Complementary and dose-dependent action of AtCCS52A isoforms in endoreduplication and plant size control

Transcription

1 Research Complementary and dose-dependent action of AtCCS52A isoforms in endoreduplication and plant size control Mikhail Baloban 1 *, Marleen Vanstraelen 1,4 *, Sylvie Tarayre 1 *, Christophe Reuzeau 2, Antonietta Cultrone 1, Peter Mergaert 1 and Eva Kondorosi 1,3 * 1 Institut des Sciences du Vegetal, Centre National de la Recherche Scientifique, UPR2355, Avenue de la Terrasse, 91198, Gif-sur-Yvette Cedex, France; 2 CropDesign N.V., a BASF Plant Science Company, Technologiepark 3, B-9052, Zwijnaarde, Belgium; 3 Biological Research Centre of the Hungarian Academy of Sciences, Temesvari krt 62, 6726, Szeged, Hungary; 4 VIB Department of Plant Systems Biology, Ghent University, Technologiepark 927, 9052, Ghent, Belgium Authors for correspondence: Eva Kondorosi Tel: eva.kondorosi@isv.cnrs-gif.fr Marleen Vanstaelen Tel: mastr@psb.vib-ugent.be Received: 11 December 2012 Accepted: 4 February 2013 doi: /nph Key words: anaphase-promoting complex (APC), CDH1, cell size, endoreduplication, organ size. Summary The dimension of organs depends on the number and the size of their component cells. Formation of polyploid cells by endoreduplication cycles is predominantly associated with increases in the cell size and implicated in organ growth. In plants, the CCS52A proteins play a major role in the switch from mitotic to endoreduplication cycles controlling thus the number of mitotic cells and the endoreduplication events in the differentiating cells. Arabidopsis has two CCS52A isoforms; AtCCS52A1 and AtCCS52A2. Here we focused on their roles in endoreduplication and cell size control during plant development. We demonstrate their complementary and dose-dependent actions that are dependent on their expression patterns. Moreover, the impact of CCS52A overexpression on organ size in transgenic plants was dependent on the expression level; while enhanced expression of the CCS52A genes positively correlated with the ploidy levels, organ sizes were negatively affected by strong overexpression whereas milder overexpression resulted in a significant increase in the organ sizes. Taken together, these finding support both complementary and dose-dependent actions for the Arabidopsis CCS52A isoforms in plant development and demonstrate that elevated ectopic CCS52A expression positively correlates with organ size, opening a route to higher biomass production. Introduction The exponentially growing human population requires a significant increase in food supply and primarily a raise in plant production. The size of organs and whole plants is controlled genetically. However, this control allows relatively flexible variations in plant growth where enlarged organ sizes could contribute to an increase in plant biomasses. The mass of an organ is defined by the number and the size of its cells. The cell number depends on the mitotic activity of the organ meristems while plant cell growth can be achieved by cell expansion and by formation of polyploid cells. Cell expansion is regulated primarily at the level of cell wall synthesis and coupled with the production of large vacuoles. By contrast, polyploid cells are generated by one or several rounds of genome doublings via endoreduplication, or endoreplication (ER), cycles resulting in larger nuclear and cell volumes. Polyploidy is frequent in angiosperms which have characteristic inherited patterns in different species resulting in specific stages and tissues during plant development (Kondorosi & Kondorosi, 2004; De Veylder et al., 2011). It can contribute *These authors contributed equally to this work. to development of highly specialized cells as multiple gene copies and lack of chromosome condensation might lead to increased or altered transcriptional and metabolic activities. ER derives from the mitotic cell cycle by inhibition of mitosis while duplication of the genome by DNA synthesis occurs repeatedly. It is believed that endocycles operate with the same machinery as the mitotic cycles except that the M-phase is omitted by inactivation of mitotic cyclin-dependent kinase (CDK) activities (De Veylder et al., 2011). The lack of M-phase provokes a short cut in the cell cycle as after genome doubling in S-phase and a Gap period, the cells enters the S-phase again. Thus, from diploid cells having 2C or 4C DNA content (C: haploid DNA content) before and after S-phase, consecutive ER cycles generate 8C, 16C, 32C and so forth cells with increased cell sizes proportional to the nuclear volumes (Kondorosi & Kondorosi, 2004). The switch from mitotic to ER cycles defines the ratio of diploid and polyploid cells and thus can be a major determinant of organ size. Therefore, there is increasing interest in ER both in respect to fundamental and applied research (De Veylder et al., 2011). Inhibition of cell division and mitotic CDK activities can be achieved by multiple mechanisms (Sauer & Lehner, 1995; Joubes & Chevalier, 2000; Edgar & Orr-Weaver, 2001; Beemster et al., 1049

2 1050 Research New Phytologist 2005; De Veylder et al., 2007, 2011). One of them is the degradation of mitotic cyclins by the Anaphase-Promoting Complex or Cyclosome (APC/C; Sigrist & Lehner, 1997; Cebolla et al., 1999). The APC/C is an E3 ubiquitin ligase complex that promotes polyubiquitination of target proteins, leading to their degradation by the 26S proteasome (Harper et al., 2002; Buschhorn & Peters, 2006). APC/C controls cell cycle progression from the M-phase to the S-phase and leads to the degradation of various cell cycle proteins. Stage-specific activation of the APC/C, as well as selection and binding of the APC/C substrates are defined by the APC/C activator WD40-repeat proteins CDC20 and CDH1 which act consecutively in the cell cycle and differ in their substrate specificity. The nomenclature for CDH1- type APC/C activators is variable: CDH1 is used in budding yeast and humans, FZR in Drosophila, SRW1 in fission yeast and CCS52 in plants. These proteins are central players for ER control in fission yeast (Yamaguchi et al., 1997), Drosophila (Sigrist & Lehner, 1997) and plants (Cebolla et al., 1999). CCS52A was first identified in Medicago species and was named after its Cell Cycle Switch function as it provokes mitotic cyclin degradation, cell cycle exit and the transition from mitotic to endocycles. In Medicago species such as the cultivated alfalfa (Medicago sativa) or the model plant Medicago truncatula, the CCS52A gene is expressed in the shoot and root apices and during the early developmental stages of various organs (Cebolla et al., 1999; Vinardell et al., 2003; Tarayre et al., 2004). In leaf petioles and root nodules, CCS52A is required for ER-associated cell growth which is essential in root nodules for symbiotic cell differentiation (Cebolla et al., 1999; Vinardell et al., 2003) and implicated in giant cell formation in the case of root knot nematode infection (Favery et al., 2002). Similarly, SlCCS52A also regulates ER in tomato fruit with an impact on the fruit size (Mathieu-Rivet et al., 2010). In contrast to yeasts and animals, plants also possess a plantspecific CCS52B gene and often multiple isoforms of the APC/C activators. Arabidopsis has five CDC20 gene copies (Kevei et al., 2011) and two copies of the CCS52A gene, AtCCS52A1 and AtCCS52A2 (F ul op et al., 2005). The Arabidopsis CCS52A1 and CCS52A2 proteins are 83% identical and the genes are co-expressed in synchronized cell cultures from late M until the G2-phase of the cell cycle, suggesting that two AtCCS52A isoforms may have redundant cell cycle functions (F ul op et al., 2005). Introduction of either of the AtCCS52A genes provoked endoreduplication and cell enlargement in fission yeast, however, leading to different cell morphologies. The yeast cells were largely elongated and branched by the expression of AtCCS52A1, but only elongated by AtCCS52A2 (F ul op et al., 2005) indicating that the function of the two genes, at least in this heterologue system, is not identical. By contrast, in Arabidopsis the ccs52a2 mutant could be complemented with the CCS52A1 gene expressed from the CCS52A2 promoter suggesting an identical protein function (Vanstraelen et al., 2009). Distinct contribution of AtCCS52A1 and AtCCS52A2 has been demonstrated in the maintenance of Arabidopsis root meristem (Vanstraelen et al., 2009) showing that AtCCS52A1 stimulates ER and mitotic exit at the root meristem-elongation zone border while AtCCS52A2 controls identity of the quiescent centre (QC) and stem cell maintenance. This study revealed also that the functional specificities arise from distinct promoter activities of the AtCCS52A genes. The involvement of AtCCS52A1 in ER and cell expansion in Arabidopsis leaves and particularly in trichome cells has been reported by Larson-Rabin et al. (2009), Li et al. (2009), and Kasili et al. (2010). However, knowledge on the contribution of the two AtCCS52A isoforms to the development of a given organ or to different stages of plant development has remained largely incomplete. The present paper studies and describes the expression pattern of the AtCCS52A1 and AtCCS52A2 genes during plant development by promoter-marker gene fusions and characterization of the ccs52a knock-out mutants, CCS52A RNAi and CCS52A overexpressing lines. We show the influence of CCS52A gene dosages on somatic ploidy and cell size using Arabidopsis leaves and the unicellular branched polyploid hair cells, the trichomes as models. We demonstrate that the impact of CCS52A overexpression on organ sizes depends on the promoter activity. Strong overexpression resulted in higher ploidy levels but smaller organs while milder overexpression resulted in lower ploidy levels but significantly larger organs, opening a route to higher biomass production. Materials and Methods Plant material Arabidopsis thaliana (L.) Heynh ecotype Columbia was used as wild-type in this study. Mutant lines were ccs52a1-2 and ccs52a1-5 (Garlick Syngenta lines G797 and G510, respectively) and ccs52a2-1 (SALK line ). The ccs52a1-2 and ccs52a1-5 lines were indistinguishable in all our analyses. In figures, data are shown for the ccs52a1-5 allele except when specified otherwise. Crosses were made between the ccs52a2-1 and ccs52a1-5 lines and the genotype of the descendants was determined by PCR analysis. The ccs52a RNAi as well as the AtCCS52A1-GUS/GFP and AtCCS52A2-GUS/GFP lines were described by Vanstraelen et al. (2009). Overexpression of HA-AtCCS52A1 and HA-AtCCS52A2 from the 35S cauliflower mosaic virus promoter was achieved by transferring the HA-CCS52A cassette (HA tag sequence in frame with the coding sequence of either AtCCS52A1 or AtCCS52A2) onahindiii fragment from the prt-3ha vector (F ul op et al., 2005) into the pgreenii vector. For transformation of A. thaliana with UBI::AtCCS52A1, AtCCS52A1 was PCR amplified from cdna using primers forward (5 -GGGGACAAGTTTGTACAAAAAAGCAGGCTTCA CAATGGAAGAAGAAGATCCTACAGC-3 ) and reverse (5 - GGGGACCACTTTGTACAAGAAAGCTGGGTTTCTCACC GAATTGTTGTTCTAC-3 ). This fragment was cloned into the Gateway pdonr201 vector following the protocol of the supplier (Invitrogen) and verified by sequence analysis. The entry clone was subsequently used in an LR recombination reaction with the destination vector, p0712, a plant binary transformation vector carrying the T-DNA borders and a BASTA resistance

3 New Phytologist Research 1051 selectable marker. Constitutive expression of AtCCS52A1 was provided by the sunflower ubiquitin promoter located upstream of the Gateway cassette resulting in UBI::AtCCS52A1. All constructs were transferred into the Agrobacterium tumefaciens C58C1RifR strain used for stable transformation of A. thaliana with the floral dip transformation method (Clough & Bent, 1998). Sterile seeds were grown on half-strength Murashige and Skoog medium, 1% sucrose and 0.8% agar on square Petri dishes or in soil at 16 h light : 8 h dark photoperiod at 22 C. cleared by incubation in an 8 : 3 : 1 mixture of choral hydrate : distilled water : glycerol. Imaging was carried out as above. Surface areas in mesophyll and epidermal cells were determined using ImageJ software (NIH, USA). For scanning electron microscopy (S-3000; Hitachi, Krefeld, Germany), leaves were mounted directly. Samples were slowly frozen at 18 C on the Peltier stage, and then observed under a partial vacuum with the ESED mode Environmental Secondary Electron Detector (90 Pa, 12 kv). qrt-pcr analysis Total RNA isolated from rosette leaves of glasshouse grown plants with the RNeasy Mini Kit (Qiagen) was used as template for first-strand cdna synthesis with the RevertAid First Strand cdna Synthesis kit from Fermentas, according to manufacturer s instructions. Real-time qrt-pcr reactions were performed using the LightCycler480 SYBR Green I Master Kit on a LightCycler480 apparatus according to the manufacturer s instructions (Roche). Cycling conditions were as follows: 95 C for 10 min, 40 cycles at 95 C for 5 s, 60 C for 5 s, and 72 C for 15 s. Dissociation kinetic analysis of the amplification products confirmed that only the expected products were amplified. A negative control without cdna template was always included for each primer combination. Data represent mean values of three technical replicates on three independent biological repeats, and were calculated as the quantification of specific PCR amplification products normalized to ACT2 (At3 g18780), or in addition also for PPA2 (At1 g13320) and Expressed protein (At4 g26410) described by Czechowski et al. (2005). Primers for CCS52A1 were Forward: CGGTCACACATACCGAGTCTT and Reverse: GTTCTGAGATTTTGGGGAAGG and for CCS52A2 Forward: CAGACAATTGTGACAGGAGCA and Reverse: CTCA AGATGTCACCGGATTGT. Primers for the reference genes are in the Supporting Information Table II of Czechowski et al. (2005). Flow cytometry The nuclear DNA content was measured according to (Cebolla et al., 1999) on the Cell Biology Platform of Imagif, using a Partec CyFlow SL3 cytometer and the FlowMax software (Partec, Münster, Germany). Histology and microscopy b-glucuronidase activity in transgenic marker lines was visualized by staining 2 16 h in 2 mm X-gluc in 0.2% Triton X-100, 0.5 2mM K 4 Fe(CN) 6, 0.5 2mM K 3 Fe(CN) 6 and 50 mm sodium phosphate buffer, ph 7.2 at 37 C according to Weigel & Glazebrook (2002). Preparations were imaged with a Reichert Polyvar fluorescence microscope (Reichert-Jung AG, Vienna, Austria) or Nikon AZ100 Multizoom Microscope with a Nikon camera (Nikon, Champigny-sur-Marne, France). For microscopic observation of epidermal and mesophyll cells and of embryo development, leaves and seeds (respectively) were Western blot analysis Anti-AtCCS52A1 and Anti-AtCCS52A2 antibodies were raised in rabbit using the synthetic peptide QSQSPSPSSLSRSIC for AtCCS52A1 or EEDESTTPKKKSDSC for AtCCS52A2 (Genscript, Piscataway, NJ, USA). The polyclonal antibodies were purified against the synthetic peptides. Protein extracts prepared from 4-d-old seedlings in extraction buffer (F ul op et al., 2005) were separated with SDS-PAGE and Western Blotting, using anti-atccs52a1 or anti-atccs52a2 antibodies in 1 : 500 dilution or the monoclonal mouse anti-ha antibody (clone 3F10; Roche) in 1 : dilution. Secondary antibodies were goat anti-rabbit (A0545; Sigma) and sheep anti-mouse (A-5906; Sigma), used at 1 : and 1 : dilutions, respectively. Results AtCCS52A1 and AtCCS52A2 have dynamic and mostly complementary expression patterns The expression of AtCCS52A1 and AtCCS52A2 during plant development was studied in transgenic plants carrying the b-glucuroronidase reporter gene (GUS) under control of the AtCCS52A1 or AtCCS52A2 promoter described by Vanstraelen et al. (2009). These translational reporter constructs, where the GUS was fused to the 2nd exon of the AtCCS52A genes, expressed similarly in the root as GFP fused C-terminal to the entire genomic region of AtCCS52A1 or AtCCS52A2 comprising the same promoter region, which complemented the ccs52a phenotype confirming thereby accurate expression of the reporter constructs (Vanstraelen et al., 2009). Forty independent lines were isolated and characterized for both CCS52A. The vast majority of the lines exhibited similar expression profiles. Two days after germination (DAG), the AtCCS52A1::GUS staining was detectable at the meristem-elongation zone border and in the cell files of the root elongation zone (EZ) without detectable expression in aerial parts of the seedlings (Fig. 1a). At the same developmental stage, AtCCS52A2 was expressed in the root tip but it was predominant and very strong in the cotyledons (Fig. 1h). This strong expression in the cotyledon had, however, drastically faded by 10 DAG (Fig. 1i). Faint expression of both genes became apparent in the young emerging rosette leaves and in stipules (paired leaf-like structures at the base of leaves) with more restricted implication of AtCCS52A2 in the initial phase of leaf development (Fig. 1b,c,i,j). The expression of both genes

4 1052 Research New Phytologist (a) (b) (c) (d) (e) (f) (g) (h) (i) (j) (k) (l) (m) (n) (o) (p) (q) (r) Fig. 1 Expression of AtCCS52A1 and AtCCS52A2 during plant development. GUS expression driven by the AtCCS52A1 promoter (a g, o, p) and the AtCCS52A2 promoter (h n) 2 d after germination (DAG) (a, h) and 10 DAG Arabidopsis thaliana seedlings (b, c, i, j), cauline leaves (d, k), in flowers (e, l), anthers (f, m), developing seeds (g, n), leaf (o) and stem (p) trichomes. Asterisks (b, i) indicate the expression in the cotyledons; arrows (c, j) the stipules and the arrowhead (f) denotes the anther tapetum. Bars,1 mm (a e, g, h l, n), 100 lm (f, m, o, p). (q) Detection of translational fusion of GFP with AtCCS52A1 (A1-GFP) and AtCCS52A2 (A2-GFP) in Arabidopsis leaves reveals only the expression of AtCCS52A1 in the trichomes (white arrowheads). (r) GENEVESTIGATOR developmental summary of AtCCS52A1 and AtCCS52A2 expression from microarray data. Developmental stages and tissues were: (1) germinated seed, (2) seedling, (3) young rosette, (4) developed rosette, (5) bolting plants, (6) young flower, (7) developed flower, (8) flowers and siliques, and (9) mature siliques.

5 New Phytologist Research 1053 decayed with leaf maturation suggesting a function for both of them in cell differentiation. In developed plants, expression of AtCCS52A1 was detectable in the young growing cauline leaves (Fig. 1d,k). In flowers, both AtCCS52A1 and AtCCS52A2 were expressed in the anthers but AtCCS52A1 in the early and AtCCS52A2 in later stages of anther development (Fig. 1e,l). Not only the temporal, but also the spatial expression patterns of the two genes differed inside the anther, as AtCCS52A1 was expressed in the tapetum (Fig. 1f) whereas AtCCS52A2 was mostly and very strongly expressed in the pollen grains (Fig. 1m). Both genes were active in maturing seeds, AtCCS52A1 with stronger and AtCCS52A2 with weaker expression (Fig. 1g,n). Only CCS52A1 and not CCS52A2 was expressed in trichomes and hair cells on the stem (Fig. 1o,p). The sole expression of CCS52A1 in the trichomes was also confirmed in the AtCC52A1: A2::GFP transgenic plants (Fig. 1q). In summary, AtCCS52A1 and AtCCS52A2 are expressed in a subset of the differentiating tissues of plant organs where their expression is temporally and spatially regulated and complement each other. This complementary way of expression of the two CCS52A genes during plant development is also supported by the GENEVESTIGATOR data which show that an increase in CCS52A1 expression correlates usually with a decrease in CCS52A2 gene expression or vice versa (Fig. 1r). Mutations and overexpression of the CCS52A genes lead to different abnormalities in plant growth and development The functional characterization of AtCCS52A1 and AtCCS52A2 was carried out with homozygous T-DNA insertion mutants and using transgenic lines either with downregulated expression of these genes with RNA interference or by overexpressing their HA-tagged version from the 35S promoter (Fig. 2). In the ccs52a1 mutants, the size of vegetative organs and their development rate were similar to wild-type (WT) plants (Vanstraelen et al., 2009; Fig. 2a,b). This raised the possibility that the macroscopically WT-like phenotype of the ccs52a1 mutants is due to upregulation of the other, AtCCS52A2 isoform. Therefore, we (a) (b) (c) (d) (e) (f) (g) (h) (i) (j) Fig. 2 Comparative characteristics of ccs52a T-DNA mutant plants, overexpressors and RNAi lines. Phenotypical characteristics of ccs52a2 mutants. (a) Arabidopsis thaliana rosette stage of ccs52a mutant, overexpressor and RNAi lines. (b) Flowering stage of ccs52a mutant, overexpressor and RNAi lines. (c) Reduced inflorescence of ccs52a2 (a2) mutants in comparison to WT and ccs52a1 (a1) mutants. Bar, 1 mm. (d) Abnormal pollen formation in ccs52a2 mutants. (e) AtCCS52A1 and AtCCS52A2 were overexpressed in plants with a hemagglutinin (HA) tag from the 35S promoter. The images show an immunoblot of WT, AtCCS52A1 (HA-A1) and AtCCS52A2 (HA-A2) overproducing lines using the gene specific anti-atccs52a1/anti-ha (left panel) and anti-atccs52a2/anti-ha (right panel) antibodies. The bars indicate the position of a 47.5 kda molecular weight standard on the SDS-PAGE gel. (f) Comparison of WT, ccs52a1 and ccs52a2 mutant siliques. Bar, 1 cm. (g) ccs52a2 mutant silique with aborted seeds (arrows). (h) WT seeds with embryo, (i) normal seeds of ccs52a2 mutants, (j) aborted seeds of ccs52a2 mutants. Arrowhead indicates embryo.

6 1054 Research New Phytologist measured the expression of AtCCS52A2 with qrt-pcr in the third rosette leaves of WT and ccs52a1 mutant plants but detected no upregulation of AtCCS52A2 (Supporting Information Fig. S1). Using three genes for normalization, two of them, PPA2 and Expressed Protein, resulted in equal AtCCS52A2 transcript levels in the WT and the ccs52a1 mutant while with ACT2 the AtCCS52A2 transcript levels were lower than in WT pointing to the importance of reference genes in normalization of gene expression. The ccs52a2 mutant showed, by contrast, drastic phenotypic alterations as they were small plants with reduced size of roots (Vanstraelen et al., 2009), shoots and leaves (Fig. 2a,b). Compared to WT plants or the ccs52a1 mutants, in the ccs52a2 mutants the inflorescence was less dense (Fig. 2c), a proportion of the pollen grains were shriveled, irregularly shaped or aborted (Fig. 2d), and the siliques were shorter (Fig. 2f) and only partially filled with seeds (Fig. 2g). In the ccs52a2 mutants the aborted seeds contained no embryo (Fig. 2j) in contrast to the normally developed seeds (Fig. 2i) or the WT ones (Fig. 2h). Similarly to the ccs52a2 mutants, downregulation of CCS52A2 by RNA interference resulted in reduced plant growth and organ sizes (Fig. 2a, b). CCS52A2 was previously shown to regulate QC identity and stem cell maintenance in the root meristem but lack of its function also caused defects in the organization and maintenance of the shoot apical meristem, explaining the strong effects of loss of CCS52A2 function in root and shoot development (Vanstraelen et al., 2009). Overexpression of the AtCCS52A1 or AtCCS52A2 genes from the 35S promoter was verified with Western blot analysis (Fig. 2e). These plants did not show any phenotypic differences during the first week of growth while from the second week, the plant growth became retarded. Overexpression of either CCS52A1 or CCS52A2 provoked similar phenotypical alterations: the rosette leaves were smaller and reduced in number compared to WT plants (Fig. 2a,b) and the adult plants exhibited drastic decreases in their stem size. In the most severe cases, the inflorescence was set on a short stem close to the rosette leaves (Fig. 2b; 35S::CCS52A2). All vegetative organs of overexpressing plants were dark green or green-violet reflecting stress and anthocyanin production. In accordance with the reduced inflorescence, the seed number was drastically reduced in overexpressing lines. These results indicate that CCS52A genes are essential for proper plant development. Strong overexpression of either of the two genes, CCS52A1 or CCS52A2 or mutations in CCS52A2 disturbed plant development and resulted in growth and fertility abnormalities. AtCCS52A1 and AtCCS52A2 control endoreduplication and cell expansion during leaf development In Medicago species, CCS52A regulates the switch from the mitotic cell cycle to the endocycle (Cebolla et al., 1999; Vinardell et al., 2003). Given that both AtCCS52A1 and AtCCS52A2 are expressed in young rosette leaves, we studied how these genes contribute to leaf development. Leaf development in Arabidopsis comprises two consecutive stages; until d after germination (DAG), leaves grow mainly by cell proliferation, but thereafter the cell division rates decline abruptly and leaf growth continues mainly through ER driven cell expansion until mature leaf size is attained (Beemster et al., 2005, 2006). In mature rosette leaves of the ccs52a mutants, the ER was reduced resulting in altered endoploidy level (Fig. 3a). Loss of AtCCS52A1 caused an increase in the number of 8C nuclei, a reduction in 16C nuclei and an absence of 32C nuclei, indicating that AtCCS52A1 was dispensable from the 4C to 8C cycles but (a) (b) (c) (d) (e) (f) Fig. 3 AtCCS52A1 and AtCCS52A2 regulate endoreduplication and cell size during Arabidopsis thaliana rosette leaf development. (a) DNA ploidy distribution, (b) size of cells in the adaxial epidermis and mesophyll cell layers, (c) number of cells per unit leaf area (0.08 mm 2 ), (d) leaf area, (e) average cell number and (f) total cell number in the first pair of mature rosette leaves of WT plants, ccs52a1 (a1) and ccs52a2 (a2) mutants and transgenic lines that overexpress AtCCS52A1 (HA-A1) or AtCCS52A2 (HA-A2). Data represent average SD. Bar, 100 lm.

7 New Phytologist Research 1055 was required for the further ER cycles. Loss of AtCCS52A2 induced even stronger effects on endoploidy as there was a striking increase in the population of 4C nuclei with less 8C and almost no 16C nuclei. Hence, absence of AtCCS52A2 hampered mostly the mitotic to endocycle transition (from 4C to 8C) which is in agreement with the E2Fe/DEL1 controlled expression of CCS52A2 in leaves at the endocycle onset (Lammens et al., 2008). Compared to the knock-out mutants, overproduction of HA-tagged AtCCS52A proteins from the 35S promoter (HA-A1 and HA-A2) triggered an opposing positive effect on endoploidy by inducing more ER cycles (Fig. 3a). In the mature leaves, ploidy levels increased up to 64C in the case of HA-A1 and up to 128C for HA-A2 (Fig. 3a). Thus, AtCCS52A1 and AtCCS52A2 act as strong positive regulators of the endocycle in rosette leaves. In agreement with the ER phenotype, cell expansion was altered in the ccs52a mutant leaves. Epidermal cells at the adaxial side of the rosette leaf and mesophyll cells were smaller in the mutant backgrounds, whereas enlarged cells were found upon overexpression of either HA-AtCCS52A1 or HA-AtCCS52A2 (Fig. 3b). Accordingly, the number of cells per unit leaf area had increased in ccs52a1 and ccs52a2 mutant lines, but decreased in the overexpression lines (Fig. 3c). In spite of increased ploidy levels and larger cells in the HA-A1 and HA-A2 rosette leaves, their total leaf area was significantly reduced compared to WT plants and was similar to the ccs52a2 mutants (Fig. 3d). Even though the ccs52a1 plants were morphologically similar to WT plants, their leaf area was also reduced and more cells occupied the same surface area than in the WT, in line with the altered proportion of polyploid cells (Fig. 3a,d). The average cell area decreased to a lesser extent in the ccs52a1 than in the ccs52a2 mutants, while overexpression of either AtCCS52A1 or AtCCS52A2 increased the cell size (Fig. 3b,e). The total epidermal cell number was practically equal in the WT and ccs52a1 plants, but strongly reduced in the ccs52a2 mutants and even further decreased in the HA-A1 and HA-A2 lines (Fig. 3f). This indicates that expression of AtCCS52A1 and AtCCS52A2 from the 35S promoter induced a precocious switch from mitotic cycles to endocycles resulting in large cells but with a reduced cell number leading to a net reduction in leaf size. These data collectively show that both AtCCS52A1 and At- CCS52A2 are required and sufficient to induce ER during rosette leaf development, which sets the final cell and leaf size. Trichomes on the WT Arabidopsis leaf predominantly have three branches and 32C DNA content. Our expression studies demonstrated that only CCS52A1 is expressed in the trichome cells (Fig. 1o,p,q), indicating an exclusive role for AtCCS52A1 in controlling the ER cycles and branching in trichomes. Indeed, mutation in AtCCS52A1 but not in AtCCS52A2 altered thrichome branching. The trichomes on the WT and ccs52a2 leaves carried three branches (Fig. 4a,c), while the majority of trichomes on the ccs52a1 leaves had only two branches (Fig. 4b). By contrast, overexpression of either AtCCS52A1 or AtCCS52A2 induced the formation of four or more branches (Fig. 4d,e). Phenotype of the CCS52A overexpressing lines depends on the promoter activity Overexpression of the CCS52A genes from the 35S promoter induced endocycles and formation of larger cells. Nevertheless, the final size of organs and the entire plant was strikingly reduced. This raised the possibility that strong overexpression of the CCS52A genes may strongly perturb the normal functioning of meristems and the balance between mitotic and endocycles stimulating the latter ones. Therefore, we decided to test how overexpression of AtCCS52A genes from the milder constitutive ubiquitin (UBI) promoter (Holtorf et al., 1995) affects plant development. Because CCS52A1 and CCS52A2 acted similarly when they were expressed from the same promoters (Figs 3, 4; Vanstraelen et al., 2009; Kasili et al., 2010), we only generated transgenic Arabidopsis plants with the UBI::AtCCS52A1 construct. Several independent UBI:CCS52A1 lines exhibited vigorous growth and two of them, UBI5 and UBI19, were selected for (a) (b) (c) (d) (e) (f) Fig. 4 Trichome morphology in CCS52A mutant and overexpressing lines. Trichomes at the adaxial side of Arabidopsis thaliana rosette leaves of 3-wk-old WT (a), ccs52a1 (b), ccs52a2 (c), HA-A1 (d), HA-A2 (e) and UBI::CCS52A1 (UBI-A1) (f) plants. Bar, 100 lm.

8 1056 Research New Phytologist (a) (b) (c) (d) (e) (f) (g) (h) (i) (j) (k) Fig. 5 Phenotypical and cellular characteristics of UBI::CCS52A1 expressing plants. (a) Arabidopsis thaliana rosette stage, (b) caulin leaf, (c) radial stem section of WT and UBI:: AtCCS52A1 (UBI5) plants. (d) qrt-pcr analysis of the CCS52A1 expression in rosette (grey) and cauline (white) leaves demonstrates mild overexpression of the CCS52A1 in the UBI5 and UBI19 lines compared to WT plants and strong upregulation in HA-A1. (e) Cell sizes in the adaxial epidermis and mesophyll cell layers of cleared mature rosette and cauline leaves of WT and UBI5 plants. (f) Percentage of the total surface (Area%) occupied by cells of different sizes (lm 2 ) in rosette leaves of WT and UBI::CCS52A1 (lines Ubi5 and Ubi19) plants. (g) The ploidy levels and (h) size of rosette leaves. (i) Number of cells per unit leaf area (0.08 mm 2 ). (j) Average cell size and (k) estimated total cell number per leaf. Measurements were performed on WT plants, UBI5 and UBI19 lines. Data represent average SD. Bars, 300 lm (c), 100 lm (e). Arrows in (b) indicate the primary stem whose radial sections are shown in (c). detailed analysis. As shown for UBI5, they formed more and slightly larger rosette leaves than the WT plants (Fig. 5a). Later a significant increase in the size of cauline leaves was observed (Fig. 5b). The stems were also thicker and their microscopic analysis revealed an increase both in cell number and cell size without perturbation of patterning that was comparable to WT stems (Fig. 5c). In order to link these growth effects to CCS52A function we measured the CCS52A1 expression levels with qrt-pcr in the UBI::CCS52A1 lines UBI5 and UBI19 as well as in WT and 35S::CCS52A1 (HA-A1) plants (Fig. 5d). In the rosette leaves a c fold upregulation of CCS52A1 was detected in the UBI::CCS52A1 lines whereas in the case of the 35S promoter the increase was c. 5.6-fold. In the cauline leaves of UBI::CCS52A1 lines, the CCS52A1 transcript levels were also c fold higher than in WT. These qrt-pcr experiments thus confirmed overexpression of CCS52A1 from the UBI promoter that was, however, weaker than from the 35S promoter. We investigated the adaxial side of the first rosette leaves and measured the surface area of the epidermal and mesophyll cells in the UBI5 and UBI19 lines and in WT plants. Both cell types were notably larger in the UBI::AtCCS52A1 lines than in WT (Fig. 5e). Establishing distinct cell size categories from < 1000 up to lm 2, the cells in the smallest size categories (< 1000, < 1500, < 2000 lm 2 ) were the most abundant in the WT rosette leaf, whereas they were highly reduced in the UBI::AtCCS52A1 lines which contained a higher proportion of cells in the larger size categories (from 3000 to lm 2 ; Fig. 5f). Measuring the DNA content of nuclei isolated from WT and UBI:: AtCCS52A1 rosette leaves revealed a correlation between the cell size and the ploidy levels as the UBI::AtCCS52A1 lines contained twice as much polyploid cells than the control (Fig. 5g). In the UBI5 and UBI19 lines, the area of rosette leaves was bigger and contained fewer but larger cells than the WT leaves (Fig. 5h k). Consequently, a given surface area of the leaf was composed of predominantly small cells in the WT plants and big cells in the UBI::AtCCS52A1 plants. As the UBI promoter has significantly lower activity than the 35S promoter, we were interested to test whether moderate upregulation of AtCCS52A1 in the UBI::AtCCS52A1 plants

9 New Phytologist Research 1057 affects trichome branching also. Similarly to the 35S:: AtCCS52A1 (HA-A1) and 35S::AtCCS52A2 (HA-A2) lines, four branched trichomes were predominant (up to 71.5%) in the UBI::AtCCS52A1 plants (Fig. 4f) but, unlike the HA-A1 and HA-A2 lines, trichomes with more than four branches were not observed. CCS52A genes act synergistically in gene dosagedependent manner As both CCS52A1 and CCS52A2 positively regulate the endocycles we studied how alterations in gene dosage affect the ploidy levels in the rosette leaves in 10-d-old plants. By crossing the ccs52a1 (a1a1/a2a2 genotype) and the ccs52a2 (A1A1/a2a2 genotype) mutants, we recovered different genotypes with the loss of two or three functional alleles. Not surprisingly, no double mutants (a1a1/a2a2 genotype) were obtained indicating that the absence of all the four alleles causes lethality. The phenotypes of the wild type and mutant plants were compared at the rosette stage (Fig. 6a). The a1a1/a2a2 mutant as shown also in Fig. 2(a, b) was similar to WT, but losing a further allele in a1a1/a2a2 decreased the size of this mutant. The A1A1/a2a2a genotype was smaller than WT and the loss of an additional functional allele made the A1a1/a2a2a plants even smaller, indicating haploinsufficiency of the gene. This was further investigated by the ploidy levels of the mutants (Fig. 6b). In the ccs52a1 mutant (a1a1/ A2A2), the 2C, 4C cell population was similar to the WT while the number of 8C cells increased due to insufficiency of 8C 16C transition. Additional inactivation of one of the CCS52A2 alleles in the a1a1/a2a2 background inhibited the 4C 8C transition in spite of the presence of one functional A2 allele, leading to a larger population of 4C and 2C cells with reduced number of 8C cells and only of a fraction of 16C cells. This effect was more pronounced in the ccs52a2 mutant (A1A1/a2a2a) where the proportion of 2C and 4C cells further increased and the number of 8C cells further reduced. Losing one A1 allele in the ccs52a2 mutant (A1a1/a2a2) further increased the 2C population at the expense (a) (b) Fig. 6 Elimination of CCS52A alleles from Arabidopsis genome leads to gradual decrease in ploidy level. (a) Represented phenotype of plants with two and three alleles of CCS52A genes excluded from plant genome in comparison to WT. (b) Ploidy level of rosette leaves in ccs52a mutants and WT. of 8C cells. These ploidy values together with the plant phenotypes support the gene dosage-dependent action of the CCS52As in Arabidopsis. Discussion Our study reveals a dynamic and largely complementary expression pattern of AtCCS52A1 and AtCCS52A2 in the different organs during different phases of plant development. Previously we reported cell cycle regulation of the Arabidopsis CCS52 genes (F ul op et al., 2005) and restricted expression of AtCCS52A genes in the root meristem where AtCCS52A2 is expressed in the stem cell region, while AtCCS52A1 is activated in the meristemelongation zone border (Vanstraelen et al., 2009). Genome-wide analysis of gene expression profiles during leaf development at the proliferation (day 9), expansion (day 15) and mature (day 22) stages revealed no specific association of AtCCS52A1 or AtCCS52A2 with endoreduplicating tissue (Beemster et al., 2005). Larson-Rabin et al. (2009) explored also the GENEVES- TIGATOR microarray data and concluded that the CCS52 genes are expressed in all organs throughout the life cycle. They also studied the expression of AtCCS52A1 and AtCCS52A2 during leaf development with qrt-pcr, which showed relatively steady-state expression of both genes after a peak of expression at 3 5 d mainly in the case of AtCCS52A2. On the other hand, Lammens et al. (2008) reported increasing transcript levels for AtCCS52A2 and decreasing ones for AtCCS52A1from days 8 to 10 of leaf development and positioned the function of CCS52A2 at day 10 in the transition from mitosis to endoreduplication. Here we show expression of both genes in developing rosette leaves and involvement of AtCCS52A2 particularly in the initial phase of leaf development. Our expression studies were based on the use of transgenic plants carrying translational fusion of b-glucuroronidase reporter gene (GUS) under the control of the indigenous AtCCS52A1 or AtCCS52A2 promoter. During the emergence and differentiation of new organs, the GUS staining revealed dynamic and often transient expression of the AtCCS52A1 and AtCCS52A2 genes and differences in the tissuespecific and/or temporal expression of the two genes within the same organ. We have shown recently that inactivation of the AtCCS52A1 gene increased the root meristem size and stimulated slightly the root growth, in contrast to the Atccs52a2 mutants in which the root growth was halted as the root meristem was consumed by differentiation of the meristematic cells (Vanstraelen et al., 2009). Here we focused on the aboveground phenotypes and showed that the lack of the AtCCS52A2 or high overexpression of either AtCCS52A1 or AtCCS52A2 negatively affected plant development as the plant organ sizes were reduced, resulting in diminished plant biomass. However, no adverse effects occurred when the AtCCS52A1 gene was expressed from the milder ubiquitin promoter, and the plants exhibited even more vigorous growth and developed larger organs and more biomass than the WT plants. In fission yeast overexpression of either AtCCS52A1 or AtCCS52A2 halted cell division and promoted ER resulting in

10 1058 Research New Phytologist large polyploid yeast cells albeit with different morphologies (F ul op et al., 2005). Here we demonstrate that in Arabidopsis both the AtCCS52A1 and AtCCS52A2 proteins are important positive regulators of the ER cycles. Mutations of either genes resulted in reduced ploidy levels and the formation of smaller cells. Analysis of the WT and the ccs52a mutant rosette leaves revealed the major role of AtCCS52A2 for the 4C 8C switch and of AtCCS52A1 for the transitions from the 8C to higher ploidy levels. The shared roles of AtCCS52A1 and AtCCS52A2 in consecutive endocycles likely rely on differences in their temporal and spatial expression and activity because CCS52A2 is expressed mostly at the initial stage of leaf development while CCS52A1 expression is broader and more prolonged. The four alleles of the AtCCS52A1 and AtCCS52A2 genes seem to act in a dose-dependent and a largely complementary manner. The reduced ploidy levels of single mutants decreased even more with the loss of a further allele of the other gene in spite of the presence of one functional allele. This indicated haploinsufficiency of the remaining allele. Double mutants with the loss of all the four ccs52 alleles were never obtained, indicating that they are not viable and that the CCS52A genes are essential and a minimum one functional allele is needed for the survival of the plant. Overexpression of the AtCCS52A genes either from the 35S or from the ubiquitin promoter resulted in either case in a positive effect on endoploidy, provoking higher ploidy levels and the formation of larger cells. In spite of this, the phenotype of plants and their organ sizes varied to a great extent upon the activity of the promoters. Overexpression from the 35S promoter resulted in small organs that contained less but bigger cells than the WT ones. This could be due to the consumption of meristematic cells, which, at high dosage of AtCCS52As, could be forced prematurely toward ER cycles and differentiation. This presumption is also supported by the disappearance of the root meristem in the 35S::AtCCS52A1 plant roots (Larson-Rabin et al., 2009). In WT roots, both AtCCS52A1 and AtCCS52A2 contribute to the maintenance of root meristem; however, they provide different functions as they are expressed in different regions of the meristem. AtCCS52A2 is active in the QC and stem cells and repressed by the DEL1 transcription factor in the upper region of the root meristem (Lammens et al., 2008; Vanstraelen et al., 2009). AtCCS52A1 is induced at meristem-elongation zone border where it promotes mitotic exit, cell differentiation and ER (Vanstraelen et al., 2009). The meristem is maintained by the equilibrium of the outgoing postmitotic cells and the newly generated mitotic cells replacing the outgoing ones. Strong ectopic expression of AtCCS52A1 or AtCCS52A2 likely perturbs this balance by pushing the cell towards differentiation and ER, which leads ultimately to the consumption of the meristem. In the case of moderate overexpression in the UBI::AtCCS52A1 plants, the balance is probably only slightly shifted towards differentiation and ER. Hence, this restrained overexpression of AtCCS52A1 promoted ER while sufficiently maintaining the production of meristematic cells. Thus, the production of larger cells resulting from ER could be a way to promote organ growth in plants. A dose-dependent effect on endoreduplication, with a different outcome on ER and leaf morphology, was also reported for KRP2 (Verkest et al., 2005). KRP2 is an inhibitor of A-type cyclin-dependent kinase CDKA;1 that regulates the mitosis-toendocycle transition during Arabidopsis leaf development. Weak KRP overexpression was found to restrain only the mitotic CDKA;1 activity, resulting in increased ploidy levels, whereas strong overexpression inhibited both mitotic and endoreduplicating CDKA1 activities (Verkest et al., 2005). In the case of CCS52As, both the weak and strong overexpression stimulated endoreduplication but to differing extents and resulted in enhanced or restricted leaf and plant growth, respectively, pointing to the importance on dose-dependent effects of ER regulators on ploidy levels and further leaf development. The unicellular Arabidopsis trichome is a favourite model to study ER in the context of cell differentiation. WT trichomes have 32C DNA content and three branches. In the ccs52a1 mutants, the trichomes carry only two rather than three branches. The WT trichome phenotype was unaffected by the ccs52a2 mutation in accordance with the lack of CCS52A2 expression in this cell type. Overexpression of either CCS52A gene resulted in more than three branches. This indicates that both proteins can promote ER and trichome branching when they are strongly expressed in trichomes. This is in agreement with previous results overexpressing CCS52A1 or CCS52A2 from the trichome-specific GL2 promoter (Kasili et al., 2010). Formation of the two branches is, however, independent of the CCS52A proteins which points to the existence of mechanisms other than the APC/C CCS52A -mediated ER that triggers the first rounds of ER. Because trichome branching in Arabidopsis involves several independent pathways, including endoreplication-dependent and -independent ones, the factor(s) and mechanism forming two-branched trichomes remain to be defined. Acknowledgements We are grateful to late Adam Kondorosi for his constant support. We thank Gabor Horvath for his assistance in analysing the Garlic Syngenta Arabidopsis lines. We thank the Imagif Cell Biology Unit of the Gif campus which is supported by the Conseil General de l Essonne and the electron microscopy facilities of the Institut Federatif de Recherche (IFR)87 for support with cytometry and microscopy experiments. M.B. was supported by the Marie Curie Early Stage Training Network ADOPT Grant MEST-CT and M.V. by a European Molecular Biology Organization long-term fellowship. This study was funded by the Agence National de la Recherche Grant ANR-05- BLAN and by the Hungarian Office for Research and Technology, Grant OMFB-00441/2007. The Centre National de la Recherche Scientifique and CropDesign N.V. hold a patent on CCS52 (patent no. WO/2004/087929). References Beemster GT, Mironov V, Inze D Tuning the cell-cycle engine for improved plant performance. Current Opinion in Biotechnology 16:

11 New Phytologist Research 1059 Beemster GT, Vercruysse S, De Veylder L, Kuiper M, Inze D The Arabidopsis leaf as a model system for investigating the role of cell cycle regulation in organ growth. Journal of Plant Research 119: Buschhorn BA, Peters JM How APC/C orders destruction. Nature Cell Biology 8: Cebolla A, Vinardell JM, Kiss E, Olah B, Roudier F, Kondorosi A, Kondorosi E The mitotic inhibitor ccs52 is required for endoreduplication and ploidy-dependent cell enlargement in plants. EMBO Journal 18: Clough SJ, Bent AF Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant Journal 16: Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiology 139: De Veylder L, Beeckman T, Inze D The ins and outs of the plant cell cycle. Nature Reviews Molecular Cell Biology 8: De Veylder L, Larkin JC, Schnittger A Molecular control and function of endoreplication in development and physiology. Trends in Plant Science 16: Edgar BA, Orr-Weaver TL Endoreplication cell cycles: more for less. Cell 105: Favery B, Complainville A, Vinardell JM, Lecomte P, Vaubert D, Mergaert P, Kondorosi A, Kondorosi E, Crespi M, Abad P The endosymbiosisinduced genes ENOD40 and CCS52a are involved in endoparasitic-nematode interactions in Medicago truncatula. Molecular Plant-Microbe Interactions 15: F ul op K, Tarayre S, Kelemen Z, Horvath G, Kevei Z, Nikovics K, Bako L, Brown S, Kondorosi A, Kondorosi E Arabidopsis anaphase-promoting complexes: multiple activators and wide range of substrates might keep APC perpetually busy. Cell Cycle 4: Harper JW, Burton JL, Solomon MJ The anaphase-promoting complex: it s not just for mitosis any more. Genes & Development 16: Holtorf S, Apel K, Bohlmann H Comparison of different constitutive and inducible promoters for the overexpression of transgenes in Arabidopsis thaliana. Plant Molecular Biology 29: Joubes J, Chevalier C Endoreduplication in higher plants. Plant Molecular Biology 43: Kasili R, Walker JD, Simmons LA, Zhou J, De Veylder L, Larkin JC SIAMESE cooperates with the CDH1-like protein CCS52A1 to establish endoreplication in Arabidopsis thaliana trichomes. Genetics 185: Kevei Z, Baloban M, Da Ines O, Tiricz H, Kroll A, Regulski K, Mergaert P, Kondorosi E Conserved CDC20 cell cycle functions are carried out by two of the five isoforms in Arabidopsis thaliana. PLoS ONE 6: e Kondorosi E, Kondorosi A Endoreduplication and activation of the anaphase-promoting complex during symbiotic cell development. FEBS Letters 567: Lammens T, Boudolf V, Kheibarshekan L, Zalmas LP, Gaamouche T, Maes S, Vanstraelen M, Kondorosi E, La Thangue NB, Govaerts W et al Atypical E2F activity restrains APC/C CCS52A2 function obligatory for endocycle onset. Proceedings of the National Academy of Sciences, USA 105: Larson-Rabin Z, Li Z, Masson PH, Day CD FZR2/CCS52A1 expression is a determinant of endoreduplication and cell expansion in Arabidopsis. Plant Physiology 149: Li Z, Larson-Rabin Z, Masson PH, Day CD FZR2/CCS52A1 mediated endoreduplication in Arabidopsis development. Plant Signaling & Behavior 4: Mathieu-Rivet E, Gevaudant F, Cheniclet C, Hernould M, Chevalier C The Anaphase Promoting Complex activator CCS52A, a key factor for fruit growth and endoreduplication in Tomato. Plant Signaling & Behavior 5: Sauer K, Lehner CF The role of cyclin E in the regulation of entry into S phase. Progress in Cell Cycle Research 1: Sigrist SJ, Lehner CF Drosophila fizzy-related down-regulates mitotic cyclins and is required for cell proliferation arrest and entry into endocycles. Cell 90: Tarayre S, Vinardell JM, Cebolla A, Kondorosi A, Kondorosi E Two classes of the CDh1-type activators of the anaphase-promoting complex in plants: novel functional domains and distinct regulation. Plant Cell 16: Vanstraelen M, Baloban M, Da Ines O, Cultrone A, Lammens T, Boudolf V, Brown SC, De Veylder L, Mergaert P, Kondorosi E APC/C-CCS52A complexes control meristem maintenance in the Arabidopsis root. Proceedings of the National Academy of Sciences, USA 106: Verkest A, Manes CL, Vercruysse S, Maes S, Van Der Schueren E, Beeckman T, Genschik P, Kuiper M, Inze D, De Veylder L The cyclin-dependent kinase inhibitor KRP2 controls the onset of the endoreduplication cycle during Arabidopsis leaf development through inhibition of mitotic CDKA;1 kinase complexes. Plant Cell 17: Vinardell JM, Fedorova E, Cebolla A, Kevei Z, Horvath G, Kelemen Z, Tarayre S, Roudier F, Mergaert P, Kondorosi A et al Endoreduplication mediated by the anaphase-promoting complex activator CCS52A is required for symbiotic cell differentiation in Medicago truncatula nodules. Plant Cell 15: Weigel D, Glazebrook J Arabidopsis: a laboratory manual. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press. Yamaguchi S, Murakami H, Okayama H A WD repeat protein controls the cell cycle and differentiation by negatively regulating Cdc2/B-type cyclin complexes. Molecular Biology of the Cell 8: Supporting Information Additional supporting information may be found in the online version of this article. Fig. S1 Expression of AtCCS52A2 is not upregulated in the ccs52a1 mutants. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.