Effect of G15V and T20N Point Mutations of OsRacD from Oryza sativa on

Size: px

Start display at page:

Download "Effect of G15V and T20N Point Mutations of OsRacD from Oryza sativa on"

Brice Lamb
5 years ago
Views:

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology (9) : OsRacD G15 V T20 N 3,,,, (, ) OsRacD GTP Rho,,,., PCR, GTPase G15V T20N, GTP GDP OsRacD. CaMV35S ;,.,,,.,OsRacD 2., OsRacD G15V T20N,. OsRacD,,. OsRacD ; ; ; Q789 Effect of G15V and T20N Point Mutations of OsRacD from Oryza sativa on : ; : (No ), (No ) (No ) 3 Tel : ; E2mail edu. cn Received : January 16,2009 ; Accepted : June 17,2009 Supported by Key Project of Chinese Ministry of Education (No ), Fund of Henan Science Initiative (No ) and Basic Science Initiative Program of Henan Province (No ) Cellular Localization and Interaction with Target Proteins LIANG Wei2Hong 3 3 Corresponding author Tel : ; E2mail edu. cn, LIU Xiao2Fei, BI Jia2Jia, LΒ Chao2Hui, PENG Wei2Feng ( College of Life Sciences, Henan Normal University, Xinxiang , Henan, China) Abstract OsRacD belongs to rice Rho family small GTPases, which pivotally involved in the photoperiod fertility conversion of photoperiod2sensitive sterile rice by controlling the pollen tube growth. and influencing the rice fertility. To mimic the GTP2binding and GDP2binding state of OsRacD, G15V and T20N mutations within its GTPase domain were introduced by PCR2based site2directed mutagenesis. The GFP2fusions of wild2type and mutant were constructed under the control of the CaMV 35S promoter. The recombinant binary vectors were introduced into onion epidermal cells by Agrobacterium2mediated method. Fluorescence microscopy revealed that the wild2type OsRacD fusion protein were localized in the cytoplasm and cell membrane, the G15V mutant distributed almost exclusively at the cell membrane, while the T20N mutant were primarily concentrated in the perinuclear region. The yeast two2hybrid results showed that the binding targets of OsRacD and the mutants were different. This study demonstrated that G15V and T20N mutations of OsRacD not only changed the cellular localizations, but also affected the interactions with targets, suggesting that the GTPΠGDP2binding state of OsRacD is critical to trigger different cell responses. Key words OsRacD ; site2directed mutagenesis ; GFP ; protein interaction

2 9 : OsRacD G15V T20N 829 GTP Rho,, [1 ]. Rho GTP Rho, Rac Cdc42, Rho Cdc42 [2 ]. Rho GTP Rac [3,4 ]. Rho, [5 ],,Rho [6,7 ]., Rho GTP GDP 3 [8 ], GDP Rho (guanine nucleotide exchange factor, GEF), GTP,,. Rho GTP, GTP ( GTPase activated protein,gap) GTP GDP,. (guanine nucleotide dissociation inhibitor, GDI) Rho. OsRacD mrna Rho [9 ].,, 58S [10,11 ]., OsRhoGA Ps ( ) OsRhoGDIs [12 ]. OsRacD, PCR, G15V [13 ] T20N, OsRacD ( constitutive active, CA) (dominant negative, DN).,., OsRacD OsRhoGAPs OsRhoGDIs, OsRacD, OsRacD E. coli DH5 ( Agrobacterium tumef aciens ) EHA105 YRG22, pbd2wt pad2wt plamin C, pbd2gal42cam pbd2osracd2g15v pet2osracd pet2osracd2g15v [13 ],pcambia13022gfp, Pst Avr EcoR Sal, Taq DNA T4 DNA RNase A ; DNA DNA marker ; Clontech ; (As) SIGMA T20N pbd2osracd2t20n PCR, OsRacD GTP T20N, [13 ], Pf : (5 2AAGAACTGCA2 TGCTCATCTC 23 ) Pr : (5 2GAGATGAGCATGCAG2 TTCTT23 ), PCR P1 (5 2TTGAATTCA2 TGAG CGCGTCT CGGTTC23 ) P2 (5 2TTGTCGACT2 TACAAGATGGCACATCC23 ), EcoR Sal. PCR, EcoR Sal, pbd2gal42cam, BD, pbd2 OsRacD2T20N.., pet2 OaRacD pet2oaracd2g15v pbd2oaracd2t20n, Taq DNA, P3 (5 2TTCTGCAGATGAGCGCGTCTCGGTTC23 ) P4 (5 2 TTCCTAGGCAAGATGGCACATCCTTT23 ) OsRacD Pst Avr., Pst Avr, pcambia13022gfp, pcambia13022 OsRacD2GFP pcambia13022osracd2g15v2gfp pcam2 BIA13022OsRacD2T20N2GFP , pcambia13022osracd2gfp pcambia13022osracd2g15v2gfp, pcambia13022 OsRacD2T20N2GFP EHA105, YEB ( 50 mgπl Rif 100 mgπl Kan),28 3 d, PCR

830 25 YEB,28. 4 000 rπmin 10 min, 1Π2 MS. 1 50 20 molπl As 50 ml YEB. 200 rπmin, 28,,5 000 rπmin 5 min, 10 mmolπl MgCl 2 20 molπl As YEB.,, 1 cm 2,,, 1Π2 MS.

11216, pbd2osracd pbd2osracd2g15v pbd2osracd2t20n YRG22, SDΠ2 Trp, pad2osrhogdi1 pad2osrhogdi2 [12 ] pad2 OsRhoGAP1 pad2osrhogap2 3, SDΠ2Trp2Leu2His, filter lift assay 2. Fig.

3 YEB, rπmin 10 min, 1Π2 MS molπl As 50 ml YEB. 200 rπmin, 28,,5 000 rπmin 5 min, 10 mmolπl MgCl 2 20 molπl As YEB.,, 1 cm 2,,, 1Π2 MS h, 30 min,, 1Π2 MS 25 2 d, 16 h Π8 h ,, (Nikon Ti2U), 480 nm, Nis2 Elements AR , pbd2osracd pbd2osracd2g15v pbd2osracd2t20n YRG22, SDΠ2 Trp, pad2osrhogdi1 pad2osrhogdi2 [12 ] pad2 OsRhoGAP1 pad2osrhogap2 3, SDΠ2Trp2Leu2His, filter lift assay 2. Fig. 1 Identification of pbd2osracd2t20n by restriction digestion M: DNA marker DL2000 ; 1 : pbd2osracd2 T20N digested by EcoR ΠSal. The arrow represents insert gene OsRacD T20 N PCR, OsRacD GTP T20N, GDP. pbd2osracd2t20n ( Fig. 1), bp, OsRacD Fig. 2 Identification of GFP fused binary expression vectors by restriction digestion M:DNA marker DL2000 ; 1 :pcambia13022osracd2gfp digested by Pst ΠAvr ; 2 : pcambia13022osracd2g15v2gfp digested by Pst ΠAvr ; 3 : pcambia13022osracd2t20n2gfp digested by Pst ΠAvr. The arrow represents insert gene 594 bp,, 20 ACC AAC. 212 PCR, OsRacD G15V2OsRacD T20N2OsRacD cdna Pst Avr, pcambia13022gfp, GFP, CaMV35S [14,15 ]. GFP OsRacD 2 C,.,, GFP CaMV 35S., GFP ( Fig. 3A),. OsRacD ( Fig. 3B), pcambia13022osracd2gfp OsRacD ( Fig. 3C), pcambia13022osracd2g15v2gfp, pcambia13022 OsRacD (Fig. 3D). OsRacD2 T20N2GFP. Fig GFP, GFP 214 OsRacD GTP,OsRacD 2, GDP

Agrobacterium2 mediated method, and the pictures were taken by a fluorescence microscope (excitation at 480 nm and emission > 515 nm).

4 9 : OsRacD G15V T20N 831 Fig. 3 Localization of GFP2fusion proteins expressed in onion epidermal cells GFP and the GFP2fusion proteins were expressed transiently in onion epidermal cells 24 hours after transformed by Agrobacterium2 mediated method, and the pictures were taken by a fluorescence microscope (excitation at 480 nm and emission > 515 nm). The following proteins were expressed under the control of the CaMV 35S promoter. (A) Images of GFP expression vector ; (B) Images of OsRacD2GFP expression vector ; ( C) Images of OsRacD2G15V2GFP expression vector ; (D) Images of OsRacD2T20N2GFP expression vector GTP. GTP G, [16,17 ]. OsRacD OsRacD, OsRacD G15V2 OsRacD T20N2OsRacD OsRhoGDIs OsRhoGAPs. Fig. 4, Leu, Trp, His 2, OsRacD 2 OsRhoGDIs, 2 OsRhoGAPs ; G15V OsRacD OsRhoGDIs OsRhoGAPs ; T20N OsRacD OsRhoGDIs OsRhoGAPs, OsRhoGDIs Fig. 4 Identification of protein2protein interaction in yeast two2hybrid system The GAL4 DNA2 binding domain vector (BD) was fused to OsRacD, OsRacD2G15V and OsRacD2T20 N,respectively. The GAL4 transcription activation domain vector (AD) was fused to OsRhoGDIs and OsRhoGAPs, respectively. The baits (pbd plasmids) and targets (pad plasmids) were co2 transformed into Saccharomyces cerevisiae YRG221 Cotransformants selected on SD2Trp2Leu2His (2LTH) mediums were then performed 2galactosidase activitives analysis. After incubating for 4 days at 30, the colonies on each plate were transferred to sterile filter papers by placing the filter on the plate, ensure the filter contact all the colonies. Then the filter papers with colony side up were freezed in liquid nitrogen and thawed at room temperature for three thimes, and placed on the filter paper soaked in the Z buffer with X2gal, incubated at 25 for 3 hours. The graphs on the left indicate the growth conditions of cotransformants on 2LTH and the right indicate the result of 2galactosidase assay corresponding to the left. The positive control was cotransformants harbored pad2wt and pbd2wt vector ; the negative control was cotransformants harbored plamin C and pad2wt vectors

5 OsRhoGAPs OsRacD, OsRacD, OsRacD OsRhoGDIs, OsRhoGAPs, OsRacD. 3,, [18 ]. OsRacD,, AtROP2 [19 ], G15V2OsRacD [13 ] ingh T20N2OsRacD. GTP, G15V2OsRacD GTP [13 ], T20N GTP ( ), G15V T20N OsRacD GTP GDP., G 2 :,, GTP GEF. OsRacD GFP, CaMV 35S,,,,, OsRacD,., GTP,G. GDP,., OsRacD,. OsRacD 2 OsRhoGDIs OsRhoGAPs,OsRhoGAPs OsRacD, OsRacD ;OsRhoGDIs OsRacD, OsRhoGDIs OsRacD,, OsRacD,,, OsRhoGDIs [12 ] ; OsRacD OsRhoGDIs OsRhoGAPs,. GFP., OsRacD OsRhoGDIs OsRhoGAPs., FRET. ( References) [ 1 ] Etienne2Manneville S, Hall A. Rho GTPases in cell biology [J ]. Nature,2002, 420 (6916) : [ 2 ] Takai Y, Sasaki T, Matozaki T. Small GTP2binding proteins [J ]. Physiol Rev,2001,81 (1) : [ 3 ] Winge P, Brembu T, Bones AM. Cloning and characterization of Rac2like cdnas from Arabidopsis thaliana[j ]. Plant Mol Biol,1997, 35(4) : [ 4 ] Vernoud V, Horton AC, Yang Z, et al. Analysis of the small GTPase gene superfamily of Arabidopsis[J ]. Plant Physiol,2003,131 (3) : [ 5 ] Kost B. Spatial control of Rho ( Rac2Rop) signaling in tip2growing plant cells[j ]. Trends Cell Biol,2008,18 (3) : [ 6 ] Yang Z, Fu Y. ROPΠRAC GTPase signaling[j ]. Curr Opin Plant Biol,2007, 10(5) : [ 7 ] Yang Z. Cell polarity signaling in Arabidopsis[J ]. Annu Rev Cell Dev Biol,2008, 24 : [ 8 ] Yang Z. Small GTPases : versatile signaling switches in plants[j ]. Plant Cell,2002,14(Supple) : [ 9 ],,. GTP OsRacD [J ]. ( Mi Z Y, Wang S S,Wu N H. Isolation of OsRacD gene encoding a small GTP2binding protein from rice[j ]. Chin Sci Bull),2002,45(19) : [10 ],,. osracd [J ]. ( Ye J R, Huang M J, Wu N H. Fertility analysis of the Arabidopsis transformed with antisense rice osracd gene[j ], Prog Nat Sci),2003,13 (3) : [11 ],,,. OsRacD. ( Ye J R, Huang M J, Wu N H. et al. The correlation analysis of the expression of OsRacD and rice photoperiod fertility transition[j ]. Prog Nat Sci), 2004,14 (2) : [12 ],,. GDP [ J ]. ( (Liang W H, Tang C R, Wu N H. Isolation and characterization of two GDP dissociation inhibitors from Oryza sativa L [ J ]. Biochem Mol Biol ),2004, 20(6) : Chin J [13 ],. G15V OsRacD [J ]. (Liang W H, Wu N H. Effects of G15V point mutation on functions of rice OsRacD

6 9 : OsRacD G15V T20N 833 protein[j ]. Chin J Biochem Mol Biol ),2006,22( 4) : [14 ] Chiu W, Niwa Y, Zeng W. et al. Engineered GFP as a vital reporter in plants [J ]. Curr Biol, 1996, 6(3) : [15 ] Haseloff J, Siemering K R, Prasher D C. et al. Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly[j ]. Proc Natl Acad Sci USA,1997,94(6) : [16 ] Bishop A L, Hall A. Rho GTPases and their effector proteins[j ]. Biochem J, 2000,348(Pt 2) : [17 ] Van Aelst L, D souza2schorey C. Rho GTPases and signaling net2 works[j ]. Genes Dev,1997,11(18) : [18 ] Ling M M, Robinson B H. Approaches to DNA mutagenesis : An overview[j ]. Anal Biochem,1997,254 (2) : [19 ] Li H, Shen J J, Zheng Z L, et al. The Rop GTPase switch controls multiple developmental processes in Arabidopsis[J ]. Plant Physiol, 2001, 126 (2) : (, ) , 214,1 835,16 ( ) : 21,, DNA,, :,,, ; ; ; ( ), 2000,,,2005,, , ( 843 )

A Genome-Wide Analysis of Arabidopsis Rop-Interactive CRIB Motif Containing Proteins That Act as Rop GTPase Targets

The Plant Cell, Vol. 13, 2841 2856, December 2001, www.plantcell.org 2001 American Society of Plant Biologists A Genome-Wide Analysis of Arabidopsis Rop-Interactive CRIB Motif Containing Proteins That