTTTGA TCA TGGCTCA G23 ) R1492 (5 2 TACGGTTACCTTGTTACGACTT23 ) PCR 16 S rdna [11 ]. 117 PCR PCR ( Idaho Technology) 20 L : 915 L,10 Buffer 2 L,2. 5 mg/ ml BSA 2 L,2. 0 mmol/ L dn TP 2 L,F27 1 L,R L, Taq 015 L, DNA 50 2 L,, 35,,94 20 s,52 30 s,72 1 min 20 s,35 10 min,110 %

3 452 20,EB Promega DNA PCR, Promega p GEM2easy, DH5, Ap (5 g/ ml) / IPTG/ X2gal LB,, EcoR S rdna 16 S rdna (sbs), BLAST Gen2 bank 16 S rdna [12 ] ,30, 015 mg/ ml,30 5 d, PHEA PHEA22 LB 20 ml LB, r/ min,od , 2 % 012 mg/ ml 015 mg/ ml 100 ml A15, r/ min 12 h 5 ml OD 600. : A15, 012 mg/ ml, 12 h, 015 mg/ ml, 72 h,, ( 1). 1 PHEA22,,, 012 mg/ ml, OD , 015 mg/ ml, OD ,, PHEA22,,,,, 12h Folsom nmol/ (mg min), Ehrt [13 ] nmol/ (mg min) 20 h,, 014 mg/ ml. PHEA22, 16 h, 1 PHEA22 Fig. 1 The growth and degradation curve of PHEA22 in different phenol concentra2 tions PHEA22 Pseudomonas sp A ci netobacter sp [14 ]. 213 p H PHEA22 PHEA mg/ ml A15 PHEA , PHEA22 30.

4 4 : 453 PHEA22 p H, p H mg/ ml A15, 24 h, p H %. p H 10,PHEA22, 4817 %. p H 4 11,PHEA PHEA22 95 Biolog, 24 h, PHEA22, 1 PHEA22 95 PHEA22, Bi2 olog, PHEA22 ( A ci netobacter calcoaceticus), (SIM INDEX) PHEA2A Biolog 95 Table 1 Utilization of 95 carbonsubstrates by strain PHEA22 using biolog microplate + p2 - D2 - L2 + 2 V - 2 2D2-2L2 + V 2 + D2 V L2 + V 2 + D2 - L L2 - L D,L2 + D2 - L2 + N2 2D2 - + V L2 + N2 2D2 - - D2 V D2 V - + V L2 + L2 + D2 + V L2 + D D,L2 V i V L2 V D2 + + V - + D2 + D D2 + L2 + D2 - + m2 - L2 - D D2 - L2 + D2-2,32 - lactulose - L2 + D2 - - V L D,L2 2 - D2 V 2L2 V D2 + 2L2 V : +, -, V 215 PHEA22 16 S rdna PHEA22 DNA, 16 S rdna F27 R1492 PCR, 115kb PCR, T PCR T EcoR, 662 bp 838 bp 2, 115 Kb DNA ( 3). PHEA22 16 S rdna Gen2 bank, AF

5 PHEA22 16 S rdna EcoR (M) DNA/ EcorR + Hind, (1) PHEA22 DNA, (2) 16 S rdna, (3) 16 S rdna T, (4) 16 S rdna T, (5) EoR 16 S rdna T, (6) EoR 16 S rdna Fig. 2 The amplification, linkage and EcoR Restriction of PHEA22 16 S rdna 3 PHEA22 16 S rdna Fig. 3 The sequence of 16 S rdna fragment of PHEA22 BLAST PHEA22 16 S rdna Genebank 16 S rdna, 16 S rdna 90 %, 16 S rdna 98 %, PHEA22,, PHEA22 Pseudomonas sp. CF600 [15 ] A. calcoaceticus NCIB 8250 [16 ] 3 11 PHEA22, Biolog 16 S rdna, ( A ci netobacter calcoaceticus). 21 PHEA22

6 4 : PHEA22 NCIB8250 [13 ]., : [ 1 ],. [ M ]. : [ 2 ],,. [J ].,1999,18 (1) :82 86 [ 3 ] Klibanov A M, Tu T M, Scott K P. Peroxidase2 catalyzed removalof phenols from calconversion wastewaters [J ]. Scince, 1983, 221 : [ 4 ] Lee S G, Hung S P, Sung M H. Removal and bioconversion of phenol in wastewater by a thermostable 2tryrosion[J ]. En2 zyme and Microbial Technology, 1996, 19 : [ 5 ] [J ].,1998, 38 : [ 6 ] Vandamme P, Pot B, et al. Polyphasic taxonomy, a consensus approach to bacterial systemmatics[j ]. Microbiol Reviews, 1996, 60 : [ 7 ] [ M ]. : [ 8 ] Folsom B R, Chapman P J. Phenol and trichloroethylene degradation by Pseudomonas cepacia G4 : Kinetics and interactions between substrates[j ]. Appl Environ Microbiol, 1990, 56 : [ 9 ] Bradford M M. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the priciple of protein2dye bending[j ]. Anal Biochem, 1976, 72 : [ 10 ] Wilson K. Preparation of genomic DNA from bacteria. Preparation of genomic from bacteria[ A]. In : Ausubul F M, Bent R(eds). Current protocols in molecular biology [ C]. New york, (N Y. ) :J Wiley & Sons : 1987 [ 11 ] Weissburg W G, Barns S M, et al. 16 S robosomal DNA amplification for phylogenetic study [J ]. J Bacteriol, : [12 ] Altschul Stephen F, Thomas L. Gapped BLAST and PSI2BLAST : a new generation of protein database search programs [J ]. Nucleic Acids Res, 1997, 25 : [ 13 ] Ehrt S, Ornston L N, KpoN ( 54 ) is required for conversion of phenol to catechol in Acinetobacter calcoaceticus [J ]. J Bac2 teriol,1994,176 : [ 14 ], [J ]. 1991, 2 :44 47 [15 ] Nordlund I, Powlowki J, Shingler V. Complete nucleotide sequence and polypide analysis of multicomponent phenol hy2 droxylase form Psedomonas sp. strain CF600[J ]. J Bacteriol, 1990, 172 : [ 16 ] Fewson C A. The identity of the gram2negtive bacterium NCIB 8250[J ]. J Gen Microbiol,1967,48 :