Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies

Transcription

1 Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies Khaya Ntushelo Department of Agriculture and Animal Health, University of South Africa, Science Campus, Florida, 1710, South Africa

2 Unisa Science Campus Research Metagenomics Plant-microbe interactions Potato diseases

3 Metagenomics: Introduction Metagenome Handelsman 1988 University of Wisconsin Madison As applicable to bacteria Popular gut, soil, extreme environments, ocean water, sewage Direct study of genetic material from environmental samples Prominence with high-throughput genomic sequencing

4 Known metagenomics projects Sargasso Sea and Global Ocean Survey Metagenomics genetic diversity in marine microbial communities Human Microbiome Project

5 Rationale for our study

6 Introduction: Bacterial metagenomics of potato and tomato Laphalale Skeerpoort Polokwane Hoedspruit Ladanna Vryburg Bothaville Petrusburg Warden

7 Metagenomics: Sample preparation

8 PCR products of the 16S rrna gene run through agarose gel paf:agagtttgatcctggctcag/ phr:aaggaggtgatccagccgca Edwards et al., 1989

9 Analysis of the 16S rrna gene paf:agagtttgatcctggctcag/phr:aaggaggtgatccagccgca Edwards et al., amplified ~ 550 bp of the 16S region targeting the v3-v4 region with Illumina MiSeq 300 x 300 pair-end reads

10 MALDI-TOF

11 MALDI-TOF compared with sequence analysis of the 16S rrna gene Sample code Source Locality Identification by MALDI-TOF Identification by sequence analysis of the 16S rrna gene GeneBank Accession number Comment on mismatch identification Unisa1 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP Unisa2 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP Unisa3 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP KP Unisa4 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP Unisa5 b Potato Bothaville Myroides odoratimimus Myroides odoratimimus

12 Results of the 16S rrna gene-based metagenomics Organism/Hit name Cluster size Result count Comment Acinetobacter sp. 1 1 Acricotopus lucens 1 1 Non bacterial hit Alicyclobacillus acidoterrestris 1 1 Non bacterial hit Allenhyphes flinti 1 1 Spoilage bacterium Anaplasma platys 1 1 Canine pathogen Antheraea pernyi 1 1 Non bacterial hit Aphidius ervi 1 1 Non bacterial hit Asterias forbesii 1 1 Non bacterial hit Bacillus halodurans 18 1 Bacillus licheniformis 11 2 Bacillus sp. 9 3 Bacillus subtilis Clastoptera testacea 1 1 Non bacterial hit Danaus affinis 1 1 Non bacterial hit Geobacillus thermoleovorans Enterobacter sp Eucalyptus tereticornis 1 1 Non bacterial hit Fusarium equiseti 1 1 Non bacterial hit Fusarium oxysporum 1 1 Non bacterial hit Galleria mellonella 4 3 Non bacterial hit Geobacillus sp Geobacillus stearothermophilus Myroides sp. 3 1 Nicotiana tabacum 18 3 Non bacterial hit

13 Results of the 16S rrna gene-based metagenomics: Summary Dominant genera Bacillus Geobacillus Enterobacter

14 Bacillus and plants Growth promoter Control of pathogens Effect on germination and on potato growth scanty Bacillus an antagonist of the blackleg pathogen Pbcb New tools, and a variety of combined treatments

15 Bacillus and plants Seed germination AND seedling vigour experiment Okra Seed coated with Bacillus subtilis 5 x 3 x 2 factorial experiment (rep 5x in 3 cycles) Aluminium toxicity, temperature and B & No B In total 450 Petri plates were examined in the data collection, 50 plates for the chemical analysis

16 Seed germination assays Germination percentage, Coleoptile length Chemistries of the germination medium and the germinated seed Cations quantified in the 50 samples K mg/kg P mg/kg Mg mg/kg Ca mg/kg Na mg/kg Al mg/kg Fe mg/kg Zn mg/kg Mn mg/kg B mg/kg Cu mg/kg Avearage (Bacillus) Avearage (No Bacillus) Anions quantified in the 50 samples PO 3-4 mg/kg Fl - mg/kg Cl - mg/kg SO 2-4 mg/kg NO - 3 mg/kg NO - 2 mg/kg Avearage (Bacillus) Avearage (No Bacillus) Secondary metabolite shifts in the germinated seed

17 Seed germination assays Germination percentage, Coleoptile length Chemistries of the germination medium and the germinated seed Cations quantified in the 50 samples K mg/kg P mg/kg Mg mg/kg Ca mg/kg Na mg/kg Al mg/kg Fe mg/kg Zn mg/kg Mn mg/kg B mg/kg Cu mg/kg Avearage (Bacillus) Avearage (No Bacillus) Anions quantified in the 50 samples PO 3-4 mg/kg Fl - mg/kg Cl - mg/kg SO 2-4 mg/kg NO - 3 mg/kg NO - 2 mg/kg Avearage (Bacillus) Avearage (No Bacillus) No differences in the ionic composition of Bacillus-treated and Bacillus-untreated samples: conclusion

18 Effect of Bacillus on the germination on okra

19 Effect of Bacillus on the germination on okra

20 Secondary metabolite shifts due to Bacillus treatment

21 Secondary metabolite shifts due to Bacillus treatment Data output was NMR intensity values Phase correction and baseline correction of the NMR spectra were done using ACD/NMR Processor. NMR intensities were selected from the range zero to 14 ppm. PCA was done using Multibase 2014

22 Bacillus and plants Potato growth, yield and disease suppression studies

23 Data collected in the plant growth studies Growth parameters Stomatal conductance Chlorophyll content Chemical analysis Will extend to a whole range of molecular data

24 Effect of Bacillus on the growth of potato

25 Effect of Bacillus on the growth of potato

26 Preliminary findings A few bacterial species dominate potato and tomato Sequence analysis of the 16S rrna gene and MALDI-TOF give the same result of bacterial species IDs Bacillus one of the dominant species promotes germination of okra growth of potato Not much bacterial cells are needed to cause germination and growth effects Bacillus ineffective in high temperature A small portion of the okra germinating seed chemistry is altered to boost germination

27 Still to come Tuber yield data Bacterial antagonism Molecular interactions between Bacillus and bacterial plant pathogens

28 Acknowledgements Postdoctoral researcher Sheku Kanu MSc student Taboga Mathiba BTech students Livhuwani Nemutandani and Mpho Nematswerani PPRI for providing the Bacillus strains used Inqaba Biotech and the ARC Biotechnology Platform for their facilities and expertise shared University of Pretoria for MALDI-TOF

29