Supplementary Information. Autocatalytic backbone N-methylation in a family of ribosomal peptide natural products
|
|
- Aubrey Harper
- 5 years ago
- Views:
Transcription
1 Supplementary Information Autocatalytic backbone -methylation in a family of ribosomal peptide natural products iels S. van der Velden 1, oemi Kälin 1, Maximilian J. Helf 1, Jörn Piel 1, Michael F. Freeman 2 * and Markus Künzler 1 * 1 Department of Biology, Institute of Microbiology, Eidgenössische Technische Hochschule (ETH) Zurich, Vladimir-Prelog-Weg 4, 893 Zurich, Switzerland 2 Department of Biochemistry, Molecular Biology, and Biophysics & BioTechnology Institute, University of Minnesota-Twin Cities, St. Paul, M 5518, USA *Co-corresponding authors *Correspondence: mkuenzle@ethz.ch (Markus Künzler) or mffreema@umn.edu (Michael F. Freeman).
2 Supplementary Results Supplementary Figure 1 SDS-PAGE page of purified proteins from E. coli and size exclusion chromatography of pha and pha-f. (a) SDS-PAGE of purified proteins from E. coli. 1 µg of each purified protein was run on a standard 12% (w/v) SDS-PAGE and stained with Coomassie brilliant blue. The name of the protein is followed by the duration of E. coli expression. Lane 1: pha, 24 hrs; Lane 2: pha, 5 days; Lane 3: DbphA, 24 hrs; Lane 4: DbphA, 5 days; Lane 5: pha-f, 5 days; Lane 6: pha-p, 5 days; Lane 7: pha-cyca, 5 days; Lane 8: pha-dica, 5 days; Lane 9: pha Y98A, 5 days; Lane 1: pha S129A (marked by ), 5 days. All proteins contain an -terminal histidine tag. Theoretical masses: pha, 46.9 kd; DbphA, 46.9 kd; pha-f, 46.3 kd; pha-p, 45.1 kd; pha-cyca, 45,7 kd; pha-dica, 46.8 kd. (b) Purified pha expressed for 24 hrs in E. coli BL21(DE3) eluted as high molecular mass aggregates (1st peak) and as a dimer (2nd peak) with an expected theoretical mass of 93.7 kd. (c) pha-f expressed for 24 hrs in E. coli BL21(DE3) mainly eluted as a dimer (2nd peak) with a theoretical mass of 92.5 kd. Insets: SDS-PAGE profile of the peak fractions. pha and pha-f are indicated with a. (d) The calibration curve used to estimate the observed molecular weight of pha and pha-f. The observed mass of the dimer of both pha and pha-f was 95.7 kd versus a theoretical mass of 93.7 kd for pha and 92.5 kd for pha-f. For calibration of the column the following size markers were used: carbonic anhydrase (29 kd), ovalbumin (44 kd), conalbumin (75 kd), ferritin (44 kd) and thyroglobulin (66 kd). The Y-axis represents the partition coefficient (Kav) and X-axis represents the log of the molecular weight (Mr). a kd 25 kd 13 kd 13 kd 1 kd 1 kd 7 kd 7 kd 55 kd 55 kd 2 kd 35 kd 35 kd 15 kd 25 kd 25 kd 15 kd 1 kd 75 kd 15 kd 1 kd 75 kd 5 kd 5 kd 37 kd 37 kd 25 kd 25 kd 2 kd 15 kd b 1 9 d c pha pha-f Carbonic Anhydrase 1 dimer 25kD 75kD aggregates 5kD 37kD 25kD Elution volume (ml) kD 75kD 5kD 37kD 1 25kD 5 valbumin dimer Kav 15 5kD 37kD UV absorption (mau) UV absorption (mau) 75kD 5kD 37kD aggregates.3 Conalbumin pha/pha-f.2 25kD.1 y= -.147ln(x) R2= Elution volume (ml) Mr Ferritin Thyroglobulin 1
3 Supplementary Figure 2 Protein sequence and structural alignments of the methyltransferase domain of pha. (a) Protein sequence alignment (ClustalW) along with secondary prediction (PSIPRED) of the methyltransferase domain of pha with homologous putative methyltransferases found in basidiomycota according to a BLAST search in the JGI fungal genome database ( Amino acids Y98 and S129 (highlighted in black) are fully conserved among all fungal homologues. The online software ESPript 3. was used to create the alignment figure. A red background denotes identical residues and red lettering denotes similar residues. The protein sequences corresponding to the respective protein ID numbers can be found on the JGI website ( programs/fungi/index.jsf). (b) The protein structural model of pha was generated using the online tool PHYRE2 28 and aligned with the bacterial homologues using PyML. Amino acid residues Y98 and S129 (black) of pha (red) are structurally conserved and lay in close proximity to the SAM binding pocket of the bacterial methyltransferases (magenta); cobalt-precorrin-4 (CobA) from Bacillus megaterium 29, dehydrogenase and ferrochelatase (CysG) from Salmonella enterica 3 and the SAM-dependent bismethyltransferase cytochrome cd1 nitrite reductase (ire) from Pseudomonas aeruginosa 31. Protein data bank files 1S4D (CobA), 1PJT (CysG) and 2YB (ire) were used for the generation of the structural alignments with pha.
4 Supplementary Figure 2 a Y98 b CobA S129A CysG ire S129 S129 S129 Y98 Y98 Y98
5 Supplementary Figure 3 Detected -methylations of pha-y98a and pha-s129a when expressed in E. coli alone or co-expressed with pha-v5t. Extracted ion chromatograms (EICs) of trypsin-treated, His-tagged (a) pha, (b) pha-y98a and (c) pha-s129a after five days of expression in E. coli compared to coexpression of pha-v5t with His-tagged (d) pha, (e) pha-y98a and (f) pha-s129a for 36 hrs. Methylation of pha-y98a and pha-s129a was only observed when coexpressed with pha-v5t, insinuating trans-methylation from pha-v5t. The catalytically active core mutant pha-v5t was used as a precaution for unambiguous detection of the pha-y98a and pha-s129a core peptides. Detected -methylated species are highlighted in green. Protein, time of expression in E. coli and HPLC retention time (RT) are listed in the upper right-hand corner of the spectrum. A mass window of.1 was used to create all EICs.
6 Supplementary Figure 3 a RT: min pha, 5 days [M+3H] 3+ ( ) [M+9Me+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) [M+11Me+3H] 3+ ( ) b RT: min pha-y98a, 5 days [M+3H] 3+ (126.58) 2 c [M+3H] 3+ (126.58) RT: min pha-s129a, 5 days
7 d RT: min pha, 36hrs [M+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) [M+2Me+3H] 3+ ( ) [M+3Me+3H] 3+ (14.512) [M+6Me+3H] 3+ ( ) [M+9Me+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) e RT: min pha-y98a, 36hrs [M+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) f RT: min pha-s129a, 36hrs [M+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) [M+1Me+3H] 3+ ( )
8 Supplementary Figure 4 Detected -methylations of pha after cell-free incubation. (a) EIC of purified pha after four hours of expression in E. coli. (b) EIC of purified pha (after four hours of expression in E. coli) incubated in an E. coli cell extract for three days at room temperature. Detected -methylated species are highlighted in green. Protein, time of expression in E. coli and HPLC retention time (RT) are listed in the upper right-hand corner of the spectrum. A mass window of.1 was used to create all EICs. More details concerning these data can be found in the methods. a RT: min pha, 4hr 1 8 [M+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) [M+2Me+3H] 3+ ( ) [M+3Me+3H] 3+ (14.58) b RT: min pha, 4hr, CF, 3 days [M+3H] 3+ ( ) [M+1Me+3H] 3+ ( ) [M+9Me+3H] 3+ ( ) [M+1Me+3H] 3+ ( )
9 Supplementary Figure 5 Structures of omphalotin B-I. Green depicts -methylations and blue denotes structural differences from omphalotin A. R 1 H R 2 H H R 3 H mphalotin B: R1 = H, R2 = mphalotin C: R1 = H, R2 = mphalotin D: R1 =, R2 = mphalotin E: R1 = H mphalotin F: R1 = H, R2 = H, R2 = H mphalotin G: R1 = H, R2 = H H, R3 = H, R3 = H, R3 = H, R3 = H, R3 = H, R3 = H H mphalotin H: R1 =, R2 = mphalotin I: H R1 =, R2 =, R3 =, R3 = H H omphalotins B-I
10 Supplementary Figure 6 pha is part of a gene cluster that is conserved in D. bispora. (a) The omphalotin gene cluster from. olearius and the homologous cluster found in D. bispora. Details regarding the individual genes in the clusters can be found in Supplementary Table 2. (b) Protein sequence alignment (ClustalW) along with secondary prediction (PSIPRED) of pha (JGI Prot. ID. 287) with DbphA (JGI Prot. ID ) using the online software ESPript 3.. A red background denotes identical residues and red lettering denotes similar residues. a. olearius omphalotin gene cluster ophb1 ophc opha ophd ophb2 ophp ophe dbophb1 dbophb2 dbophc dbophd1 dbophb3 dbopha dbophd2 dbophb4 dbophp dbophe 1 kb D. bispora putative borosin gene cluster Monooxygenase TF2-like Methyltransferase -acyltransferase Prolyloligopeptidase F-box/RI-like b pha pha DbphA pha pha DbphA pha pha DbphA pha pha DbphA pha pha DbphA core peptide
11 Supplementary Table 1 Primers used in this study
12 Supplementary Table 2 l Details of genes located in the. olearius and D. bispora borosin gene clusters *The protein sequences corresponding to the respective protein ID numbers can be found on the JGI website ( and /Denbi1/Denbi1.home.html). Supplementary References 28. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M.. & Sternberg, M. J. E. The Phyre2 webportal for protein modeling, prediction and analysis. at. Protoc. 1, (215). 29. Vévodová, J. et al. Structure/function studies on a S-adenosyl-L-methionine-dependent uroporphyrinogen III C methyltransferase (SUMT), a key regulatory enzyme of tetrapyrrole biosynthesis. J. Mol. Biol. 344, (24). 3. Stroupe, M. E., Leech, H. K., Daniels, D. S., Warren, M. J. & Getzoff, E. D. CysG structure reveals tetrapyrrole-binding features and novel regulation of siroheme biosynthesis. at. Struct. Biol. 1, (23). 31. Storbeck, S. et al. Crystal structure of the heme d1 biosynthesis enzyme ire in complex with its substrate reveals new insights into the catalytic mechanism of S-adenosyl-Lmethionine-dependent uroporphyrinogen III methyltransferases. J. Biol. Chem. 286, (211).
13 Supplementary ote: Mass spectra supporting the structural assignment of peptides described in this study.
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationTable S1. Computational details for the reaction of {[(NH 3 ) 2 Cu]-(O 2 )-[Cu(NH 3 ) 2 ]} 2+ with 4-carboxamidophenolate.
SI 1 Supporting Information: Structure/function correlations among coupled binuclear copper proteins through spectroscopic and reactivity studies of NspF Supplementary Materials and Methods. Protein Expression
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10244 a O07391_MYCAV/127-243 NLPC_HAEIN/80-181 SPR_SHIFL/79-183 P74160_SYNY3/112-245 O24914_HELPY/301-437 Q51835_PORGI/68-178 DPP6_BACSH/163-263 YKFC_BACSU/185-292 YDHO_ECOLI/153-263
More informationTransmembrane Domains (TMDs) of ABC transporters
Transmembrane Domains (TMDs) of ABC transporters Most ABC transporters contain heterodimeric TMDs (e.g. HisMQ, MalFG) TMDs show only limited sequence homology (high diversity) High degree of conservation
More informationProtein supramolecular complex formation by site-specific avidin-biotin interactions
Protein supramolecular complex formation by site-specific avidin-biotin interactions Yutaro Mori, 1 Masahiro Goto, 1, 2 and Noriho Kamiya 1, 2 * 1 Department of Applied Chemistry, Graduate School of Engineering,
More informationydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
More informationSUPPLEMENTARY INFORMATION
Data collection Supplementary Table 1 Statistics of data collection, phasing and refinement Native Se-MAD Space group P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 50.4, 94.2, 115.4 49.8, 94.2,
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationSupplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
More informationSerine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
More informationStructure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome
Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome Ahmad Jomaa 1, Yu-Hsien Hwang Fu 2, Daniel Boehringer 1, Marc Leibundgut 1, Shu-ou Shan 2, and Nenad
More informationTitle. CitationChemical Communications, 48(53): Issue Date Doc URL. Type. Additional There Information.
Title A heme degradation enzyme, HutZ, from Vibrio cholera Author(s)Uchida, Takeshi; Sekine, Yukari; Matsui, Toshitaka; CitationChemical Communications, 48(53): 6741-6743 Issue Date 2012-06 Doc URL http://hdl.handle.net/2115/68577
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationSupporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationSupplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
More informationStructural insights into bacterial flagellar hooks similarities and specificities
Supplementary information Structural insights into bacterial flagellar hooks similarities and specificities Young-Ho Yoon, Clive S. Barker, Paula V. Bulieris, Hideyuki Matsunami, Fadel A. Samatey* Affiliation:
More informationThe Fic protein Doc uses an inverted substrate to phosphorylate and. inactivate EF-Tu
The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu Daniel Castro-Roa 1, Abel Garcia-Pino 2,3 *, Steven De Gieter 2,3, Nico A.J. van Nuland 2,3, Remy Loris 2,3, Nikolay
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationStructural insights into energy regulation of light-harvesting complex from spinach CP29
SUPPLEMENTARY INFORMATION Structural insights into energy regulation of light-harvesting complex from spinach CP29 Xiaowei Pan 1, Mei Li 1, Tao Wan 1,2, Longfei Wang 1,2, Chenjun Jia 1,2, Zhiqiang Hou
More informationJohns Hopkins University, Baltimore, Maryland, USA Ph.D. Biology, 2008
DEPARTMENT OF BIOCHEMISTRY, MOLECULAR BIOLOGY, & BIOPHYSICS, THE UNIVERSITY OF MINNESOTA 244A GORTNER LABORATORY 1479 GORTNER AVE. ST. PAUL, MN 55108 (+1) 612-201-2003 (CELL) (+1) 612-624-8575 (OFFICE)
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12890 Supplementary Table 1 Summary of protein components in the 39S subunit model. MW, molecular weight; aa amino acids; RP, ribosomal protein. Protein* MRP size MW (kda) Sequence accession
More informationBiochemical Journal. Structure and function of SirC from Bacillus megaterium: a metal-binding precorrin-2 dehydrogenase
www.biochemj.org Biochem. J. (2008) 415, 257 263 (Printed in Great Britain) doi:10.1042/bj20080785 257 Structure and function of SirC from Bacillus megaterium: a metal-binding precorrin-2 dehydrogenase
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
More informationBiochemistry Quiz Review 1I. 1. Of the 20 standard amino acids, only is not optically active. The reason is that its side chain.
Biochemistry Quiz Review 1I A general note: Short answer questions are just that, short. Writing a paragraph filled with every term you can remember from class won t improve your answer just answer clearly,
More informationFull-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Definition and assessment of ciap1 constructs.
Supplementary Figure 1 Definition and assessment of ciap1 constructs. (a) ciap1 constructs used in this study are shown as primary structure schematics with domains colored as in the main text. Mutations
More informationHalogenation of glycopeptide antibiotics occurs at the amino acid level during non-ribosomal peptide synthesis
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Halogenation of glycopeptide antibiotics occurs at the amino acid level during non-ribosomal
More informationCrystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition
JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More informationKang, Lin-Woo, Ph.D. Professor Department of Biological Sciences Konkuk University Seoul, Korea nd Semester
Kang, Lin-Woo, Ph.D. Professor Department of Biological Sciences Konkuk University Seoul, Korea 2018. 2 nd Semester Absorbance Assay (280 nm) Considerations for use Absorbance assays are fast and
More informationA: Up regulated proteins B: Down regulated proteins. Susceptible Resistant Susceptible Resistant Resistant Susceptible
Supplementary Materials: Identification of Biomarkers for Resistance to Fusarium oxysporum f. sp. cubense Infection and in Silico Studies in Musa paradisiaca Cultivar Puttabale through Proteomic Approach
More informationBSc and MSc Degree Examinations
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes Marking
More informationTitle: A novel mechanism of protein thermostability: a unique N-terminal domain confers
1 2 Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers heat resistance to Fe/Mn-SODs 3 4 Running Title: Thermostability-improving peptide for SODs 5 6 7 8 Authors Wei
More informationSupplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1
S1 of S8 Supplementary Materials: Localization and Spectroscopic Analysis of the Cu(I) Binding Site in Wheat Metallothionein Ec-1 Katsiaryna Tarasava, Jens Loebus and Eva Freisinger Figure S1. Deconvoluted
More informationBCMP 201 Protein biochemistry
BCMP 201 Protein biochemistry BCMP 201 Protein biochemistry with emphasis on the interrelated roles of protein structure, catalytic activity, and macromolecular interactions in biological processes. The
More informationA pentose bisphosphate pathway for nucleoside degradation in Archaea. Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto , Japan.
SUPPLEMENTARY INFORMATION A pentose bisphosphate pathway for nucleoside degradation in Archaea Riku Aono 1,, Takaaki Sato 1,, Tadayuki Imanaka, and Haruyuki Atomi 1, * 7 8 9 10 11 1 Department of Synthetic
More informationSupplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences
Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia
More informationIdentification and characterization of the missing terminal enzyme for siroheme biosynthesis in α-proteobacteria
Molecular Microbiology (2014) 92(1), 153 163 doi:10.1111/mmi.12542 First published online 13 March 2014 Identification and characterization of the missing terminal enzyme for siroheme biosynthesis in α-proteobacteria
More informationProtein assay. Absorbance Fluorescence Emission Colorimetric detection BIO/MDT 325. Absorbance
Protein assay Absorbance Fluorescence Emission Colorimetric detection BIO/MDT 325 Absorbance Using A280 to Determine Protein Concentration Determination of protein concentration by measuring absorbance
More informationSupplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases
Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3
More informationCSCE555 Bioinformatics. Protein Function Annotation
CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The
More informationTargeting protein-protein interactions: A hot topic in drug discovery
Michal Kamenicky; Maria Bräuer; Katrin Volk; Kamil Ödner; Christian Klein; Norbert Müller Targeting protein-protein interactions: A hot topic in drug discovery 104 Biomedizin Innovativ patientinnenfokussierte,
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationImproved 6- Plex TMT Quantification Throughput Using a Linear Ion Trap HCD MS 3 Scan Jane M. Liu, 1,2 * Michael J. Sweredoski, 2 Sonja Hess 2 *
Improved 6- Plex TMT Quantification Throughput Using a Linear Ion Trap HCD MS 3 Scan Jane M. Liu, 1,2 * Michael J. Sweredoski, 2 Sonja Hess 2 * 1 Department of Chemistry, Pomona College, Claremont, California
More informationA New Model for Asymmetric Amplification in Amino Acid Catalysis - Supporting information
A New Model for Asymmetric Amplification in Amino Acid Catalysis - Supporting information Martin Klussmann, Hiroshi Iwamura, Suju P. Mathew, David H. Wells, Urvish Pandya, Alan Armstrong and Donna G. Blackmond
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/4/e1600663/dc1 Supplementary Materials for A dynamic hydrophobic core orchestrates allostery in protein kinases Jonggul Kim, Lalima G. Ahuja, Fa-An Chao, Youlin
More informationBiological Sciences 11 Spring Experiment 4. Protein crosslinking
Biological Sciences 11 Spring 2000 Experiment 4. Protein crosslinking = C - CH 2 - CH 2 - CH 2 - C = H H GA Cl - H 2 N N H 2 Cl - C - CH 2 - CH 2 - CH 2 - CH 2 - CH 2 - CH 2 - C DMS CH 3 CH 3 N - - C -
More informationA catalase-peroxidase from a newly isolated thermoalkaliphilic Bacillus sp. with potential for the treatment of textile bleaching effluents
A catalase-peroxidase from a newly isolated thermoalkaliphilic Bacillus sp. with potential for the treatment of textile bleaching effluents Marinka Gudelj, Gilbert Otto Fruhwirth, Andreas Paar, Fritz Lottspeich,
More informationEnhancing hydrogen production of microalgae by redirecting electrons from photosystem I to hydrogenase
Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2014 Supplementary information for Enhancing hydrogen production of microalgae
More informationSupplementary Figure 1. Biochemical and sequence alignment analyses the
Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).
More informationIntroduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
More informationStructure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis
Structure and mechanism of an intramembrane liponucleotide synthetase central for phospholipid biosynthesis Xiuying Liu 1,3, Yan Yin 1,2,3, Jinjun Wu 1 and Zhenfeng Liu 1 1 National Laboratory of Biomacromolecules,
More informationFigure 2. Amino acid sequence alignment of L-carbamoylases. A BLAST search was conducted with BsLcar sequence, using the UNIREF100 sequence cluster
Figure 1. A) Simulated MIT MAP at 1.2 σ contours (blue), generated by shaking the coordinates using PDBSET from the CCP4 program suite [1], removing cacodylate molecule from the model, and refining 5 cycles
More informationUse of SEC-MALS. (Size Exclusion Chromatography - Multi Angle. Light Scattering) for protein quality and characterization
Use of SEC-MALS (Size Exclusion Chromatography - Multi Angle Light Scattering) for protein quality and characterization Methods for protein characterization Analytical SEC is a common method to characterize
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationGenomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
More informationPhylogenetic analysis of Cytochrome P450 Structures. Gowri Shankar, University of Sydney, Australia.
Phylogenetic analysis of Cytochrome P450 Structures Gowri Shankar, University of Sydney, Australia. Overview Introduction Cytochrome P450 -- Structures. Results. Conclusion. Future Work. Aims How the structure
More informationWe used the PSI-BLAST program (http://www.ncbi.nlm.nih.gov/blast/) to search the
SUPPLEMENTARY METHODS - in silico protein analysis We used the PSI-BLAST program (http://www.ncbi.nlm.nih.gov/blast/) to search the Protein Data Bank (PDB, http://www.rcsb.org/pdb/) and the NCBI non-redundant
More informationHomology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana
www.bioinformation.net Hypothesis Volume 6(3) Homology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana Karim Kherraz*, Khaled Kherraz, Abdelkrim Kameli Biology department, Ecole Normale
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationVibrational Stark Effect: Theory and Analysis. NC State University
Vibrational Stark Effect: Theory and Analysis NC State University Vibrational Stark Effect Surface effect on bound ligands (interfacial) CO on metal surfaces Electrostatic environment in a protein (matrix)
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2013. Supporting Information for Adv. Mater., DOI: 10.1002/adma.201301472 Reconfigurable Infrared Camouflage Coatings from a Cephalopod
More informationSupplemental Materials
JOURNAL OF MICROBIOLOGY & BIOLOGY EDUCATION, May 2013, p. 107-109 DOI: http://dx.doi.org/10.1128/jmbe.v14i1.496 Supplemental Materials for Engaging Students in a Bioinformatics Activity to Introduce Gene
More informationSUPPLEMENTARY EXPERIMENTAL PROCEDURES
SUPPLEMENTARY EXPERIMENTAL PROCEDURES Yeast two-hybrid assay The yeast two hybrid assay was performed according to described in Assmann (2006) [01] and was performed with the baits SCOCO (2-82) and SCOCO
More informationProject Manual Bio3055. Apoptosis: Caspase-1
Project Manual Bio3055 Apoptosis: Caspase-1 Bednarski 2003 Funded by HHMI Apoptosis: Caspase-1 Introduction: Apoptosis is another name for programmed cell death. It is a series of events in a cell that
More informationSupplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element
Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element as determined in a previous study 1. The log K value
More informationGrundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
More informationDiphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
More informationSUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state
SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationStructure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
More informationml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS
a UV28 absorption (mau) 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS β 2 AR-Gs complex dissociated complex excess nucleotides b 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex
More informationTiffany Samaroo MB&B 452a December 8, Take Home Final. Topic 1
Tiffany Samaroo MB&B 452a December 8, 2003 Take Home Final Topic 1 Prior to 1970, protein and DNA sequence alignment was limited to visual comparison. This was a very tedious process; even proteins with
More informationion mobility spectrometry IR spectroscopy
Debasmita Gho 29.10.2016 Introducti on Owing to its accuracy, sensitivity, and speed, mass spectrometry (MS) coupled to fragmentation techniques is the method of choice for determining the primary structure
More informationProtein quantification and detection methods
Protein quantification and detection methods 1) Spectroscopic procedures 2) Measurement of the total protein content by colorimetry 3) Amino acid analysis 4) Other methods, eg. radiolabelling of proteins,
More informationSupplemental Data. Gao et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector
More informationBIOINFORMATICS: An Introduction
BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and
More informationRex-Family Repressor/NADH Complex
Kasey Royer Michelle Lukosi Rex-Family Repressor/NADH Complex Part A The biological sensing protein that we selected is the Rex-family repressor/nadh complex. We chose this sensor because it is a calcium
More informationSupplementary Figure 1. Proposed mechanism for AusE, PrhA, and these mutants. (a) 5 is desaturated
S1 Supplementary Figure 1. Proposed mechanism for AusE, PrhA, and these mutants. (a) 5 is desaturated to form 6 through hydrogen atom abstraction at C-2 followed by the second hydrogen atom abstraction
More informationBIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total)
BIMS 503 Exam I September 24, 2007 _ /email: Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) Questions 1-6 refer to this situation: You are able to partially purify an enzyme activity
More informationSupplemental Data SUPPLEMENTAL FIGURES
Supplemental Data CRYSTAL STRUCTURE OF THE MG.ADP-INHIBITED STATE OF THE YEAST F 1 C 10 ATP SYNTHASE Alain Dautant*, Jean Velours and Marie-France Giraud* From Université Bordeaux 2, CNRS; Institut de
More informationSupplemental Data. Nayak et al. (2013). Plant Cell /tpc
Start - End Observed Mr(expt) Mr(calc) Delta Sequence 1 13 468.8413 1403.5020 1403.7330-0.2309 MPSLMLSDKKEEK.K 19-29 610.1743 1218.3341 1218.5802-0.2461 K.MLDTPELDSK.K 85-102 663.33433343 1986.98109810
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. The asymmetric unit in para-iodio-phenylalanine crystal. The 50% probability ellipsoid representation was prepared using the Mercury Software. Colors are as
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular Biology and Biochemistry Part I Time Allowed: 1 hour and 30 minutes
More informationSupplementary Information
Supplementary Information Adenosyltransferase Tailors and Delivers Coenzyme B 12 Dominique Padovani 1,2, Tetyana Labunska 2, Bruce A. Palfey 1, David P. Ballou 1 and Ruma Banerjee 1,2 * 1 Biological Chemistry
More informationComparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy),
Supporting Information 1. Constructing the starting structure Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy), we find that: the RMSD of overall structure and
More informationSupplemental Information. The Mitochondrial Fission Receptor MiD51. Requires ADP as a Cofactor
Structure, Volume 22 Supplemental Information The Mitochondrial Fission Receptor MiD51 Requires ADP as a Cofactor Oliver C. Losón, Raymond Liu, Michael E. Rome, Shuxia Meng, Jens T. Kaiser, Shu-ou Shan,
More informationSI Text S1 Solution Scattering Data Collection and Analysis. SI references
SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.
More informationSupplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27
Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27 A40 non-canonical pair stacked over the A41 (G1-C26) three-base
More informationS-SAD and Fe-SAD Phasing using X8 PROTEUM
S-SAD and Fe-SAD Phasing using X8 PROTEUM Kristina Djinovic Carugo Dept. for Structural and Computational Biology Max F. Perutz Labs Univ. Vienna, Austria Outline Fe-SAD on chlorite dismutase from Candidatus
More informationChapter 5. Partial purification of granule bound Pi-fA synthase
Chapter 5 Partial purification of granule bound Pi-fA synthase 5.1 INTRODUCTION The enzyme PHA synthase occurs inside the bacterial cells both, as soluble and granule bound form (Haywood et al., 1989).
More informationFast Protein and Peptide Separations Using Monolithic Nanocolumns and Capillary Columns
Application Note 3 Fast Protein and Peptide Separations Using Monolithic Nanocolumns and Capillary Columns INTRODUCTION Polymeric monolithic stationary phases offer an alternative to the classical microparticulate
More informationSupplementary Information for
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2015 Supplementary Information for The use of Ion Mobility Mass Spectrometry to assist Protein Design:
More informationSupporting Information
Supporting Information Mullins et al. 10.1073/pnas.0906781106 SI Text Detection of Calcium Binding by 45 Ca 2 Overlay. The 45 CaCl 2 (1 mci, 37 MBq) was obtained from NEN. The general method of 45 Ca 2
More informationDisaggregation of Amylin Aggregate by Novel Conformationally. Restricted Aminobenzoic Acid containing α/β and α/γ Hybrid.
Supporting Information Disaggregation of Amylin Aggregate by Novel Conformationally Restricted Aminobenzoic Acid containing α/β and α/γ Hybrid Peptidomimetics Ashim Paul 1, Sourav Kalita 1, Sujan Kalita
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationCISC 636 Computational Biology & Bioinformatics (Fall 2016)
CISC 636 Computational Biology & Bioinformatics (Fall 2016) Predicting Protein-Protein Interactions CISC636, F16, Lec22, Liao 1 Background Proteins do not function as isolated entities. Protein-Protein
More information