HPLC Columns. Capture the Essence

Transcription

1 HPLC Columns Capture the Essence 0-09

2 We provide a wide range of products to meet your analytical needs, from pretreatment and separation columns to calibration standards for size exclusion chromatography. Please visit the Shodex website to see detailed information about our products and their uses with abundant application data. Shodex website The following names are trademarks or registered trademarks of SHOWA DENKO K.K. Shodex, AFpak, Asahipak, AXpak, CLNpak, CXpak, HILICpak, MSpak, ODP, OHpak, ORpak, RSpak, SUGAR, USPpak [Caution]. Please read the operating manual packaged with the product carefully before the use.. For improvement purposes, some specifications are subject to change without notice.. Figures and descriptions in this catalogue are provided to help you select appropriate columns. However they do not guarantee nor warrant the suitability for your applications.. It is essential to take normal precautions when handling reagents and other chemical products even if the safety information is not included in the operating manual.. Products described in this brochure are not intended for medical use or medical applications including medical diagnosis.

3 Contents Column selection Analysis and preparative columns Sample pretreatment columns Product name changes notices Information Index Reversed Phase, Hydrophilic Interaction and Normal Phase Chromatography Ligand Exchange Chromatography Ion Exclusion Chromatography Ion Chromatography Size Exclusion Chromatography Calibration Standards for SEC Ion Exchange Chromatography Special Separation Modes Columns Types of Columns, Base Materials, Functional Groups and Ligands HPLC Separation Modes Column Selection by Sample Character and Separation Mode Column Selection (Application) Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features Polymer-based Reversed Phase Chromatography Columns (ODP HP) Polymer-based Reversed Phase Chromatography Columns (Asahipak) Polymer-based Reversed Phase Chromatography Columns (RSpak) Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak) Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (Asahipak) Silica-based Reversed Phase Chromatography Columns (ODS Columns) Silica-based Reversed Phase Chromatography Columns (Other Columns) Silica-based Normal Phase Chromatography and HILIC Columns Ligand Exchange Chromatography Columns Ion Exclusion Chromatography Columns Ion Chromatography Columns (Anion Analysis) Ion Chromatography Columns (Cation Analysis) Column Selection for Size Exclusion Chromatography (SEC) Precautions for Polar Polymer Analysis Aqueous SEC (GFC) Columns: Silica-based Aqueous SEC (GFC) Columns: Polymer-based Multimode Columns Aqueous/Organic SEC Columns Organic SEC (GPC) Columns (General Analysis): THF Organic SEC (GPC) Columns (General Analysis): Chloroform Organic SEC (GPC) Columns (General Analysis): DMF Solvent-peak Separation Columns for Organic SEC (GPC) Organic SEC (GPC) Columns: Rapid Analysis Organic SEC (GPC) Columns: High Performance Analysis Organic SEC (GPC) Columns: Ultra-rapid Analysis Organic SEC (GPC) Columns: Preparative Colums Organic SEC (GPC) Columns: Linear Calibration Type Organic SEC (GPC) Columns: High Temperature/Ultra High Temperature Analysis Organic SEC (GPC) Columns: HFIP Solvent Replacement Applicability of SEC (GPC) Columns Calibration Standards for SEC Anion Exchange Chromatography Columns Cation Exchange Chromatography Columns Hydrophobic Interaction Chromatography Column Affinity Chromatography Columns Chiral Separation Columns High Temperature Reversed Phase Chromatography Column Pretreatment Column for Column Switching Method GPC Clean-up Columns Changes Notices USP0-NF Column List Column Cleaning Procedures General Precautions for Column Handling Column Trouble Shooting HPLC System Trouble Shooting Index by Index by

4 Separation Type Base Material Functional Group, Ligand Reversed Phase & HILIC (Polymer-based) Asahipak Asahipak Asahipak RSpak RSpak RSpak RSpak RSpak HILICpak HILICpak HILICpak HILICpak Asahipak ODP HP ODP-0, ODP-0 CP-0 CP-0 RP-, DS DE DM- NN JJ-0 VG-0 VT-0 VC-0 VN-0 NHP ET-RP Polyhydroxymethacrylate Polyvinyl alcohol Polyvinyl alcohol Polyvinyl alcohol Styrene divinylbenzene copolymer Polymethacrylate Polyhydroxymethacrylate Polyhydroxymethacrylate Polyvinyl alcohol Polyvinyl alcohol Polyvinyl alcohol Polyvinyl alcohol Polyvinyl alcohol Polyvinyl alcohol Polyvinyl alcohol Octadecyl Octyl Butyl Sulfo Quaternary ammonium Ao Quaternary ammonium Carboxyl Diol Ao Octadecyl C Silica Octadecyl Silica CM, CP Silica Octadecyl Silica C Silica Octyl Reversed Phase, Silica CN Silica Cyanopropyl Normal Phase & HILIC Silica Nitrophenylethyl (Silica-based) Silica NPE Silica PYE Silica Pyrenylethyl Silica SIL Silica Silica NH Silica Aopropyl Ligand Exchange SUGAR SUGAR SUGAR RSpak SUGAR EP USPpak SC SP00 KS-00 DC- SZ SC0-F MN- Styrene divinylbenzene copolymer Styrene divinylbenzene copolymer Styrene divinylbenzene copolymer Styrene divinylbenzene copolymer Styrene divinylbenzene copolymer Styrene divinylbenzene copolymer Styrene divinylbenzene copolymer Sulfo (Ca + ) Sulfo (Pb + ) Sulfo (Na + ) Sulfo (Na + ) Sulfo (Zn + ) Sulfo (Ca + ) Sulfo (Ca + ) Ion Exclusion SUGAR SH Styrene divinylbenzene copolymer Sulfo RSpak KC- Styrene divinylbenzene copolymer Sulfo IC NI-, I-A Polyhydroxymethacrylate Quaternary ammonium IC SI Polyvinyl alcohol Quaternary ammonium Ion Chromatography IC YS-0 Polyvinyl alcohol Carboxyl IC YK- Silica Carboxyl IC Y-, T- Styrene divinylbenzene copolymer Sulfo PROTEIN KW-00 Silica Hydrophilic polymer PROTEIN LW-0 Silica Hydrophilic polymer Aqueous SEC (GFC) KW00 Silica Hydrophilic polymer OHpak SB-00 HQ Polyhydroxymethacrylate OHpak LB-00 Polyhydroxymethacrylate Multimode Asahipak GS-HQ Polyvinyl alcohol Aqueous/Organic SEC Asahipak GF-HQ Polyvinyl alcohol MSpak GF-0 Polyvinyl alcohol KF-00, K-00, KD-00, HK-00, Organic SEC (GPC) GPC HK-HFIP0, KF-00, KF-00HQ, LF, HT-00, UT-00, AT-0MS, Styrene divinylbenzene copolymer HFIP-00, HFIP-00 IEC QA- Polyhydroxymethacrylate Quaternary ammonium IEC DEAE- Polyhydroxymethacrylate Diethylaoethyl IEC DEAEN Polyhydroxymethacrylate Diethylaoethyl PIKESS DEAE-B Polyhydroxymethacrylate Diethylaoethyl Asahipak ES-0N Polyvinyl alcohol Diethylaoethyl AXpak WA- Polyhydroxymethacrylate Diethylaoethyl Ion Exchange IEC SP- Polyhydroxymethacrylate Sulfopropyl IEC SP-0N Polyhydroxymethacrylate Sulfopropyl IEC SP-FT A Polyhydroxymethacrylate Sulfopropyl PIKESS SP-B Polyhydroxymethacrylate Sulfopropyl IEC CM- Polyhydroxymethacrylate Carboxymethyl Asahipak ES-0C Polyvinyl alcohol Carboxymethyl CXpak P-S Styrene divinylbenzene copolymer Sulfo (Na + ) Hydrophobic Interaction Affinity Types of Columns, Base Materials, Functional Groups and Ligands Chiral Separation Column Switching Pretreatment GPC Clean-up HIC AFpak AFpak ORpak ORpak MSpak CLNpak CLNpak PH- APA-9 ACH-9 CDBS- CRX- GF-A EV PAE Polyhydroxymethacrylate Polyhydroxymethacrylate Polyhydroxymethacrylate Silica Polyhydroxymethacrylate Polyvinyl alcohol Styrene divinylbenzene copolymer Polyvinyl alcohol Phenyl Protein A Choline oxydase, Acetylcholine esterase β-cyclodextrin derivative L-Ao acid derivative Page ,,,,,,,

5 HPLC Separation Modes Liquid chromatography (LC) uses liquid as mobile phase (eluent). It is an analytical method that separates a mixture of compounds based on their physical and chemical differences. High performance liquid chromatography (HPLC) is a method that introduces the mobile phase under high-pressure conditions resulting in rapid and high-performance separations. The various interactions between the analyte, stationary phase (packing material), and mobile phase are the key factors for the separation. A wide variety of separation modes can be achieved by using particular combinations of stationary and mobile phases. Separation mode Reversed Phase Chromatography (RPC) Hydrophilic Interaction Chromatography (HILIC) Normal Phase Chromatography (NPC) Ligand Exchange Chromatography (LEX) Ion Exclusion Chromatography (IEX) Ion Chromatography (IC) Size Exclusion Chromatography (SEC) Ion Exchange Chromatography (IEC) Hydrophobic Interaction Chromatography (HIC) Affinity Chromatography (AFC) Chiral Separation Chromatography (CS) Multimode Chromatography Separation is based on hydrophilic interaction. A high polarity stationary phase is used. Typically the mobile phase contains a mixture of organic solvents such as acetonitrile and aqueous solvents (water or buffer). Using the higher polarity mobile phase causes a faster elution. Applicable for the analysis of high polar substances. Separation is based on the partition equilibrium between the stationary phase and the mobile phase. The polarity of the stationary phase is higher than that of the mobile phase. Typically the mobile phase contains a mixture of organic solvents with different polarities such as hexane and isopropanol. Using the higher polarity mobile phase causes a faster elution. Separation is based on differences in analytes' coordination complex. Stationary phase modified with metal sulfonate complex ion. Works in combination with size exclusion or HILIC modes. Separation is based on electrostatic interaction (repulsion) between the ion exchanger and ionic solutes. Dissociated ionic molecules elute faster than non-dissociated forms. Used mainly for the analysis of organic acids. Separation is based on electrostatic interaction (bonding) between the ion exchanger and ionic solutes. Electrical conductivity detector can be used with a mobile phase with low-salt concentration. Used mainly for the analysis of inorganic compounds. Network or pores on the surface of the packing material works as molecular sieve to separate molecules based on their sizes. To separate molecules solely based on their sizes, it requires an analytical condition without any analyte and packing gel interaction. The bigger the molecule size, the faster the elution sequence. Used for molecular weight or molecular distribution deteration of macromolecules and qualification of oligomers. Separation is based on electrostatic interactions between the ion exchanger and ionic solutes. The mobile phase of choice should have a sufficient buffering capacity at the ph that produces the largest charge differences between the analyte of interest. The elution position is optimized by varying the ph, salt concentration, and/or ionic strength of the mobile phase. Separation is based on hydrophobic interaction. Hydrophobic functional group is modified on the stationary phase. Adsorption of analytes generally occurs at a high salt concentration and they are released by lowering the salt concentration. Used mainly for the analysis of proteins. Separation is based on adsorption of the analyte to the specific biologically derived ligand pair. Highly selective. A buffer solution with the appropriate ph and ionic strength is selected based on the type of ligand, analytes, and their interaction. Used mainly for the purification and concentration of biologically active substances. Separation of optical isomers using chiral selectors. Highly selective. Separation is based on the combination of different modes. Column Selection by Sample Character and Separation Mode Sample Solubility Aqueous soluble Sample MW,000,000 Separation Mode RPC LEX IEX SEC IEC HIC AFC RPC HILIC LEX IEX IC SEC IEC AFC CS Sample Solubility Organic soluble Sample MW,000,000 Characteristics Separation is based on the partition equilibrium between stationary phase and mobile phase. The polarity of the stationary phase is lower than that of the mobile phase. Typically the mobile phase contains a mixture of organic solvents (methanol, acetonitrile, or THF) and aqueous solvents (water or buffer). Use of lower polarity mobile phases fasten the elution. Separation Mode SEC RPC NPC SEC RPC : Reversed Phase Chromatography HILIC : Hydrophilic Interaction Chromatography NPC : Normal Phase Chromatography LEX : Ligand Exchange Chromatography IEX : Ion Exclusion Chromatography IC : Ion Chromatography SEC : Size Exclusion Chromatography IEC : Ion Exchange Chromatography HIC : Hydrophobic Interaction Chromatography AFC : Affinity Chromatography CS : Chiral Separation Chromatography Types of Columns, Base Materials, Functional Groups and Ligands HPLC Separation Modes Column Selection by Sample Character and Separation Mode

6 Column Selection (Application) Pharmaceuticals, Cosmetics Separation Mode Page Foods Separation Mode Page Pharmaceuticals Metabolites Additives Hydrophobic substances Hydrophilic substances Substances in bio-fluid (serum plasma urine) RPC HILIC IEC+RPC LEX+SEC RPC SEC+RPC, 0,,, 0,, Monosaccharides Disaccharides Sugar alcohols Oligosaccharides Low molecular weight water-soluble dietary fiber HILIC LEX+SEC LEX+HILIC HILIC LEX+HILIC SEC SEC, 0, 0,, Moisturizers Emulsifiers Preservatives Optical active materials Polymer Polyalcohols Protein hydrolysates Mucopolysaccharides Surfactants Paraben Dehydroacetic acid SEC RPC LEX+SEC LEX+HILIC SEC RPC SEC SEC SEC+RPC SEC RPC CS,,,,, 0, 0,, 0,, Nutritional ingredients Polysaccharides Organic acids Water-soluble vitas Fat-soluble vitas Fatty acids Nucleic acids (umami) Ao acids SEC RPC IEX+RPC IC RPC IEC+RPC HILIC RPC NPC SEC RPC SEC IEC+SEC IEC+IEX+RPC HILIC IC,, 0, 0,, 0 0 0,,, 0,, IEC Food additives RPC HILIC 0,,, 0 RPC Food safety Pesticides IEC+RPC HILIC IC Separation Mode (Page and Page ) Mycotoxin Pretreatment of residual pesticides RPC SEC GPC ( clean-up ) RPC : Reversed Phase Chromatography HILIC : Hydrophilic Interaction Chromatography NPC : Normal Phase Chromatography LEX : Ligand Exchange Chromatography IEX : Ion Exclusion Chromatography IC : Ion Chromatography SEC : Size Exclusion Chromatography IEC : Ion Exchange Chromatography HIC : Hydrophobic Interaction Chromatography AFC : Affinity Chromatography CS : Chiral Separation Chromatography New Materials Synthetic polymers Additives Oligomers Organic solvent soluble Polar organic solvent soluble High temperature/ Ultra high temperature Water-soluble Organic solvent soluble Polar organic solvent soluble Water-soluble Separation Mode SEC RPC SEC Page, 0,,,,,,,,,,,, 0,,, 0,,,,,,,,,,

7 Biotechnology Genomics Nucleobases Nucleotides Nucleosides Oligo nucleic acids Separation Mode RPC IEC+SEC IEC HILIC RPC IEC+SEC IEC Page, 0 0 Environment Water quality Anions Oxyhalides Cyanide Cyanogen chloride Cations Surfactants Separation Mode IC IC IEC+HILIC IEX IC RPC SEC+RPC Page 0 0, Column Selection (Application) DNA/RNA SEC, RPC, RPC IEC+IEX+RPC 0 Pesticides IEC+RPC HILIC Ao acids HILIC IC IEC Anions IC Proteomics IEC+SEC Heavy metals IC RPC 0, Humic substances SEC Peptides Proteins SEC IEC,,, 0, Soil Organic arsenic IEX+RPC RPC, HIC RPC 0, Pesticides IEC+RPC HILIC Glycomics Glycoproteins Sugar chains Monosaccharides SEC IEC HIC HILIC HILIC LEX+SEC,,, 0,, 0, 0 Environmental hormones Pretreatment of Phthalates PCBs Benzo [a] pyrene Monosaccharides Oligosaccharides IC SEC GPC ( clean-up ) HILIC LEX+SEC, 0 Hormones Sialic acids Uronic acids Aldonic acids Aes LEX+HILIC IEX+RPC RPC IEC RPC 0, 0, 0 Bioethanols Oligosaccharides Alcohols Furfural Saccharides Organic acids Alcohols Furfural Hemicelluloses Celluloses LEX+SEC IEX+RPC+SEC SEC 0, Steroids HILIC, 0 Cations IC Lipids Phospholipids Lipoproteins SEC NPC SEC SEC,, 0,, Biodiesels Fatty acid glycerides Fatty acid methyl esters Organic acids SEC RPC IC

8 Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features ODS columns are the most popular reversed phase columns that are packed with silica-based octadecyl group. Shodex provides not only ODS columns but also polymer-based reversed phase columns with different functional groups. Please use following descriptions about the column features as guidelines to select suitable columns for your application purposes. Features ODP HP ODP-0 CP-0 CP-0 ODP-0 RP- DS- DS- DE DM- NN JJ-0 C CM CP C CN NPE PYE Provides a large theoretical plate number nearly twice as much as generally available polymer-based reversed phase columns do Offers enhanced retention of high polar substances compared to ODS columns Suitable for the analysis of small molecules such as pharmaceuticals in the presence of protein matrix Ideal for LC/MS analysis of high polar compounds Fulfills USP L9 requirements Relatively large pore size is suitable for the analysis of ao acids, peptides, and proteins Usable in a wide ph range from ph to Usable in 00% water and buffer solution Best used for the analysis of basic substances ODP-0 Fulfills USP L requirements Higher performance type of ODP-0 series Fulfills USP L requirements Large pore size is suitable for the analysis of proteins and peptides Fulfills USP L requirements Suitable for reversed phase analysis of highly hydrophilic substances that are not well retained by ODS columns Fulfill USP L requirements General purpose polymer-based column having similar polarity as ODS columns Wide working ph range (form ph to ), usable in 00% water and buffer solutions Fulfills USP L requirements Suitable for the analysis of ao acids and water-soluble vitas Fulfills USP L9 requirements The packing material modified with sulfo groups supports multimode (reversed phase and cation exchange) analysis Ideal for the analysis of complex samples containing neutral and ionic substances The packing material is modified with trace amounts of quaternary ammonium groups, and supports multimode (reversed phase and anion exchange) analysis Ideal for analysis of complex samples containing neutral and ionic substances Fully end capped ODS column available at very reasonable price Fulfills USP L requirements Monomeric type ODS column fully end capped high purity silica (99.99% or higher) Fulfills USP L requirements Polymeric type ODS column fully end capped high purity silica (99.99% or higher) Excellent acid tolerance Advantageous for separating planar and nonplanar compounds from each other Fulfills USP L requirements Use when the retention capacity of C is too strong Rapid mass transfer and fast equilibration allow its use as an ion-pair chromatography Fulfills USP L requirements Utilizes reversed phase interaction and π-electron interaction to separate regioisomers, which typically cannot be separated with ODS or C columns Fulfills USP L0 requirements Utilizes several types of interactions based on π-electrons to separate structural isomers NPE Fulfills USP L requirements

9 The interrelation between hydrophobicity and retention, and the interrelation between steric selectivity and retention were compared among Shodex columns for reversed phase chromatography. The retention factor (k ) of amylbenzene was used as the retention, the separation factor (α) between n-butylbenzene and n-ao benzene was used as the hydrophobicity. The separation factor between o-terphenil and triphenylene was used as the steric recognition. Lager separation factor means higher hydrophobicity and higher steric selectivity. Hydrophobicity differences among Shodex RPCs Hydrophobicity NPE CN ODP HP C PYE CP-0 CP-0 DE- Retention Column size :.mm I.D. x 0mm each Eluent : H O/CH OH=0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C C CM CP ODP-0 Steric selectivity ODP HP NPE CN n-butylbenzene o-terphenyl CP-0 PYE CP-0 DE- C Retention n-amylbenzene Triphenylene Steric selectivity differences among Shodex RPCs Column size :.mm I.D. x 0mm each Eluent : H O/CH OH=0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C ODP-0 CP C CM Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features Comparison of different functional groups on the separation of alkylalcohols Effects of steric selectivity differences EG C C C C0 C C Sample : Ethyleneglycol, n-alkylalcohol Sample : µl. n-buthylbenzene. n-amylbenzene CP-0 (Butyl). o-terphenyl CM D. Triphenylene ODP-0 EG C C C CP-0 (Octyl) C0 C C Elution volume (ml) 0 0 Carbon number (n) CP-0 CP-0 Relationship between the carbon number in alkylalcohols and elution volume PYE D EG C C 0 C ODP-0 (Octadecyl) C0 C C 0 0 Column : Shodex Asahipak ODP-0 D Shodex Asahipak CP-0 D Shodex Asahipak CP-0 D Eluent : H O/CH OH=0/0 Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex Silica CM D Shodex Silica PYE D Eluent : H O/CH OH=0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C

10 Polymer-based Reversed Phase Chromatography Columns (ODP HP) Please refer to Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features on page and for features. Standard columns Functional Group Shipping Solvent F00 ODP HP-B, H O/CH CN=/ F00 ODP HP-D, H O/CH CN=/ F00 ODP HP-E, H O/CH CN=/ F00 ODP HPG-A. 0 H O/CH CN=/ F00 ODP HP-B, H O/CH CN=/ F00 ODP HP-D, H O/CH CN=/ F0 ODP HPG-A.0 0 H O/CH CN=/ mm I.D columns [Customized columns] Base Material: Polyhydroxymethacrylate Functional Group F00 ODP HP-B F00 ODP HP-D F0 ODP HPG-A.0 0 Preparative columns *Preparative columns are made to order. Base Material: Polyhydroxymethacrylate Standard Column F00 ODP HP-0E 9, ODP HP F0 ODP HPG-B. 0 Comparison between ODP HP-D and ODS column for their alkaline tolerances Chromatograms obtained before and after passing alkaline eluent Before After 00 hr ODP HP-D (.mm I.D.x0mm) Sample : µl. Pyridine 00µg/mL. Phenol 0µg/mL 0 0 Before After hr ODS (.mm I.D.x0mm) 0 0 Correlation between alkaline eluent passing time and relative theoretical plate number Relative theoretical plate number for pyridine (%) ODP HP-D ODS Alkaline eluent passing time (hr) Analysis condition Column : Shodex ODP HP-D ODS from other manufacturer Eluent : H O/CH OH=0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Eluent passing conditions for alkali tolerance test Column : Shodex ODP HP-D ODS from other manufacturer Eluent : 0mM Sodium phosphate buffer (ph) /CH CN=/ Flow rate : 0.mL/ Column temp. : 0 C

11 Comparison between ODP HP and ODP-0 (existing) Sample : µl. Phenol 00mg/L. Methyl benzoate 0mg/L. Toluene 000mg/L. Naphthalene 0mg/L ODP HP-D N:, Column : Shodex ODP HP-D Eluent : H O/CH CN=/ Flow rate : 0.mL/ Detector : UV (nm) Column temp. : 0 C Ratio of Pressure (%) * Sample : µl BSA.0mg/mL ODS (.0mm I.D. 0mm) ODP HP-B (.0mm I.D. 0mm) Number of Injection *Considering original pressure as 00% Column : Shodex ODP HP-B ODS from other manufacturer Eluent : mm CH COONH aq./ch CN=90/0 Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : 0 C ODP-0 D (existing) N:,00 Column : Shodex Asahipak ODP-0 D Eluent : H O/CH CN=/ Flow rate : 0.mL/ Detector : UV (nm) Column temp. : 0 C Influence of repeated protein injection on column pressure ODP HP columns are packed with gels with increased surface polarity and smaller pore size which prevent the adsorption of proteins. BSA was injected multiple times to both ODS and ODP HP columns. A significant column pressure increase was observed for the ODS column, while no considerable change was observed for the ODP HP column even after 0 injections. Imidazoles. Sample : 0.% each, 0µL. Imidazole. -Methylimidazole. -Methylimidazole Column : Shodex ODP HP-E Eluent : 0mM Na HPO aq./ch CN=90/0 Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : 0 C Anticonvulsant in serum Sample : 0µL. -Acetaophenol (I.S.) 0µg/mL. Zonisamide.0µg/mL. Phenobarbital 9.0µg/mL. Carbamazepine.µg/mL. Phenytoin 9.0µg/mL Column : Shodex ODP HP-E Eluent : mm Sodium phosphate buffer (ph.)/ch CN=0/0 Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : 0 C Sample pretreatment: Mix the same volumes of serum and acetonitrile. Centrifuge the mixture at 000g for utes. Use the supernatant as sample. Data courtesy of Katsuko Hara.MT Yutaka Komiyama.Ph.D., Department of Clinical Sciences and Laboratory Medicine, Kansai Medical University. Polymer-based Reversed Phase Chromatography Columns (ODP HP) Comparison of barbital recovery rate using ODP HP-B and ODS in the presence of BSA ODP HP Barbital 00ng/mL ODS Barbital 00ng/mL For the LC/MS analysis of drugs in samples containing protein matrix, use of ODP HP column showed less matrix effect (ion suppression in this case) compared to when ODS column was used. This shows that ODP HP column does not retain protein and elute it as a void. Barbital Barbital Peak Area : 00% Peak Area : 00% Barbital 00ng/mL in BSA.0mg/mL Barbital 00ng/mL in BSA.0mg/mL Barbital Barbital Peak Area : 99% Peak Area : % Column : Shodex ODP HP-B ODS from other manufacturer Eluent : 0mM Ammonium acetate aq. /CH CN=0/0 Flow rate : 0.mL/ Detector : ESI-MS (SIM Negative : m/z ) Column temp. : 0 C Injection vol. : 0µL 9

12 Polymer-based Reversed Phase Chromatography Columns (Asahipak) Please refer to Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features on page and for features. Standard columns Functional Group Column Size (mm) Shipping Solvent F00 Asahipak ODP-0 D,000 Octadecyl 0. 0 H O/CH CN=/ F00 Asahipak ODP-0 E,000 Octadecyl 0. 0 H O/CH CN=/ F000 Asahipak ODP-0 D 9,000 Octadecyl H O/CH CN=/ F000 Asahipak ODP-0 E,000 Octadecyl H O/CH CN=/ F000 Asahipak ODP-0G A Octadecyl.0 0 H O/CH CN=/ F00 Asahipak ODP-0 B,00 Octadecyl 0. 0 H O/CH CN=/ F000 Asahipak ODP-0 D 9,000 Octadecyl 0. 0 H O/CH CN=/ F000 Asahipak ODP-0 E,000 Octadecyl 0. 0 H O/CH CN=/ F00 Asahipak ODP-0G A Octadecyl. 0 H O/CH CN=/ F0009 Asahipak ODP-0 D,000 Octadecyl H O/CH CN=/ F00 Asahipak ODP-0G A Octadecyl.0 0 H O/CH CN=/ F000 Asahipak CP-0 D,000 Octyl 0. 0 H O/CH CN=/ F000 Asahipak CP-0 E,000 Octyl 0. 0 H O/CH CN=/ F000 Asahipak CP-0G A Octyl. 0 H O/CH CN=/ F000 Asahipak CP-0 D,000 Butyl 0. 0 H O/CH CN=/ F000 Asahipak CP-0 E 9,000 Butyl 0. 0 H O/CH CN=/ F000 Asahipak CP-0G A Butyl. 0 H O/CH CN=/ mm I.D columns [Customized columns] Base Material: Polyvinyl alcohol Functional Group F0 Asahipak ODP-0 B Octadecyl F0 Asahipak ODP-0 D Octadecyl F0 Asahipak ODP-0G A Octadecyl Base Material: Polyvinyl alcohol Semi-micro columns *The following semi-micro columns are made to order. Functional Group F0 ODP0-B Octadecyl F0 ODP0-D Octadecyl Base Material: Polyvinyl alcohol Preparative columns *Preparative columns are made to order. Standard Column F000 Asahipak ODP-0 0E 0, ODP-0, ODP-0 F00 Asahipak ODP-90 0F 9, ODP-0, ODP-0 F000 Asahipak ODP-0G B. 0 F000 Asahipak CP-0 0E, CP-0 F00 Asahipak CP-0G B. 0 F000 Asahipak CP-0 0E, CP-0 0 F00 Asahipak CP-0G B. 0

13 Alkaline tolerance of ODP-0 0 (+) hr 90hr 0hr 0hr ph Scopolae HC N O OH O O Atropine Sample :. Acetophenone. Butyrophenone. Hexanophenone. Heptanophenone. Octanophenone Column : Shodex Asahipak ODP-0 D Eluent : 0mM NaOH aq. (ph.0)/ch CN=/ Flow rate : 0.mL/ Detector : UV (nm) Column temp. : 0 C LC/MS analysis of basic drugs Sample : 0ng/mL each, µl. Scopolae. Atropine Local anesthetics Dissociation of tertiary ao groups in basic drugs can be suppressed by making ph of the eluent higher than pka of the ao groups. This increases the relative hydrophobicity of the basic drugs,thereby allowing the column to retain the drugs stronger and provide baseline separation of them. 0 0 Fat-soluble vitas ph 0 0 Column : Shodex Asahipak ODP-0 D Eluent : mm Phosphate buffer/ch CN=0/0 Flow rate : 0.mL/ Detector : UV (nm) Column temp. : 0 C ph 0 0 Sample :. Benzocaine HN. Lidocaine CH CH. Tetracaine NHCOCHN COOCHCHN NH(CH)CH COOCH Sample : 0µL. Vita K.µg/mL. Vita A.0 IU/mL. Vita A acetate 0. IU/mL. Vita D.µg/mL. Vita D. IU/mL. Vita E acetate.µg/ml. Vita E.µg/mL. Vita K.µg/mL CH CH CH CH Polymer-based Reversed Phase Chromatography Columns (Asahipak) N OH 90 (+) O O Column : Shodex ODP0-D Eluent : 0.0% NH aq./ch CN=0/0 Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C Column : Shodex Asahipak ODP-0 E Eluent : CH CN/CH OH=0/0 Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : 0 C Analysis of azithromycin following USP method Unsaturated fatty acids Gradient analysis of proteins and peptides Sample : 0µL Standard solution Azithromycin (0.mg/mL) Sample : µl 0.00% each (in Ethanol). EPA (Eicosapentaenoic acid). α-linolenic acid. DHA (Docosahexaenoic acid). Arachidonic acid. Linoleic acid 9 0 Sample : 0µL No. 0%CHCN Sample Lys-Bradykinin Bradykinin Met-Enkephalin Neurotensin Recovery MW (%) System suitability solution Azaerythromycin A (0.mg/mL) Azithromycin (0.mg/mL) 0%CHCN 9 Leu-Enkephalin Substance P Bacitracin Insulin Insulin B chain Lysozyme 00 9 Rs >.0 Mastoparan Myoglobin Column : Shodex Asahipak ODP-0 Eluent :.g/l Dibasic potassium phosphate aq. (ph.0 adjusted with 0M KOH) /CH CN=0/0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex Asahipak ODP-0 D Eluent : 0.% H PO in (H O/CH CN=0/0) Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Column : Shodex Asahipak ODP-0 D Eluent : (A); 0.0% TFA aq./ch CN=0/0 (B); 0.0% TFA aq./ch CN=0/0 Linear gradient; (A) to (B), 0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C

14 Polymer-based Reversed Phase Chromatography Columns (RSpak) Please refer to Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features on page and for features. Standard columns Functional Group Base Material Particle Size Pore Size Column Size (mm) Shipping Solvent F RSpak RP-,000 Styrene divinylbenzene copolymer 0. 0 H O/CH CN=/9 F09 RSpak RP-G Styrene divinylbenzene copolymer. 0 H O/CH CN/THF=0/0/0 F0000 RSpak DS-,00 Styrene divinylbenzene copolymer H O/CH CN/THF=0/0/0 F000 RSpak DS-,000 Styrene divinylbenzene copolymer H O/CH CN/THF=0/0/0 F000 RSpak DS-G Styrene divinylbenzene copolymer 0. 0 H O/CH CN/THF=0/0/0 F0000 RSpak DE-,000 Polymethacrylate.0 0 H O F0000 RSpak DE-,000 Polymethacrylate. 0 H O/CH CN=0/0 F00900 RSpak DE-L,000 Polymethacrylate. 0 H O/CH CN=0/0 F000 RSpak DE-G A (RSpak DE-G) Polymethacrylate 0. 0 H O F0000 RSpak DE-,000 Polymethacrylate.0 0 H O/CH CN=0/0 F00 RSpak DE-G A (RSpak DE-SG) Polymethacrylate.0 0 H O/CH CN=0/0 F0000 RSpak DM-,00 Polyhydroxymethacrylate mm H PO aq. F000 RSpak DM-G A (RSpak DM-G) Polyhydroxymethacrylate. 0 mm H PO aq. F000 RSpak NN- 9,000 Sulfo Polyhydroxymethacrylate M Sodium phosphate buffer (ph.0) F000 RSpak NN-,000 Sulfo Polyhydroxymethacrylate M Sodium phosphate buffer (ph.0) F000 RSpak NN-G Sulfo Polyhydroxymethacrylate M Sodium phosphate buffer (ph.0) F000 RSpak NN-,000 Sulfo Polyhydroxymethacrylate M Sodium phosphate buffer (ph.0) F000 RSpak JJ-0 D,00 Quaternary ammonium Polyvinyl alcohol H O/CH CN=0/0 F000 RSpak JJ-0 D,00 Quaternary ammonium Polyvinyl alcohol H O/CH CN=0/0

15 Semi-micro columns *The following semi-micro columns are made to order. F0 F0 F0 DE-B DE-E NN-D Functional Group Sulfo 0,000,000 Base Material Polymethacrylate Polymethacrylate Polyhydroxymethacrylate Preparative columns *Preparative columns are made to order. F0 F0090 F0 RSpak DE-0 RSpak DE-G B (RSpak DE-LG) RSpak DM Standard Column DE-, DE- DE-, DE- DM- Polymer-based Reversed Phase Chromatography Columns (RSpak) F000 RSpak DM-G B (RSpak DM-LG).0 0

16 Separation and recovery rate of standard proteins Alkylbenzenes Recovery (%). Ribonuclease A 9. Insulin 9. Cytochrome c 00. Lysozyme 00. BSA 9. Myoglobin 0. Ovalbu Sample : µl. m-cresol 0.%.,-Xylenol 0.%. Benzene 0.%. Toluene 0.%. Ethylbenzene 0.%. n-propylbenzene 0.% Column : Shodex RSpak RP- Eluent : (A); 0.% TFA aq./ch CN=99/ (B); 0.% TFA aq./ch CN=/9 Linear gradient; (B%) 0% to 0%, 0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : Room temp. 0 0 Column : Shodex RSpak DS- Eluent : H O/CH CN/THF=0/0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Fatty acid methyl esters Organic acids Sample : 0.% each, 0µL. Methyl linoleate. Methyl palmitate. Methyl oleate. Methyl stearate Sample : µl. Glyoxylic acid.mg/ml. Tartaric acid.9mg/ml. Malic acid.0mg/ml. Lactic acid µl/ml. Malonic acid.9mg/ml. Acetic acid µl/ml. Succinic acid.0mg/ml. Levulinic acid.9mg/ml 9. Propionic acid µl/ml Column : Shodex RSpak DS- Eluent : H O/CH CN/THF=//0 Flow rate :.0mL/ Detetor : RI Column temp. : 0 C Column : Shodex RSpak DE- Eluent : 0mM H PO aq. Flow rate :.0mL/ Column temp. : 0 C Food additives (Preservatives) Diols Sample : 0µL. Saccharin sodium 0.00%. p-hydroxybenzoic acid 0.00%. Sorbic acid 0.0%. Benzoic acid 0.0%. Methyl paraben 0.0%. Dehydroacetic acid 0.0%. Ethyl paraben 0.0%. Propyl paraben 0.0% n= Sample : % each,.µl HO(CH)nOH Column : Shodex RSpak DE- Eluent : 0mM KH PO + 0.% H PO aq. /CH CN=/ Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C 0 0 Column : Shodex RSpak DE- Eluent : H O Flow rate :.0mL/ Column temp. : 0 C

17 LC/MS analysis of organic acids 0 9 Ao acids Glyoxylic acid Pyruvic acid Glycolic acid Lactic acid Maleic acid Succinic acid Fumaric acid Adipic acid Sample : 0.% each, 0µL. Aspartic acid. Glycine. Alanine. Valine. Methionine. Isoleucine ( ) ( ) ( ) 9 ( ) ( ) ( ) ( ) ( ) Sample : 0ng/mL each, 0µL Column : Shodex RSpak DE- Eluent : (A); 0.% (v/v) Formic acid aq./(b); CH CN Linear gradient; (B%) % (0) % () % (.) % (0) Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C Speciation of arsenic Arsenic standards Carnitine Sample : 0µL. L-Carnitine 0.% N + OH O OH Column : Shodex RSpak NN- Eluent : 0.M H PO aq. Flow rate :.0mL/ Detector : UV (0nm) Column temp. : C Sample : Arsenic standards, 0µL. Monomethylarsonic acid. Arsinic acid. Dimethylarsinic acid. Arsenobetaine. Tetramethylarsonium. Trimethylarsine oxide Polymer-based Reversed Phase Chromatography Columns (RSpak) sec Urine of an arsenic poisoned patient 000 Urine of a healthy person Column : Shodex RSpak NN- Eluent : 0mM H PO aq. Flow rate :.0mL/ Column temp. : 0 C sec Column : Shodex RSpak NN- Eluent : mm HNO /mm NH NO aq. Flow rate : 0.mL/ Detector : ICP-MS (SIM m/z ) sec Source: Noriko Tsunoda, Pharmacia. 99, vol., No., p.- Phenylenediae isomers High sensitive analysis of bromate by LC/MS/MS Sample : 00mg/L each, 0µL. p-phenylenediae. m-phenylenediae. o-phenylenediae > () () Sample : µl Standard solution. ClO - 0.0mg/L. NO - 0.mg/L. BrO - 0.0mg/L. Br - 0.mg/L. Cl - 0.mg/L. SO - 0.mg/L Peak area BrO - R² = 0.99 > () 9 () Concentration (mg/l) 0.0 () 9 () 0 0 Column : Shodex RSpak JJ-0 D Eluent : mm Ammonium acetate buffer (ph9.)/ch CN=0/0 Flow rate : 0.mL/ Detector : UV (nm) Column temp. : 0 C Column Eluent : Shodex RSpak JJ-0 D : (A); 00mM HCOONH aq./(b); CH CN Linear gradient (High pressure); (B%) % (0) % () 0% (9) 0% () % () % (0) : 0.mL/ Flow rate Detector : ESI-MS/MS (MRM) for ClO -, BrO - ESI-MS (SIM) for NO -, Br -, Cl -, SO - Column temp. : 0 C

18 Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak) Features VG-0 VT-0 VC-0 VN-0 Suitable for saccharides analysis using HILIC mode Recovers reducing saccharides with high ratio Polymer-based packing material provides excellent chemical stability and imum deterioration over extended time period Easily regenerated by washing in an alkaline solution Appropriate for evaporative light scattering detector, corona charged aerosol detector, and LC/MS Suitable for anionic substances analysis using HILIC mode Use of some eluents add ion exchange mode Polymer-based packing material provides excellent chemical stability and imum deterioration over extended time period Suitable for LC/MS analysis Modified carboxyl group is suitable for cationic substance analysis including aes The doant separation mode is RP or IEX rather than HILIC mode The modified diol groups on the packing material create the HILIC mode Suitable for oligosaccharide separation which is not possible by SEC column or conventional HILIC columns Standard columns VG-0 (Housing Material: SUS) Functional Group Shipping Solvent F000 HILICpak VG-0 D,00 Ao H O/CH CN=0/0 F000 HILICpak VG-0 E,00 Ao H O/CH CN=0/0 F00 HILICpak VG-0G A Ao H O/CH CN=0/0 (Housing Material: PEEK) Base Material: Polyvinyl alcohol Functional Group Shipping Solvent F000 HILICpak VG-0 D,00 Ao H O/CH CN=/ F00 HILICpak VG-0G A Ao H O/CH CN=/ VT-0 (Housing Material: PEEK) Base Material: Polyvinyl alcohol Functional Group Shipping Solvent F000 HILICpak VT-0 D,00 Quaternary ammonium mm HCOONH aq. /CH CN=/ F00 HILICpak VT-0G A Quaternary ammonium mm HCOONH aq. /CH CN=/ VC-0 (Housing Material: PEEK) Base Material: Polyvinyl alcohol Functional Group Shipping Solvent F000 HILICpak VC-0 D,00 Carboxyl H O F00 HILICpak VC-0G A Carboxyl H O VN-0 (Housing Material: PEEK) Base Material: Polyvinyl alcohol Functional Group Shipping Solvent F000 HILICpak VN-0 D,00 Diol H O/CH CN=/ F00 HILICpak VN-0G A Diol H O/CH CN=/ F000 HILICpak VN-0 D 0,000 Diol H O/CH CN=/ F00 HILICpak VN-0G A Diol H O/CH CN=/ Base Material: Polyvinyl alcohol

19 Recovery of reducing sugar Silica-based ao column (company-a) (.mm I.D. x 0mm) Sample : mg/ml each, µl. Fructose. Mannose. Glucose. Sucrose VG-0 D (.mm I.D. x 0mm) Silica-based ao column (company-b) (.mm I.D. x 0mm) VG-0 D Silica-based Silica-based Ao Column Ao Column Column : Shodex HILICpak VG-0 D (company-a) (company-b) Silica based ao columns from other manufacturers Eluent : H O/CH CN=0/0 Flow rate : 0.mL/ (VG-0 D).0mL/ (Silica based ao column) Column temp. : 0 C Lactose, epilactose, and aactulose When an ao column is used for analyzing saccharides, the recovery ratio of reducing saccharides such as mannose, arabinose or xylose is low because the ao group forms Schiff base with reducing saccharides. HILICpak VG-0 is an ao column with improved reducing saccharides' recovery ratios. Improved recovery ratio results in enhancing the sensitivity of the analysis. Recovery of Mannose (%) Sample : mg/ml each, µl. Lactulose. Epilactose. Lactose Rare sugar N R N R N R Column : Shodex HILICpak VG-0 E Eluent : H O/CH CN/CH OH=//0 Flow rate : 0.mL/ Column temp. : 0 C Melae and related substances Sample : 0.% each, 0µL. L-Ribose. D-Psicose. D-Xylitol. D-Tagatose. D-Allose. L-Glucose Sample : 0µL, µg/ml each (in H O/CH CN=0/0) No. R Melae Ammeline Cyanuric acid Ammelide NH OH OH OH R NH NH OH OH R NH NH OH NH Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak) Column : Shodex HILICpak VG-0 E Eluent : H O/CH CN/CH OH=//0 Flow rate :.0mL/ Column temp. : 0 C Column : Shodex HILICpak VG-0 D Eluent : 0mM HCOONH aq./ch CN=/ Flow rate : 0.mL/ Detector : Corona charged aerosol Column temp. : 0 C Simultaneous analysis of saccharides, organic acids and ao acids with LC/MS Leu Ile Phe Met Val Pro Trp Ala Thr Gly Ser Lys + Gln Asn His Arg Tyr Glu Asp Cys m/z 0 ( ) ( ) ( ) ( ) ( ) 0 ( ) ( ) ( ) ( ) 0 ( ) ( ) ( ) ( ) ( ) 0 ( ) ( ) ( ) 9 ( ) Pyruvic acid Lactic acid Glyceric acid Malic acid Tartaric acid Malonic acid Oxalic acid m/z ( ) 9 ( ) 0 ( ) ( ) 9 ( ) 0 ( ) Maleic acid Citric acid meso-erythritol Arabinose + Xylose N-Acetylglucosae ( ) 9 ( ) ( ) 9 ( ) 0 ( ) Fructose, Mannose, Glucose 9 ( ) Glucosae ( ) Sucrose + Lactose Maltose Raffinose ( ) 0 ( ) Glucuronic acid Galacturonic acid 9 ( ) Sample : µg/ml each (in H O/CH CN=/), µl VG-0 D allows simultaneous analysis of saccharides, organic acids and ao acids with LC/MS detection under alkaline conditions. High anionic substances elute under alkaline conditions. Furthermore, alkaline conditions promote the deprotonation of hydroxyl groups at the time of ionization. Therefore, alkaline conditions are suitable for high sensitive detection of substances with hydroxyl groups such as saccharides under the negative mode. Column : Shodex HILICpak VG-0 D Eluent : (A); 0.% NH aq./(b); CH CN Linear gradient (High pressure); (B%) 0% (0 to ), 0% to 0% ( to ), 0% ( to ), 0% ( to 0) Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C

20 LC/MS/MS analysis of organic sulfonic acids LC/MS analysis of pantothenic acid and vita C Sample : µl 0.0µM each (in H O/CH CN=/). Taurine. Taurocholic acid Sample : 00ng/mL each, 0µL. Vita B (Pantothenic acid) as Calcium pantothenate. Vita C (Ascorbic acid) > 0 ( ) 0 (+) ( ) > ( ) Column : Shodex HILICpak VT-0 D Eluent : 0mM HCOONH aq./ch CN=0/0 Flow rate : 0.mL/ Detector : ESI-MS/MS (MRM) Column temp. : 0 C Column : Shodex HILICpak VT-0 D Eluent : 0mM HCOONH aq./ch CN=0/0 Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C LC/MS analysis of glyphosate and glufosinate LC/MS analysis of phosphorylated saccharides AMPA (Aomethylphosphonic acid) Sample : µg/ml each, µl 0 ( ) Sample : µm each, µl. Glucose--phosphate (GP). Fructose--phosphate (FP). Glucose--phosphate (GP). Fructose--phosphate (FP) Glufosinate (+) Glyphosate ( ) MPPA (-Methylphosphinicopropionic acid) (+) 9 ( ) Column : Shodex HILICpak VT-0 D Eluent : H O/% HCOOH aq./ch CN=0/0/0 Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C Column : Shodex HILICpak VT-0 D Eluent : mm HCOONH aq./ch CN=0/0 Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C LC/MS analysis of aoglycoside antibiotics LC/MS/MS analysis of histae and histidine 9 ( ) HSO - Sample : Aoglycoside antibiotics 0.µg/mL (in H O), 0µL Sample : ng/ml each (in H O), 0µL Histae (+) (+) (+) Kanamycin Tobramycin Gentamicin N H N Histidine O OH NH N H N NH (+) Neomycin (+) Amikacin 0 0 Column : Shodex HILICpak VC-0 D Eluent : (A);.% NH aq./(b); CH CN Linear gradient (High pressure); (B%) 0% to 0% (0 to ), 0% ( to ) Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C > 0 (+) > 9 (+) 0 0 Column : Shodex HILICpak VC-0 D Eluent : 0mM HCOOH aq./ch CN=0/0 Flow rate : 0.mL/ Detector : ESI-MS/MS (MRM) Column temp. : 0 C

21 LC/MS/MS analysis of monoae neurotransmitters 0 > 0 (+) > (+) > 9 (+) > 0 (+) > 9 (+) HO > (+) Noradrenaline HO Adrenaline HO Dopae HO Serotonin N H N N H NH Histae NH > 0 (+) 0 > (+) > 9 (+) 0 > (+). ( ) 9. ( ). ( ). ( ) 90. ( ) 0. ( ) Acarbose Miglitol Voglibose Metfor OH O N N OH O N NH HO HO HO HO Column : Shodex HILICpak VC-0 D Eluent : (A); 00mM HCOOH aq./(b); CH CN Linear gradient (High pressure) ; (B%) 0% (0 to ), 0% to 0% ( to ), 0% ( to 0) Flow rate : 0.mL/ Detector : ESI-MS/MS (MRM) Column temp. : 0 C OH OH NH NH NH LC/MS/MS analysis of ribavirin Sample : 0µL 0.µM each (in H O) Sample : µl. Ribavirin 0.ng/mL (in H O/CH CN=/) LC/MS/MS analysis of oral anti-diabetes drugs Column : Shodex HILICpak VC-0 D Eluent : (A); 00mM HCOOH aq./(b); CH CN Linear gradient (High pressure) ; (B%) 0% (0 to ), 0% to 0% ( to ), 0% ( to 0) Flow rate : 0.mL/ Detector : ESI-MS/MS (MRM) Column temp. : 0 C LC/MS analysis of oligo DNA Sample : µl Synthesized oligo DNA 0mer (ATACCGATTAAGCGAAGTTT; crude).mg/ml (in H O) mer (TT) mer (TTT) mer (GTTT) mer (AGTTT) mer (AAGTTT) mer (GAAGTTT) Sample : µl ng/ml each (in H O) Monitored ions -mer : [M-H] - -mer : [M-H] - -9mer : [M-H] - 0mer : [M-H] - Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak) ( ) mer (CGAAGTTT) Column : Shodex HILICpak VC-0 D Eluent : 0mM HCOOH aq./ch CN=0/90 Flow rate : 0.mL/ Detector : ESI-MS/MS (MRM) Column temp. : 0 C. ( ). ( ).0 ( ) 9mer (GCGAAGTTT) 0mer (AGCGAAGTTT) mer (AAGCGAAGTTT). ( ) mer (TAAGCGAAGTTT) Hydrolyzed dextran.9 ( ) mer (TTAAGCGAAGTTT) Degree of polymerization (Dp) Sample : 0µL Hydrolyzed dextran 0.% (in H O/CH CN=0/0). ( ).0 ( ) mer (ATTAAGCGAAGTTT) mer (GATTAAGCGAAGTTT) Dp 0 Enlarged view. ( ). ( ) mer (CGATTAAGCGAAGTTT) mer (CCGATTAAGCGAAGTTT) 9.0 ( ) mer (ACCGATTAAGCGAAGTTT) ( ). ( ) 9mer (TACCGATTAAGCGAAGTTT) 0mer (ATACCGATTAAGCGAAGTTT) Column : Shodex HILICpak VN-0 D Eluent : (A); H O/(B); CH CN Linear gradient ; (B)0% to 0% (0 to 0) Flow rate :.0mL/ Detector : Corona charged aerosol Column temp. : 0 C Column : Shodex HILICpak VN-0 D Eluent : (A); 0mM HCOONH aq./(b); CH CN Linear gradient ; (B%) 0% (0 to 0), 0% to % (0 to ), 0% ( to 0) Flow rate : 0.mL/ Detector : ESI-MS (SIM) Column temp. : 0 C 9

22 Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (Asahipak) Features NHP NHP-0 Suitable for saccharides analysis using HILIC mode Polymer-based packing material provides excellent chemical stability and imum deterioration over extended time period Easily regenerated by washing in an alkaline solution Appropriate for evaporative light scattering detector, corona charged aerosol detector, and LC/MS Fulfills USP L requirements Provides higher theoretical plate number than NHP-0 series Standard columns Functional Group Shipping Solvent F000 Asahipak NHP-0 B,00 Ao CH CN F000 Asahipak NHP-0 D,00 Ao CH CN F000 Asahipak NHP-0 E,00 Ao CH CN F00 Asahipak NHP-0G A Ao. 0 CH CN F000 Asahipak NHP-0 D,00 Ao CH CN F000 Asahipak NHP-0G A Ao.0 0 CH CN F000 Asahipak NHP-0 E,00 Ao CH CN F000 Asahipak NHP-0G A Ao.0 0 CH CN F000 Asahipak NHP-0 B,000 Ao CH CN F0009 Asahipak NHP-0 D,00 Ao CH CN F000 Asahipak NHP-0 E,000 Ao CH CN F000 Asahipak NHP-LF (line filter) Ao.0 CH CN Base Material: Polyvinyl alcohol mm I.D columns [Customized columns] Functional Group F00 Asahipak NHP-0 B Ao F00 Asahipak NHP-0 D Ao Base Material: Polyvinyl alcohol Preparative columns *Preparative columns are made to order. Standard Column F000 Asahipak NHP-0 0E 0, NHP-0 F00 Asahipak NHP-0G A. 0 F00 Asahipak NHP-90 0F 0, NHP-0 F00 Asahipak NHP-0G B. 0 0

23 Fructooligosaccharide syrup 0 Sample : Fructooligosaccharide syrup,.%, 0µL. Fructose. Glucose. Sucrose. -Kestose. Nystose. -Fructofuranosyl-D-nystose 0 0 Column : Shodex Asahipak NHP-0 E Eluent : H O/CH CN=0/0 Flow rate :.0mL/ Column temp. : C Imidazole dipeptides Sample : 0µL. β-alanine 00µg/mL. -Methyl-L-histidine µg/ml. L-Anserine µg/ml. Histidine µg/ml. L-Carnosine µg/ml. Nitrate (derived from L-Anserine Nitrate) Cyclodextrins Sample : 0µg/mL each, 0µL. α-cyclodextrin. γ-cyclodextrin. β-cyclodextrin Column : Shodex Asahipak NHP-0 E Eluent : H O/CH CN=0/0 Flow rate :.0mL/ Column temp. : 0 C Simultaneous analysis of water-soluble vitas Sample : 0µL. Vita B 0µg/mL. Nicotinamide 0µg/mL. Vita B 0µg/mL. Nicotinic acid 0µg/mL. Folic acid 0µg/mL. Vita C 0µg/mL Stevioside and rebaudioside A 0 0 Ascorbic acid and erythorbic acid O=C HOC O HOC HC HCOH CHOH Sample : 0.0% each, 0µL. Stevioside. Rebaudioside A Column : Shodex Asahipak NHP-0 E Eluent : H O/CH CN=/ Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Sample : µg/ml each, 0µL. Erythorbic acid. L-Ascorbic acid O=C HOC O HOC HC HOCH CHOH Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (Asahipak) Column : Shodex Asahipak NHP-0 E Eluent : 0mM NaH PO aq./ch CN=0/0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex Asahipak NHP-0 E Eluent : 0mM H PO aq./ch CN=/ Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Column : Shodex Asahipak NHP-0 E Eluent : 0mM NaH PO + 0mM H PO aq. /CH CN=0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Comparison of saccharide analysis using corona charged aerosol detector LC/TOF-MS analysis of -ao benzoic acid derivatized sugar chains A corona charged aerosol detector measures effluents as particles. Thus, the baseline is significantly affected by all components eluted from the column. The NHP series polymer-based ao column eliates insignificant amount of interfering components from the column. This results in providing stable and low noise baseline. Sample : µl Human IgG (µg protein) AA-labeled N-Glycan * AA : -Aobenzoic acid Silica-based amide column (.mm I.D. x 0mm) Silica-based ao column (.mm I.D. x 0mm) Sample : 0µg/mL each, µl. Fructose. Glucose 0 0 NHP-0 E (.mm I.D. x 0mm) Column : Shodex Asahipak NHP-0 E Silica based ao column from other manufacturer Silica based amide column from other manufacturer Eluent : H O/CH CN=0/0 Flow rate :.0mL/ Detector : Corona charged aerosol Column temp : 0 C (NHP-0 E, Silica based ao column) 0 C (Silica based amide column) 0 0 Migration time () Column : Shodex Asahipak NHP-0 D Eluent : (A); 9% CH CN/0.% Formic acid aq. (B); % CH CN/0.% Formic acid aq. Linear gradient; (B%) 0% (0-.), 0-9% (.-0) Flow rate : 0.mL/ Detector : ESI-TOF MS (Polarity : Negative, Full MS range : 000 ) Column temp. : C Data provided by Michihiro Kinoshita Ph.D., Faculty of Pharmacy, Kinki University

24 Silica-based Reversed Phase Chromatography Columns (ODS Columns) Please refer to Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features on page and for features. Standard columns Functional Group Carbon Load (%) Shipping Solvent F00 C-D,000 Octadecyl 0. 0 H O/CH OH=/ F0 C-E,000 Octadecyl 0. 0 H O/CH OH=/ F000 Silica CM D 0,000 Octadecyl H O/CH OH=0/0 F00 Silica CM E,000 Octadecyl H O/CH OH=0/0 F00 Silica CM D 9,000 Octadecyl H O/CH CN=0/0 F00 Silica CP D 0,000 Octadecyl H O/CH OH=0/0 F00 Silica CP E,000 Octadecyl H O/CH OH=0/0 F00 Silica CP D 9,000 Octadecyl H O/CH CN=0/0 Base Material: Silica Preparative columns *Preparative columns are made to order. Standard Column F000 Silica CM 0E, CM F00 Silica CM 0E, CM Silica-based Reversed Phase Chromatography Columns (Other Columns) Please refer to Comparison of Shodex Reverse Phase Chromatography (RPC) Column Features on page and for features. Standard columns Functional Group Carbon Load (%) Shipping Solvent F00 Silica C D 9,000 Octyl H O/CH OH=/ F00 Silica C E,000 Octyl H O/CH OH=/ F00 Silica CN D,000 Cyanopropyl H O/CH OH=0/0 F009 Silica CN E,000 Cyanopropyl H O/CH OH=0/0 F00 Silica NPE D,000 Nitrophenylethyl H O/CH OH=/ F00 Silica PYE D,000 Pyrenylethyl H O/CH OH=0/0 Base Material: Silica Preparative columns *Preparative columns are made to order. Standard Column F00 Silica C 0E, C F00 Silica C 0E, C

25 Silica-based Normal Phase Chromatography and HILIC Columns Features SIL NH F000 F00 F000 F00 F000 F00 F000 F00 Packed with high purity silica (99.99% or higher) Suitable used with nonpolar organic solvents for normal phase analysis Fulfills USP L requirements Suitable for saccharides analysis using HILIC mode Fulfills USP L requirements Standard columns Silica SIL D Silica SIL E Silica NH D Silica NH E 9,000,000,000,000 Functional Group Aopropyl Aopropyl Carbon Load (%) Preparative columns *Preparative columns are made to order. Silica SIL 0E Silica SIL 0E Silica NH 0E Silica NH 0E,000,000,000, Shipping Solvent C H /C H OH=9/ C H /C H OH=9/ H O/CH CN=/9 H O/CH CN=/9 Base Material: Silica Standard Column SIL SIL NH NH Silica-based Reversed Phase Chromatography Columns (ODS Columns) (Other Columns) Silica-based Normal Phase Chromatography and HILIC Columns

26 Fat-soluble vitas Anticonvulsant Sample : 0µL. Vita A 0µg/mL. Vita D µg/ml. Vita D µg/ml. Vita E 00µg/mL. Tocopherol Acetate 00µg/mL Sample : 0µL. Ethosuximide 00µg/mL. Phenytoin 0µg/mL. Phenobarbital 0µg/mL. Primidon 0µg/mL. Carbamazepine 0µg/mL 0 0 Column : Shodex C-D Eluent : CH CN Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C 0 0 Column : Shodex C-D Eluent : 00mM Phosphate buffer(ph.) /CH OH/CH CN=// Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Aflatoxins Trichothecene mycotoxins TFA method Sample : µg/l each, 0µL. Derived Aflatoxin G. Derived Aflatoxin B. Aflatoxin G. Aflatoxin B Sample : 0µL. Nivalenol (NIV). Deoxynivalenol (DON) * mg/l each of DON and NIV were added to wheat sample Reference : Shoku-An No. 0- (August, 0, Japan) "Test Methods Related to Total Aflatoxin" in Notice Reference : Shoku-An No. 000 (July, 00, Japan) Test method of deoxynivalenol Column : Shodex Silica CM E Eluent : H O/CH CN/CH OH=0/0/0 Flow rate :.0mL/ Detector : Fluorescence (Ex. : nm, Em. : 0nm) Column temp. : 0 C Column : Shodex Silica CM E Eluent : H O/CH CN/CH OH=90// Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Gingerol and shogaol Chlorogenic acid Sample : 0.mg/mL each, 0µL. -Gingerol. -Shogaol Sample : 0.mg/mL each, 0µL. Chlorogenic acid. Caffeine. Caffeic acid Column : Shodex Silica CM D Eluent : (A) ; H O (B) ; CH CN Linear gradient : (B%) 0% to 0% () Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex Silica CM D Eluent : 0mM H PO aq. /CH OH=0/0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C

27 Catechins Sample : 0µg/mL each, 0µL. Epigallocatechin. Catechin. Epigallocatechingallate. Epicatechin. Epicatechingallate. Catechingallate Column : Shodex Silica CP D Eluent : (A) ; 0mM H PO aq./(b) ; CH CN Linear gradient: (B%) 0% (0 to ), 0 to 0% ( to ), 0% ( to 0) Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Analysis of glucosae following USP method Column : Shodex Silica NH D Eluent : *Buffer(pH.)/CH CN=0/0 *Buffer ; in a -L volumetric flask, dissolve.g K HPO in water. Add 0.mL Ammonium hydroxide (%), dilute with water to volume, and mix. Adjusted with H PO to a ph. Flow rate :.ml/ Detector : UV (9nm) Column temp. : C Dinitronaphthalene isomers Sample : 0µL. mg/ml Glucosae hydrochloride (in HO/CH CN=/). Cl -. Glucosae Sample :. Naphthalene.,-Dimethylnaphthalene.,-Dinitronaphthalene.,-Dinitronaphthalene Estrogens Column : Shodex Silica CP D Eluent : H O/CH CN=/ Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Benzylpyridine isomers Column : Shodex Silica PYE D Eluent : 0mM KH PO aq./ch OH=0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Sample : 0.mg/mL each, 0µL. Estriol. β-estradiol. Estrone Simultaneous analysis of vita E homologs Sample :. -Benzylpyridine. -Benzylpyridine. -Benzylpyridine Sample : 0µL. α-tocopherol µg/ml. α-tocotrienol 0µg/mL. β-tocopherol µg/ml. γ-tocopherol µg/ml. γ-tocotrienol 0µg/mL. δ-tocopherol µg/ml. δ-tocotrienol 0µg/mL Silica-based Reversed Phase Chromatography Columns (ODS Columns) (Other Columns) Silica-based Normal Phase Chromatography and HILIC Columns Column : Shodex Silica NPE D Eluent : H O/CH OH=0/0 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Column : Shodex Silica SIL D Eluent : n-hexane/isopropanol/ch COOH=000// Flow rate :.0mL/ Detector : Fluorescence (Ex. : 9nm, Em. : nm) Column temp. : 0 C

28 Ligand Exchange Chromatography Columns Lists summarizing elution volumes of various saccharides using Shodex columns is available. Please refer to our website ( or technical notebook (No. and ). Features SC0 SC SP00 KS-0 to 0 Separates saccharides by combination of ligand exchange and size exclusion modes Three types of counter ions are available: Ca +, Pb +, and Na+ Only water is required for the analysis of neutral sugars SC0 and SC fulfill USP L9 and L requirements SP00 fulfills USP L and L requirements KS-0 and KS-0 fulfill USP L and L requirements KS-0 to 0 DC- SZ SC SC0-F Suitable for separation of polysaccharides by size exclusion mode Can be used in combination with other columns e.g., KS-0 and KS-0 Only water is required for the analysis of neutral sugars Fulfills USP L and L requirements Separates elements by combination of ligand exchange and HILIC modes DC- can analyze sugars without removing sodium salts in the sample SZ is recommended for the separation of disaccharides or trisaccharides SC is suitable for separating sugar alcohols DC- fulfills USP L and L requirements SZ fulfills USP L requirements SC fulfills USP L9 and L requirements Fulfills mannitol analysis requirements of JP, USP, and EP methods Ca + modified ligand exchange chromatography column Only water is required for the analysis of neutral sugars Fulfills USP L9 and L requirements Standard columns [ Ligand exchange and size exclusion] Functional Group (Counter Ion) Exclusion Limit (Pullulan) Shipping Solvent F0 SUGAR SC0,000 Sulfo (Ca + ), H O F0 SUGAR SC,000 Sulfo (Ca + ) 0, H O F00090 SUGAR SC-G B (SUGAR SC-LG) Sulfo (Ca + ) H O F0 SUGAR SP00,000 Sulfo (Pb + ), H O F000 SUGAR SP-G B (SUGAR SP-G) Sulfo (Pb + ) H O F00 SUGAR KS-0,000 Sulfo (Na + ), H O F00 SUGAR KS-0,000 Sulfo (Na + ) 0, H O F0 SUGAR KS-0,000 Sulfo (Na + ) 0, H O F0 SUGAR KS-0,000 Sulfo (Na + ) 00, H O F00 SUGAR KS-0 9,000 Sulfo (Na + ),000, H O F00 SUGAR KS-0 9,000 Sulfo (Na + ) *(0,000,000).0 00 H O F0000 SUGAR KS-G B (SUGAR KS-G) Sulfo (Na + ) H O [ Ligand exchange and HILIC] *( ) Estimated value Base Material: Styrene divinylbenzene copolymer Functional Group (Counter Ion) Shipping Solvent F0000 RSpak DC-,00 Sulfo (Na + ) H O/CH CN=0/0 F000 RSpak DC-G A (RSpak DC-G) Sulfo (Na + ) 0. 0 H O/CH CN=0/0 F0000 SUGAR SZ,00 Sulfo (Zn + ).0 0 H O/CH CN=0/0 F000 SUGAR SZ-G Sulfo (Zn + ). 0 H O/CH CN=0/0 F0000 SUGAR SC,00 Sulfo (Ca + ) H O/CH CN=/ F000 SUGAR SCG A (SUGAR SC-G) Sulfo (Ca + ) 0. 0 H O/CH CN=/ Base Material: Styrene divinylbenzene copolymer

29 For mannitol analysis following JP, USP, and EP methods F000 F000 F0009 F000 F00 F00 F900 EP SC0-F SUGAR SC-G B F00090 (SUGAR SC-LG) F90 USPpak MN- *See page 9 for USP0-NF Column List. SUGAR KS-00 SUGAR KS-00 SUGAR KS-00 SUGAR KS-00 SUGAR KS-00 SUGAR KS-00 Functional Group (Counter Ion) Sulfo (Ca + ) Sulfo (Ca + ) Sulfo (Ca + ),000,000,000,000,000,000 Preparative columns *Preparative columns are made to order. [ Ligand exchange and size exclusion] Shipping Solvent H O H O.0 0 H O Base Material: Styrene divinylbenzene copolymer Standard Column KS-0 KS-0 KS-0 KS-0 KS-0 KS-0 Ligand Exchange Chromatography Columns F0000 SUGAR KS-G B (SUGAR KS-LG).0 0 [ Ligand exchange and HILIC] Standard Column F0 RSpak DC-0, DC- F000 RSpak DC-G B (RSpak DC-LG) Elution volumes of saccharides analyzed by Shodex columns [Partial list only; refer to our website for complete list] Elution Volume (ml) Elution Volume (ml) Substances SP00 SC0 KS-0 SZ NHP-0 SC E Substances SP00 SC0 KS-0 SZ NHP-0 SC E Arabinose D-Mannose D-Arabitol Melibiose Dulcitol Nystose * meso-erythritol Palatinit peaks peaks.90 peaks. peaks D(-)-Fructose Palatinose D(+)-Fucose Panose * D(+)-Galactose D(+)-Raffinose * Gentiobiose * Rhamnose Glucose D(-)-Ribose myo-inositol D(-)-Sorbitol Isomaltose * Sorbose Isomaltotriose * Stachyose...9. * -Kestose * Sucrose * Kojibiose * α-d-talose Lactitol Trehalose * Lactose Trehalulose Lactulose Xylitol Maltitol Xylobiose * Maltose * D(+)-Xylose Maltotriose * D-Xylulose Mannitol ( ) Not detected ( * ) Overlap with solvent peak ( ) Not detected ( * ) Overlap with solvent peak Column : SUGAR SP00, SC0, KS-0 Eluent : H O Flow rate :.0mL/ Column temp. : 0 C Column : SUGAR SC Eluent : H O/CH CN=/ Flow rate :.0mL/ Column temp. : 0 C Column : SUGAR SZ Eluent : H O/CH CN=/ Flow rate :.0mL/ Column temp. : 0 C Column : Asahipak NHP-0 E Eluent : H O/CH CN=/ Flow rate :.0mL/ Column temp. : 0 C

30 Saccharides anomer separation Calibration curves for KS-00 series using pullulan Saccharides may present their anomers at lower temperatures. By setting the SUGAR series columns at higher temperatures will prevent the anomer separation and this results in providing better chromatograms of each saccharide. Sample : 0.% each, 0µL 0 Glucose Mannose Xylose Galactose Arabinose 9 C Glucose Mannose Xylose Galactose Arabinose Molecular weight (Pullulan) KS-0 KS-0 KS-0 KS-0 KS-0 KS-0 0 C Elution volume (ml) Column : Shodex SUGAR SC0 Eluent : H O Flow rate : 0.mL/ Column temp. : 9 C, 0 C Column : Shodex SUGAR KS-00 series Eluent : H O Column temp. : 0 C Hydrolyzed starch Biomass sugars Ketohexoses Dp-0 Dp- Dp- Sample : 0µL Hydrolyzed starch % Sample : µl. Cellobiose.0%. Glucose.%. Xylose 0.%. Galactose 0.%. Arabinose 0.%. Mannose.0% Sample : 0.0% each, 0µL. Sorbose. Fructose. Tagatose. Psicose Column : Shodex SUGAR KS-0 x Eluent : H O Flow rate :.0mL/ Column temp. : 0 C Column : Shodex SUGAR SP00 Eluent : H O Flow rate : 0.mL/ Column temp. : C Column : Shodex SUGAR SP00 Eluent : H O Flow rate :.0mL/ Column temp. : 0 C Pinitol Oligosaccharides in soybean Saccharides related to raffinose biosynthesis Sample : 0.% each, 0µL. Sucrose. Glucose. Pinitol. Fructose. chiro-inositol. myo-inositol Sample : 0.% each, 0µL. Verbascose. Stachyose. Raffinose. Sucrose. Pinitol Sample : 0.% each, 0µL. Raffinose. Sucrose. Galactinol. Galactose. myo-inositol Column : Shodex SUGAR SP00 Eluent : H O Flow rate : 0.mL/ Column temp. : C Column : Shodex SUGAR KS-0 + KS-0 Eluent : H O Flow rate : 0.mL/ Column temp. : C Column : Shodex SUGAR SC0 Eluent : H O Flow rate :.0mL/ Column temp. : 0 C

31 Acesulfame K and sucralose Sample : 0µL. Acesulfame K 0.%. Sucrose 0.%. Glucose 0.%. Unknown from Acesulfame K. Fructose 0.%. Sucralose 0.% 0 0 Column : Shodex SUGAR SC0 Eluent : 0mM CaSO aq. Flow rate : 0.mL/ Column temp. : 0 C 0 Sucrose and turanose Sample : 0.% each, 0µL. Fructose. Glucose. Sucrose. Turanose. Lactose Column : Shodex SUGAR SZ Eluent : H O/CH CN=0/0 Flow rate : 0.mL/ Column temp. : 0 C Maltose and isomaltose Sample : 0.% each, 0µL. Glucose. Maltose. Isomaltose. Maltotriose. Isomaltotriose Column : Shodex SUGAR SZ Eluent : H O/CH CN=/ Flow rate :.0mL/ Column temp. : 0 C Ligand Exchange Chromatography Columns Saccharides and sugar alcohols Saccharides and taurine Sample : 0.% each, 0µL. Rhamnose. Xylose. Arabinose. Fructose. Glucose. Galactose. Arabitol. Xylitol 9. Mannitol 0. Sorbitol Sample : 0.% each, 0µL. Sucrose. Glucose. Fructose. Taurine. myo-inositol Column : Shodex SUGAR SZ Eluent : H O/CH CN=0/0 Flow rate :.0mL/ Column temp. : C Column : Shodex SUGAR SC Eluent : H O/CH CN=0/0 Flow rate : 0.mL/ Column temp. : 0 C Moisturizing components Mannitol and sorbitol Sample : 0.% each, 0µL.,-Propanediol. Propylene glycol. Ethylene glycol. Glycerin. meso-erythritol Partial modifications on the analytical conditions of mannitol stated in the United States Pharmacopeia (USP, USP-NF) became effective on December st, 0. Now for the separation of mannitol and sorbitol, USP, European Pharmacopeia (EP), and Japanese Pharmacopeia (JP) request to use a column having resolution more than.0. SC0-F fulfills the conditions required from USP, EP, and JP. Sample : mg/ml each, 0µL. Mannitol. Sorbitol Resolution (Mannitol/Sorbitol) Column : Shodex SUGAR SC Eluent : H O/CH CN=0/0 Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex EP SC0-F Eluent : H O Flow rate : 0.mL/ Column temp. : C 9

32 Ion Exclusion Chromatography Columns Features SH0 SH KC- Columns for simultaneous analysis of saccharides and organic acids Separates neutral sugars in size exclusion mode and organic acids in ion exclusion mode Suitable for the analysis of uronic and aldonic acids Fulfills USP L and L requirements Columns suitable for the analysis of organic acids Separates compounds by ion exclusion mode and reversed phase mode Highly selective when used with post column method KC- E is suitable for the analysis of cyanide ions and cyanogen chloride in accordance with the Japanese Water Supply Act Fulfills USP L and L requirements Standard columns [ For simultaneous analysis of saccharides and organic acids] Functional Group Exclusion Limit (Pullulan) Shipping Solvent F00 SUGAR SH0,000 Sulfo, H O F0 SUGAR SH,000 Sulfo 0, H O F0000 SUGAR SH-G Sulfo H O Base Material: Styrene divinylbenzene copolymer [ For organic acids, cyanide ions and cyanogen chloride] Functional Group Shipping Solvent F00 RSpak KC-,000 Sulfo % H PO aq. F0 RSpak KC- E,000 Sulfo % H PO aq. F0000 RSpak KC-G B (RSpak KC-G) Sulfo % H PO aq. F0000 RSpak KC-G B (RSpak KC-LG) Sulfo % H PO aq. *Use KC-G B for samples with relatively high impurity and KC-G B for samples with relatively low impurity. Base Material: Styrene divinylbenzene copolymer Preparative columns *Preparative columns are made to order. Standard Column F00 RSpak KC-0, KC- F0000 RSpak KC-G B (RSpak KC-LG).0 0 0

33 Maltooligosaccharides, organic acids and ethanol Sample : 0.0% each, 0µL. Maltotetraose. Maltotriose. Maltose. Glucose. Lactic acid. Glycerol. Acetic acid. Methanol 9. Ethanol Cello-oligosaccharides and furfurals Sample : 0.% each, 0µL. Cellopentaose. Cellotetraose. Cellotriose. Cellobiose. Glucose. Glyceric acid. Acetic acid. -HMF 9. Furfural Glycerin and glyceric acid Sample : 0.% each, 0µL. Glyceric acid. Glycerin HOCH CH(OH)CH OH HOCH CH(OH)COOH Ion Exclusion Chromatography Columns Column : Shodex SUGAR SH Eluent : 0.mM H SO aq. Flow rate : 0.mL/ Column temp. : C Column : Shodex SUGAR SH Eluent : mm H SO aq. Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex SUGAR SH0 Eluent : mm H SO aq. Flow rate : 0.mL/ Column temp. : 0 C Common organic acids Hydrophobic organic acids Glucronolactone and organic acids Sample :. Citric acid. Tartaric acid. Pyruvic acid. Malic acid. Succinic acid. Glycolic acid. Lactic acid. Fumaric acid 9. Acetic acid 0. Levulinic acid. Pyroglutamic acid. Propionic acid. Isobutyric acid. n-butyric acid 9 0 Eluent = mm HClO aq. 0 Sample :. Succinic acid. Lactic acid. Formic acid. Acetic acid. Propionic acid. Isobutyric acid. n-butyric acid. Isovaleric acid 9. n-valeric acid 0 0 To shorten analysis time 9 Sample : 0µL. Citric acid 0.0%. Malic acid 0.0%. Glucronolactone 0.0%. Glycerin 0.0%. Ethanol 0.0% Eluent = mm HClO aq./ch CN=90/ Column : Shodex RSpak KC- x Eluent : mm HClO aq. Flow rate :.0mL/ Detector : VIS (0nm) post column method Column temp. : 0 C Column : Shodex RSpak KC-LG + KC- x Flow rate :.0mL/ Detector : VIS (0nm) post column method Column temp. : C Column : Shodex RSpak KC- Eluent : mm HClO aq. Flow rate :.0mL/ Column temp. : 0 C Organic acids in sake Analysis of Cyanide ion and cyanogen chloride with post column method Sample : 00µL. Phosphoric acid etc.. Citric acid. Pyruvic acid. Malic acid. Succinic acid. Lactic acid. Fumaric acid. Acetic acid 9. Pyroglutamic acid Fine rice wine Fermented liquor Pure rice wine CN - Sample : 0µg/L each, 00µL CNCl Column : Shodex RSpak KC-LG + KC- x Eluent :.mm HClO aq. Flow rate :.0mL/ Detector : VIS (0nm) post column method Column temp. : C Column Eluent Reagent A Reagent B Flow rate : Shodex RSpak KC- E :.0mM H SO aq. : Chlorae T solution : -Pyridinecarboxylic acid-pyrazolone solution : (Eluent).0mL/ (Reagent) 0.mL/ each : VIS (nm) Detector Column temp. : 0 C Reaction temp. : (Reagent A) 0 C (Reagent B) 0 C

34 Ion Chromatography Columns (Anion Analysis) Features NI- I-A SI-90 E SI-0 E SI- E SI- Columns for anion analysis with non-suppressor method NI- provides simultaneous analysis of fluoride and phosphate ions Columns for anion analysis with suppressor method Suitable for the quantitative analysis of fluoride ion SI-0 separates target inorganic anions from organic acids Not interfered by the system peak derived from carbonate Column for the analysis of oxyhalides with suppressor method Provides simultaneous analysis of oxyhalides and general inorganic ions Columns for rapid analysis with suppressor method SI- D provides rapid analysis of oxyhalides and general inorganic ions SI- B provides rapid analysis of general inorganic ions Standard columns [ For anion non-suppressor method] Functional Group Particle Size Column Size (mm) Shipping Solvent F99 F09 IC NI- IC NI-G,000 Quaternary ammonium Quaternary ammonium mm -Hydroxybenzoic acid +.mm Bis-Tris + mm Phenylboronic acid mM CyDTA aq. mm -Hydroxybenzoic acid +.mm Bis-Tris + mm Phenylboronic acid mM CyDTA aq. F990 IC I-A,000 Quaternary ammonium. 00.mM Phthalic acid aq. F0000 IC IA-G Quaternary ammonium. 0.mM Phthalic acid aq. [ For anion suppressor method] Base Material: Polyhydroxymethacrylate Housing Material: SUS Functional Group Particle Size Column Size (mm) Shipping Solvent F99 IC SI-90 E,000 Quaternary ammonium mM Na CO +.mm NaHCO aq. F090 IC SI-90G Quaternary ammonium 9. 0.mM Na CO +.mm NaHCO aq. F99 IC SI-0 E 0,000 Quaternary ammonium.0 0.mM Na CO +.0mM NaHCO aq. F09 IC SI-0G Quaternary ammonium. 0.mM Na CO +.0mM NaHCO aq. [ For oxyhalides suppressor method] Base Material: Polyvinyl alcohol Housing Material: PEEK Functional Group Particle Size Column Size (mm) Shipping Solvent F990 IC SI- E,000 Quaternary ammonium.0 0.mM Na CO aq. F09 IC SI-9G Quaternary ammonium 9. 0.mM Na CO aq. [ For rapid suppressor method] Base Material: Polyvinyl alcohol Housing Material: PEEK Functional Group Particle Size Column Size (mm) Shipping Solvent F9990 IC SI- D,000 Quaternary ammonium..0 0.mM Na CO aq. F09 IC SI-9G Quaternary ammonium 9. 0.mM Na CO aq. F999 IC SI- B,000 Quaternary ammonium mM Na CO +.0mM NaHCO aq. Guard filter for SI- B Base Material: Polyvinyl alcohol Housing Material: PEEK Contents F090 F090 IC SI-GF IC SI-GF filter One holder and one filter filters Removes insoluble components in the sample Line filters for IC Contents F000 IC FL- One holder and one filter F000 IC FL- filter filters *Attach directly to attach directly to analysis column Removes insoluble components in the eluent by installing it upstream of the injector

35 Anion analysis using NI- and I-A (non-suppressor methods) 0 NI- Sample : 0µL. HPO - 0mg/L. F - mg/l. CI - mg/l. NO - mg/l. Br - mg/l. NO - mg/l. SO - mg/l Column : Shodex IC NI- Eluent : mm -Hydroxybenzoic acid +.mm Bis-Tris + mm Phenylboronic acid mM *CyDTA aq. Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : 0 C *CyDTA : trans-,-diaocyclohexane-n,n,n',n'-tetra acetic acid, I-A Column : Shodex IC I-A Eluent :.mm Phthalic acid +.mm Tris(hydroxymethyl)aomethane aq. Flow rate :.ml/ Detector : Non-suppressed conductivity Column temp. : 0 C With twice increased theoretical plate number, NI- provides a higher performance compared to I-A. [Features of NI-] () Enables the separation of H PO - and F - which were difficult to separate with I-A. () Provides sharper peaks, and resolution between all peaks are well defined. Especially, the separation of Cl - and NO - is improved. Ion Chromatography Columns (Anion Analysis) Anion analysis using SI-90 E (suppressor method) Anion analysis using SI-0 E (suppressor method) Oxyhalides and anion analysis using SI- E (suppressor method) Sample : 0µL. F - mg/l. Cl - mg/l. NO - mg/l. Br - 0mg/L. NO - 0mg/L. HCO - 00mg/L. PO - mg/l. SO - mg/l SI-0 E is a high performance type of SI-90 E. Acetic acid, formic acid, and methacrylic acid eluted between F - and Cl -. The carbonate system peak appears between NO - and Br - peaks. Sample : 0µL. F - mg/l. Acetic acid 0mg/L. Formic acid mg/l. Methacrylic acid 0mg/L. Cl - mg/l. NO - mg/l. Br - 0mg/L. NO - 0mg/L 9. PO - mg/l 0. SO - mg/l. Oxalic acid mg/l 9 0 SI- E is a high resolution column offering,000 or higher theoretical plate number. It supports simultaneous analysis of oxyhalides and inorganic anions. It is recommended to set the column temperature at C. Sample : 0µL. F - mg/l. ClO - mg/l. BrO - mg/l. Cl - 0mg/L. NO - mg/l. Br - 0mg/L. ClO - mg/l. Dichloroacetic acid mg/l 9. NO - 0mg/L 0. PO - mg/l. SO - 0mg/L Column : Shodex IC SI-90 E Eluent :.mm Na CO +.mm NaHCO aq. Flow rate :.ml/ Detector : Suppressed conductivity Column temp. : Room temp. ( C) Column : Shodex IC SI-0 E Eluent :.mm Na CO +.0mM NaHCO aq. Flow rate : 0.mL/ Detector : Suppressed conductivity Column temp. : C Column : Shodex IC SI- E Eluent :.mm Na CO aq. Flow rate : 0.mL/ Detector : Suppressed conductivity Column temp. : C Rapid analysis of oxyhalides and anions using SI- D (suppressor method) Tricarboxylic acids analysis (suppressor method) Rapid analysis of anions using SI- B (suppressor method) Sample : 0µL. F - mg/l. ClO - mg/l. BrO - mg/l. Cl - 0mg/L. NO - mg/l. Br - 0mg/L. ClO - mg/l. NO - 0mg/L 9. PO - mg/l 0. SO - 0mg/L 0 Sample : 0µL. Citric acid 0mg/L. Isocitric acid 0mg/L. trans-aconitic acid 0mg/L. cis-aconitic acid 0mg/L Sample : µl. F - mg/l. Cl - mg/l. NO - mg/l. Br - mg/l. NO - mg/l. PO - mg/l. SO - mg/l Column : Shodex IC SI- D Eluent :.0mM Na CO +.mm NaHCO aq. Flow rate : 0.mL/ Detector : Suppressed conductivity Column temp. : C Column : Shodex IC SI- D Eluent : 9.0mM Na CO aq. Flow rate : 0.mL/ Detector : Suppressed conductivity Column temp. : C Column : Shodex IC SI- B Eluent :.0mM Na CO +.0mM NaHCO aq. Flow rate : 0.mL/ Detector : Suppressed conductivity Column temp. : 0 C

36 Ion Chromatography Columns (Cation Analysis) Features YS-0 YK- High performance type of YK- Applicable to both suppressor and non-suppressor methods Provides sharp peaks; more significant for divalent cation analysis Supports the analysis of alkylaes and transition metals Column for cation analysis with non-suppressor method Simultaneous analysis of monovalent and divalent cations Suitable separating of alkylaes Fulfills USP L requirements Y- Column for cation analysis with non-suppressor method Separates monovalent cations or divalent cations Fulfills USP L and L requirements T- Column for transition metal ion analysis Highly sensitive analysis achievable using post column color reaction method Standard columns [ For cations] Functional Group Base Material Particle Size Column Size (mm) Shipping Solvent F000 IC YS-0,00 Carboxyl Polyvinyl alcohol. H O F000 IC YS-G Carboxyl Polyvinyl alcohol. 0 H O F00 IC YK-,00 Carboxyl Silica. mm Tartaric acid + mm Dipicolinic acid +.g/l Boric acid aq. F090 IC YK-G Carboxyl Silica. 0 mm Tartaric acid + mm Dipicolinic acid +.g/l Boric acid aq. F990 IC Y-,000 Sulfo Styrene divinylbenzene copolymer. 0 mm HNO aq. F000 IC Y-G Sulfo Styrene divinylbenzene copolymer. 0 mm HNO aq. Housing Material: SUS [ For transition metal ions] Functional Group Shipping Solvent F990 IC T-,000 Sulfo. 0 mm HNO aq. F00 IC T-G Sulfo. 0 mm HNO aq. Base Material: Styrene divinylbenzene copolymer Housing Material: PEEK Line filters for IC Contents F000 IC FL- One holder and one filter F000 IC FL- filter filters Removes insoluble components in the eluent by installing it upstream of the injector

37 Common cations (YS-0 and YK-) 0 YS Column : Shodex IC YS-0 Eluent : mm Methanesulfonic acid aq. Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : 0 C 0µL inj. YK- µl inj. Sample :. Li + mg/l. Na + 0mg/L. NH + 0mg/L. K + 0mg/L. Mg + 0mg/L. Ca + 0mg/L With twice increased theoretical plate number, YS-0 provides a higher performance with improved peak shapes compared to YK-. The quantitation of NH + in the presence of high Na + content is also improved. Resolution (Na + and NH + ) TP Mg + Ca + Column : Shodex IC YK- Eluent : mm Tartaric acid + mm Dipicolinic acid +.g/l Boric acid aq. Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : 0 C YS-0. YS-0 YK-. YK-,900,000,00,000 Ion Chromatography Columns (Cation Analysis) Effects of added crown ether in the eluent Simultaneous analysis of cations and ethylenediae Crown ether forms complex with cations. The elution of cations (particularly K + ) can be well controlled by the difference in complex formation rate. mm Sample : 0µL. Li + mg/l. Na + 0mg/L. NH + 0mg/L. K + 0mg/L. Mg + 0mg/L. Ca + 0mg/L Sample : 0µL. Li + mg/l. Na + 0mg/L. NH + 0mg/L. K + 0mg/L. Mg + 0mg/L. Ca + 0mg/L. Ethylenediae 0mg/L -Crown -ether conc. mm mm 0mM Column : Shodex IC YS-0 Eluent : mm Methanesulfonic acid + -Crown -ether aq. Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : 0 C Column : Shodex IC YS-0 Eluent : mm HNO +.mm -Crown -ether aq. /CH CN=90/0 Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : 0 C Ao alcohols Alkylaes Alkaline earth metal ions Sample : 0µL. Monoethanolae 0µg/mL. Diethanolae 0µg/mL. N-Methylethanolae 0µg/mL. Triethanolae 0µg/mL. N-Methyldiethanolae 0µg/mL. N,N-Diethylethanolae 0µg/mL. N-(-Aoethyl)ethanolae 0µg/mL Sample : 0µL. NH + mg/l. Methylae mg/l. Dimethylae mg/l. Trimethylae 0mg/L. Ethylae 0mg/L. Propylae 0mg/L. Butylae 0mg/L Cu + Zn + Ni + Co + Mg + Fe +, Fe + Mn +, Pb + Cd + Ca + Sr + 0 Ba + Sample : 0µL. Ni + 0mg/L. Mg + 0mg/L. Mn + 0mg/L. Ca + 0mg/L Column : Shodex IC YK- Eluent : mm HNO aq. Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : 0 C 0 0 Column : Shodex IC YK- Eluent : mm H PO aq./ch CN=90/0 Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : C Column : Shodex IC Y- Eluent : mm Tartaric acid + mm Ethylenediae aq. Flow rate :.0mL/ Detector : Non-suppressed conductivity Column temp. : 0 C

38 Column Selection for Size Exclusion Chromatography (SEC) Application Solvent Column Page Biological macromolecules (proteins, peptides, nucleic acids, etc.) Buffer etc. KW-00 series LW-0 High performance KW00 series High performance (solvent-saving) Aqueous SEC (GFC) Biological macromolecules (high MW range) Water-soluble polymers (polyacrylamide, polyethylenie, etc.) Polysaccharides Buffer etc. Water, Buffer, Aqueous solution, etc. SB-00 HQ series LB-00 series SB-00 HQ series LB-00 series Oligosaccharide, polysaccharides Water, Aqueous solution, etc. KS-00 series GS-HQ series KF-00 series 0 Rapid analysis (solvent-saving) KF-00 series General polymers THF KF-00HQ series HK-00 series High performance (solvent-saving) Ultra-rapid Analysis (solvent-saving) LF series High-linear calibration curves Chloroform K-00 series KD-00 series Organic SEC (GPC) Polar polymers (polyimides, polyvinylpyrrolidones etc.) DMF HK-00 series Ultra-rapid Analysis (solvent-saving) LF series High-linear calibration curves SB-00 HQ series LB-00 series Analysis at high temperature (polyethylene, polypropylene etc.) ODCB etc. HT-00 series UT-00 series AT-0MS Engineering resin analysis at room temperature [polyamide (Nylon), polyethylene terephthalate (PET) etc.] HFIP HFIP-00 series HK-HFIP0L Rapid analysis (solvent-saving) HFIP-00 series Ultra-rapid Analysis (solvent-saving) High-linear calibration curves LF series Aqueous/Organic SEC GF-HQ series Solvent usability guideline for the Shodex SEC columns High Polarity of solvent H O Methanol DMSO Acetonitrile DMF THF Chloroform Toluene Low KW-00 series, LW-0, KW00 series SB-00 HQ series, LB-00 series GS-HQ series GF-HQ series KD series KF, K, HK, LF series *See page for the solvent replaceability of organic solvent SEC (GPC) packed columns.

39 Precautions for Polar Polymer Analysis Unexpected interactions in the column can affect the size exclusion chromatography analysis of polar polymers. These interactions may change elution patterns and results in an invalid molecular weight calculation. It is important to reduce these interfering interactions in order to obtain the accurate molecular weight distribution. Interactions between the analyte and the packing materials Hydrophobic interaction The analyte is adsorbed on the packing material. This delays the analyte elution and results in under estimating the analyte's molecular weight. See (B) and (D). Ionic interaction () Ion Exclusion The analyte is repelled from the packing material. This accelerates the analyte elution and results in over estimating the analyte's molecular weight. See (A) and (C). () Ion Exchange The analyte is adsorbed on the packing material. This delays the analyte elution and results in under estimating the analyte's molecular weight. See (B) and (D). Interaction within and between the analyte Ionic repulsion effects observed within the multivalent macromolecules causes structure expansion This accelerates the analyte elution and results in over estimating the analyte's molecular weight. See (A). Association between the molecules This accelerates the analyte elution and results in over estimating the analyte's molecular weight. See (A). Interactions between the analyte and the solvent The multivalent ion in the solvent works as a bridge to bind ionic molecules (analyte). Aqueous SEC (GFC) Interfering interactions likely to be observed Exclusion limit molecular weight log MW (C) Methods to reduce interactions Elution will be accelerated Exclusion limit volume (A) Elution will be retarded Organic solvent SEC (GPC) (B) Permeation limit volume (D) Column Selection for Size Exclusion Chromatography (SEC) Precautions for Polar Polymer Analysis Ionic Interaction Add salt Hydrophobic interaction Increase the analyte dissociation Cationic polymer Lower the ph Anionic polymer Higher the ph Lower the eluent polarity (Example) Add acetonitrile or methanol Ionic Interaction Add salt (Example) Add LiBr to DMF Add CF COONa to HFIP Hydrophobic interaction Lower the eluent polarity (Example) Change the eluent from DMF to THF Hydrophillic interaction Increase the eluent polarity (Example) Change the eluent from THF to DMF

40 Aqueous SEC (GFC) Columns: Silica-based Features KW-00 KW00 LW-0 Silica-based packed columns for aqueous SEC (GFC) analysis Suitable for the analysis of proteins and enzymes Fulfills USP L0, L, and L9 requirements Suitable for pore size specifically controlled for analyzing proteins with molecular weights of several hundred thousand High performance analysis of antibody drugs and various proteins High lot-to-lot reproducibility Fulfills USP L0, L, and L9 requirements Reduced packing material particle size enhances column performance Three to four-fold higher sensitivity than KW-00 series KW0-F is applicable analyzing samples with molecular weight above,000,000 Fulfills USP L0, L, and L9 requirements Standard columns ) Shipping Solvent F99000 PROTEIN KW-0., H O F990 PROTEIN KW-0,000, H O F990 PROTEIN KW-0,000, H O F00 PROTEIN KW-G B (PROTEIN KW-G).0 0 H O ) Measured with ethylene glycol Base Material: Silica Usable ph range: ph.0-. Usable concentration of methanol and acetonitrile is up to 00% Standard columns ) Shipping Solvent F990 PROTEIN LW-0,000, H O F00 PROTEIN LW-G B.0 0 H O ) Measured with BSA Base Material: Silica Usable ph range: ph.0-. Usable concentration of methanol and acetonitrile is up to 00% High performance semi-micro columns KW00 series is recommended to be used with semi-micro type devices. ) Shipping Solvent F990 KW0.-F, H O F990 KW0-F, H O F990 KW0-F,000, H O F990 KW0-F,000, H O F00 KW00G-A. 0 H O ) Measured with uridine Base Material: Silica Usable ph range: ph.0-. Usable concentration of methanol and acetonitrile is up to 00%

41 Preparative columns *Preparative columns are made to order. F000 F00 F00 F09 ) Measured with ethylene glycol PROTEIN KW-00. PROTEIN KW-00 PROTEIN KW-00 PROTEIN KW-G B (PROTEIN KW-LG) ),000,000, Standard Column KW-0. KW-0 KW-0 Aqueous SEC (GFC) Columns: Silica-based Target molecular weight range and exclusion limit Measured with protein (eluent: phosphate buffer) Measured with pullulan (eluent: ultrapure water) Target Molecular Weight Range Exclusion Limit KW-0. KW-0, LW-0 KW-0 KW0. KW0 KW0 KW0,000 00,000 0,000 00,000 0,000 *(,000,000),000 0,000 0,000 00,000 0,000 *(,000,000) 00,000 *(0,000,000) 0,000 *(,000,000) *(,000,000) 0,000 00,000 *(,000,000) *(0,000,000) *Please use the above table for reference purposes only when selecting columns. Target Molecular Weight Range Exclusion Limit KW-0. KW-0 KW-0 KW0. KW0 KW0 KW0,000 0,000,000 00,000 0,000 00,000,000 0,000,000 0,000 0,000 00,000 00,000 00,000 0,000 0,000 00,000 0,000 0,000 00,000,00,000 *( ) Estimated value *Please use the above table for reference purposes only when selecting columns. 9

42 Calibration curves for KW-00 series using protein Calibration curve for LW-0 using protein Calibration curves for KW00 series using protein Molecular weight (Protein) KW-0 KW-0. KW-0 Molecular weight (Protein) Molecular weight (Protein) KW0-F KW0.-F KW0-F KW0-F Elution volume (ml) 9 0 Elution volume (ml) Elution volume (ml) Column : Shodex PROTEIN KW-00 series Eluent : 0mM Sodium phosphate buffer (ph.0) + 0.M NaCl Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex PROTEIN LW-0 Eluent : 0mM Sodium phosphate buffer (ph.0) + 0.M NaCl Flow rate :.0mL/ Detector : UV (0nm) Column temp. : Room temp. Column : Shodex KW00-F series Eluent : 0mM Sodium phosphate buffer (ph.0) + 0.M NaCl Flow rate : 0.mL/ Detector : UV (0nm) (small cell volume) Column temp. : 0 C Analysis of impurities (high molecular weight proteins) in insulin glargine following USP method Lipoproteins in serum Sample : 00µL System suitability solution (prepared following USP method). High molecular weight proteins. Insulin glargine Sample : 0µL Whole lipoproteins from serum of a healthy person.0mg/ml. VLDL. LDL. HDL [Preparation of sample]. Use potassium bromide to adjust the specific gravity of serum from a healthy person to.0g/ml. Ultracentrifuge for hours.. Dialyze the supernatant and then substitute the solvent with PBS*.. Measure protein concentration by Lowry method and dilute the sample with PBS* to.0mg/ml Data provided by Ohkawa Ryunosuke, Graduate School of Health Care Sciences, Analytical Laboratory Chemistry, Tokyo Medical and Dental University Column : Shodex PROTEIN KW-0. x Eluent : CH COOH/CH CN/H O=0/0/0 (ph to.0 adjusted with % NH aq.) Flow rate : 0.mL/ Detector : UV (nm) Column temp. : Ambient Column : Shodex PROTEIN KW-G + KW-0 Eluent : 0-fold diluted x 0 PBS* with H O Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C x0 PBS* : 0g NaCl + 9g Na HPO H O + g KCl + g KH PO in 000mL of H O 0 Proteins in human blood serum Sample : 0.% each. Fibrinogen 0µL. α -Macroglobulin 0µL. IgG 0µL. Transferrin 0µL. Plasogen 0µL. Albu 00µL. Antitrypsin 00µL. Hemoglobin 00µL Column : Shodex PROTEIN KW-0 Eluent : 0mM Sodium phosphate buffer (ph.0) + 0.M NaCl Flow rate :.0mL/ Detector : UV (0nm) Column temp. : Room temp. Comparing three GFC columns for the separation of common proteins Sample :. Thyroglobulin (bovine). γ-globulin (bovine). Ovalbu (chicken). Myoglobin (horse). Cyanocobala SB-0 HQ GF-0 HQ KW Separation performances of three aqueous SEC columns (SB-0 HQ, GF-0 HQ, and KW-0) were compared. KW-0, silica-based column, showed the best separation performance for the analysis of protein standards. Molecular weight (Protein) 0 0 KW-0 GF-0 HQ SB-0 HQ 0 9 Elution time () Column : Shodex OHpak SB-0 HQ Shodex Asahipak GF-0 HQ Shodex PROTEIN KW-0 Eluent : 0.M Phosphate buffer (ph.9) Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : 0 C

43 Comparison of LW-0, conventional column, and other manufacturer s column PROTEIN LW-0 is suitable for analyzing proteins with molecular weight of several hundreds of thousands. Compared to our conventional columns and other manufacturer's columns, LW-0 has improved separation performance in the molecular weight range around 0,000 (about the size of γ-globulin). This improvement is advantageous for the separation of monomer and dimer of IgG which is a mainstream antibody drug. Sample : µl. Thyroglobulin (MW : 0,000) mg/ml. γ-globulin (MW : 0,000) mg/ml. Ovalbu (MW :,00).mg/mL. Ribonuclease A (MW :,00) mg/ml. Uridine (MW : ) 0.mg/mL LW-0 (conventional type) KW-0 Company A 0 Sample : µl IgG from human serum 0mg/mL. Aggregates. Dimer. Monomer LW-0 (conventional type) KW-0 Company A Column : Shodex PROTEIN LW-0, Shodex PROTEIN KW-0, Silica-based SEC column from other manufacturer Eluent : 0mM Sodium phosphate buffer (ph.0) + 0.M NaCl Flow rate :.0mL/ Detector : UV (0nm) Column temp. : Room temp. Resolution(Monomer/Dimer) LW-0. KW-0. Company A.9 Aqueous SEC (GFC) Columns: Silica-based Monitoring papain digestion of humanized monoclonal IgG Papain digestion (hr) Papain digestion (hr) Papain digestion (hr) Papain digestion (90) Papain digestion (0) Sample : 0µL Humanized monoclonal IgG. Aggregates of IgG. Dimer of IgG. Monomer of IgG,,. Fragments of IgG from papain digestion. Citric acid. Papain Papain digestion of humanized monoclonal IgG was monitored using PROTEIN LW-0, an aqueous SEC (GFC) column. During the papain digestion of IgG, Fc and Fab fragments from the IgG and their decomposition intermediates are expected to be observed. LW-0 separates IgG and decomposed fragments and intermediates well from each other, thus it is suitable for the monitoring of papain digestion of IgG. [Procedure of papain digestion] () Dissolve mg of humanized monoclonal IgG in 00µL of the eluent. (mg/ml conc.) () Dissolve mg of papain in 00µL of the eluent. (mg/ml conc.) () Pass () and () through 0.µm membrane filter. () Mix each solution in equal amounts. () Keep temperature at C. () Takes a sample with time and analyze it by HPLC. Papain digestion (0) Without Papain 0 0 Column : Shodex PROTEIN LW-0 Eluent : 0.M Sodium phosphate buffer (ph.0) + 0.M NaCl Flow rate :.0mL/ Detector : UV (0nm) Column temp. : C Comparison of KW0.-F and KW-0. KW00 series is a high performance type of semi-micro columns. It offers approximately. times larger theoretical plate number and to times higher detection sensitivity (peak height) than KW-00 series columns do. Sample : 0µL. Blue dextran mg/mL. γ-globulin 0.mg/mL. Ovalbu 0.mg/mL. Myoglobin 0.mg/mL. Uridine 0.0mg/mL (A) KW0.-F N=,000 Whey in yogurt Lectins Sample : Whey, µl Sample : µl. Lectin from soybean 0.mg/mL. Lectin from arachis hypogaea.mg/ml. Lectin from canavalia ensiformis (Con A) 0.9mg/mL. Lectin from lens culinaris (LCA) 0.mg/mL. Lectin from triticum vulgaris (WGA) 0.mg/mL (B) KW-0. N=, Column : Shodex KW0.-F Shodex PROTEIN KW-0. Eluent : 0mM Sodium phosphate buffer (ph.0) + 0.M NaCl Flow rate : (A) 0.mL/, (B).0mL/ Detector : UV (0nm) (small cell volume) Column temp. : C Column : Shodex KW0.-F + KW0-F Column : Shodex KW0.-F Eluent : 0mM Sodium phosphate buffer Eluent : 0mM Sodium phosphate buffer (ph.0) + 0.M NaCl (ph.0) + 0.M NaCl Flow rate : 0.0mL/ Flow rate : 0.mL/ Detector : UV (0nm) (small cell volume) Detector : UV (0nm) (small cell volume) Column temp. : 0 C Column temp. : 0 C

44 Aqueous SEC (GFC) Columns: Polymer-based Features SB-00 HQ SB-0 HQ LB-00 Polymer-based packed columns for aqueous SEC (GFC) analysis Supports a wide range of molecular weight sample analysis The eluent can be replaced with DMF (except SB-0 HQ and SB-0 HQ), enabling the analysis of polar polymers Method using SB-0 HQ or SB-0 HQ for gelatin s mean molecular weight deteration is comparable with PAGI method (Ver. 0, Japan) Fulfills USP L and L9 requirements SB-0 and 0. HQ fulfill USP L requirements SB-0 HQ fulfills USP L requirements Column for the analysis of water-soluble ultra high molecular weight polymers Large particle-size gel prevents shear degradation of polymers Fulfills USP L and L9 requirements Polymer-based packed columns for aqueous SEC (GFC) analysis Controlled column bleeding allows its use with light scattering detectors The eluent can be replaced with DMF enabling the analysis of polar polymers LB-0 (exclusion limit: about,000,000) newly added to the series Fulfills USP L and L9 requirements Standard columns Shipping Solvent F900 OHpak SB-0 HQ, % NaN aq. F90 OHpak SB-0. HQ, % NaN aq. F90 OHpak SB-0 HQ, % NaN aq. F90 OHpak SB-0 HQ,000 0, % NaN aq. F90 OHpak SB-0 HQ,000, % NaN aq. F90 OHpak SB-0 HQ,000, % NaN aq. F90 OHpak SB-0M HQ,000, % NaN aq. F090 OHpak SB-G B (OHpak SB-G) % NaN aq. SB-0M HQ is a mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. Base Material: Polyhydroxymethacrylate Usable ph range: ph-0 [ Aqueous high molecular weight analysis column] Shipping Solvent F90 OHpak SB-0 HQ,00 0, H O F09 OHpak SB-0G.0 0 H O [ GFC columns to be used with light scattering detector] Base Material: Polyhydroxymethacrylate Usable ph range: ph-0 Shipping Solvent F90 OHpak LB-0, H O F90 OHpak LB-0,000, H O F90 OHpak LB-0M,000, H O F09 OHpak LB-G B.0 0 H O Base Material: Polyhydroxymethacrylate Usable ph range: ph-0

45 Preparative columns *Preparative columns are made to order. F0 F0 F0 F0 F0 F0 F0 F09 OHpak SB-00 OHpak SB-00. OHpak SB-00 OHpak SB-00 OHpak SB-00 OHpak SB-00 OHpak SB-00M OHpak SB-G B (OHpak SB-LG) 9,000,000,000,000,000,000, Standard Column SB-0 HQ SB-0. HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0M HQ Aqueous SEC (GFC) Columns: Polymer-based Usable concentration of organic solvents The maximum usable concentration (%) Methanol Acetonitrile DMF SB-0 HQ SB-0. HQ, SB-0 HQ SB-0 HQ~SB-0M HQ 00 SB-G B SB-0 HQ, SB-0G LB-0, LB-0, LB-0M, LB-G B (Note) The maximum solvent tolerance of SB-000 series, preparative columns of SB-00 series, is 0% methanol, acetonitrile, or DMF (SB-00 is not tolerant to organic solvents). Target molecular weight range and exclusion limit Measured with pullulan (eluent: ultrapure water) Measured with *PEG/PEO (eluent: DMF) Target Molecular Weight Range Exclusion Limit SB-0 HQ SB-0. HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0M HQ SB-0 HQ LB-0 00, ,000,000 00,000,000 00,000 00,000,000,000 00,000 *(0,000,000) 00 *(0,000,000) 00,000 *(00,000,000),000 00,000,000 0,000 00,000,000,000 *(,000,000) *(0,000,000) *(0,000,000) *(00,000,000) 00,000 SB-0. HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0M HQ LB-0 LB-0 LB-0M Target Molecular Weight Range 00, , ,000 0,000 00,000 0,000 **(0,000,000) 00 **(0,000,000) 00 0,000 0,000 00, **(0,000,000) LB-0 LB-0M 00,000,000, *(0,000,000) *Please use the above table for reference purposes only when selecting columns. *(,000,000) *(0,000,000) *( ) Estimated value *Please use the above table for reference purposes only when selecting columns. *PEG: polyethylene glycol *PEO: polyethylene oxide **( ) Estimated value

46 Calibration curves for SB-00 HQ series using pullulan (eluent: H O) Calibration curves for SB-00 HQ series using PEG/PEO (eluent: DMF) Carboxymethylcellulose 0 0 Sample : Carboxymethylcellulose 0.% each, 0µL,00-,000cP Molecular weight (Pullulan) SB-0 HQ SB-0 HQ SB-0. HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0M HQ Molecular weight (PEG/PEO) SB-0 HQ SB-0 HQ SB-0. HQ SB-0 HQ SB-0 HQ SB-0M HQ Mn : 0,00 Mw :,90,00 Mw/Mn : cP Mn : 0,00 Mw :,,000 Mw/Mn : cP Mn :,00 Mw : 0,000 Mw/Mn : Elution volume (ml) Elution volume (ml) *Molecular weight was detered from the calibration curve of pullulan. Column : Shodex OHpak SB-00 HQ series Eluent : H O Flow rate :.0mL/ Column temp. : 0 C Column : Shodex OHpak SB-00 HQ series Eluent : DMF Flow rate :.0mL/ Column temp. : 0 C Column : Shodex OHpak SB-0M HQ x Eluent : 0.M NaCl aq. Flow rate :.0mL/ Column temp. : 0 C Effects of sodium nitrate in eluent on the analysis of polyallylae For the analysis of cationic polymers, such as pollyallylae, undesired adsorption of the polymer is observed when low (0.0M) sodium nitrate eluent was used. By using higher concentration (> 0.M) salt, it suppresses the sample adsorption and enables to obtain accurate chromatograms. Sample : Polyallylae 0.%, 00µL 0. M 0.0 M Gelatin Sample : 0.% each, 00µL Gelatin from bovine skin (Acid treatment, Gel strength : g) Gelatin from porcine skin (Alkali treatment, Gel strength : 90-00g) 0. M From bovine skin Mn :,00 Mw : 0,00 Mw/Mn : M From porcine skin Mn :,00 Mw :,00 Mw/Mn : Volume (ml) *Molecular weight was detered from the calibration curve of pullulan. Column : Shodex OHpak SB-0M HQ x Eluent : 0.M CH COOH + NaNO aq. Flow rate :.0mL/ Column temp. : 0 C Column : Shodex OHpak SB-0M HQ x Eluent : 0.M KH PO aq./ 0.M Na HPO aq.=0/0 Flow rate :.0mL/ Column temp. : 0 C Polyacrylamide Cellulose acetate SB-0 HQ Sample : Polyacrylamide, 00µL Sample : Cellulose acetate 0.% each, 00µL.0x0 SB-0 HQ Mn~0,000 Molar Mass (g/mol).0x0.0x0 Mw:,00,000 Mn~0, x Volume (ml) Column : Shodex OHpak SB-0 HQ, SB-0 HQ Eluent : 0.M NaCl aq. Flow rate : 0.mL/ MALS (Multi angle light scattering) Column temp. : 0 C Column : Shodex OHpak SB-0M HQ x Eluent : 0mM LiBr in DMF Flow rate :.0mL/ Column temp. : 0 C

47 Copovidones Sample : 00µL Poly(-vinylpyrrolidone-co-vinyl acetate) 0.% each Copolymer : Mn :,000 Mw :,00 Mw/Mn :.0 Copolymer : Mn :,00 Mw :,900 Mw/Mn : *Molecular weight was detered from Elution volume (ml) the calibration curve of PEG/PEO. Column : Shodex OHpak SB-0M HQ x Eluent : 0mM LiBr in DMF Flow rate :.0mL/ Column temp. : 0 C Calibration curves for LB-00 series using pullulan (eluent: H O) Molecular weight (Pullulan) LB-0 LB-0M LB-0 Column : Shodex OHpak LB-00 series Eluent : H O Flow rate :.0mL/ Column temp. : 0 C Calibration curves for LB-00 series using PEG/PEO (eluent: DMF) Molecular weight (PEG/PEO) LB-0 LB-0M LB Elution volume (ml) Column : Shodex OHpak LB-00 series Eluent : DMF Flow rate :.0mL/ Column temp. : 0 C Aqueous SEC (GFC) Columns: Polymer-based Pullulan detection by LB-0M and multiangle light scattering detector The new OHpak LB-00 series is able to detect low molecular weight substances owing to its improved low baseline noise level while using it with a multiangle light scattering detector. This cannot be achieved with other manufacturer's SEC column. LB-0M (.0mm I.D. x 00mm) SB-0M HQ (.0mm I.D. x 00mm) Sample : Pullulan (MW :,000) 0.%, 0µL Signal to noise ratio (S/N) LB-0M (.0mm I.D. x 00mm) SB-0M HQ (.0mm I.D. x 00mm) SEC column from other manufacturer (.mm I.D. x 00mm) 0 SEC column from other manufacturer (.mm I.D. x 00mm) 0,0,00,000 0,00 Molecular weight (Pullulan) 0 0 Column : Shodex OHpak LB-0M Shodex OHpak SB-0M HQ SEC column from other manufacturer Eluent : 0.M NaNO aq. Flow rate :.0mL/ Detector : MALS (Multi angle light scattering) (90 ) Column temp. : 0 C Sodium alginate Sodium heparin Sample : Sodium alginate 0.%, 00µL Sample : Sodium heparin 0.%, 00µL.0x0.0x0.0x0.0x0 Molar Mass (g/mol).0x0.0x0.0x Molar Mass (g/mol).0x0.0x0.0x Mn :,90 Mw :,00 Mw/Mn : Mn :,00 Mw :,0 Mw/Mn : Time () Time () Column : Shodex OHpak LB-0M x Eluent : 0.M NaNO aq. Flow rate :.0mL/ MALS (Multi angle light scattering) Column temp. : 0 C Column : Shodex OHpak LB-0M x Eluent : 0.M NaNO aq. Flow rate :.0mL/ MALS (Multi angle light scattering) Column temp. : 0 C

48 Multimode Columns Features GS-HQ SEC is the main separation mode With the choice of eluent, the column provides multimode features of reversed phase, HILIC, and ion exchange modes to SEC Suitable for the separation of peptides or nucleic acids with similar molecular weights Suitable for desalting samples or substituting buffer in protein analysis Standard columns Shipping Solvent F0000 Asahipak GS-0 HQ 9, H O/CH OH=0/0 F0000 Asahipak GS-0 HQ 9, H O/CH OH=0/0 F0000 Asahipak GS-0 HQ,000, H O/CH OH=0/0 F0000 Asahipak GS-0 HQ,000, H O/CH OH=0/0 F009 Asahipak GS-G B 9. 0 H O/CH OH=0/0 Semi-micro columns *The following semi-micro columns are made to order. Base Material: Polyvinyl alcohol Usable ph range: ph- (GS-0 HQ: ph-9) Usable concentration of methanol is up to 00% (GS-0 HQ: up to 0%) Usable concentration of acetonitrile is up to 0% F0 GS0A-D F0 GS0A-E Base Material: Polyvinyl alcohol Preparative columns *Preparative columns are made to order. Standard Column F00 Asahipak GS-0 0F, GS-0 HQ F00 Asahipak GS-0 0F, GS-0 HQ F009 Asahipak GS-0 0F, GS-0 HQ F000 Asahipak GS-0 0F, GS-0 HQ F00 Asahipak GS-0 0G, GS-0 HQ F00 Asahipak GS-0 0G, GS-0 HQ F00 Asahipak GS-0 0G, GS-0 HQ F00 Asahipak GS-0 0G, GS-0 HQ F00 Asahipak GS-0G B 0. 0 Target molecular weight range and exclusion limit Measured with pullulan (eluent: ultrapure water) Target Molecular Weight Range Exclusion Limit GS-0 GS-0 GS-0 00, ,000,000 00,000,000 0,000 00,000 GS-0 0,000 00,000,000,000 *Please use the above table for reference purposes only when selecting columns.

49 Calibration curves for GS-HQ series using pullulan Molecular weight (Pullulan) GS-0 HQ GS-0 HQ GS-0 HQ GS-0 HQ Peptides GS-HQ columns work not only under SEC (GFC) mode, but also under multimode, adding hydrophobic and ionic interactions. By carefully selecting the eluent, they provide separation mode that was not available with other types of columns. GS-0 HQ shows excellent performance separating hydrophilic peptides, particularly for acidic and basic peptides. Glu-Ala-Glu Arg-Asp Gly-His-Lys Arg-Pro-Lys-Pro MW pl Σf Sample : 0µL. Glu-Ala-Glu 0.0%. Arg-Asp 0.0%. Gly-His-Lys 0.0%. Arg-Pro-Lys-Pro 0.0% Multimode Columns 0 Σf: Hydrophobic parameter pl: Isoelectric point 9 0 Elution volume (ml) Column : Shodex Asahipak GS-HQ series Eluent : H O Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex Asahipak GS-0 HQ Eluent : 0mM Ammonium acetate buffer (ph.) Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : 0 C Analysis of purine bases in beer Purine in food is analyzed as purine base after steps of sample preparation: homogenization, freeze drying, hydolyzation with 0% perchloric acid, and neutralization. Example below shows the analysis of purine in regular beer and beer treated with guanase (an enzyme that degrades guanine to xanthine). The following data indicate that guanine was decreased and xanthine was increased by guanase. Purine bases in beer Normal beer Guanase treated beer adenine guanine guanine hypoxanthine xanthine xanthine uric acid xanthine Column : Shodex Asahipak GS-0 HQ Eluent : 0mM Sodium phosphate buffer (ph.) Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : C Data provided by Kiyoko Kaneko Ph.D., Faculty of Pharmaceutical Sciences, Teikyo University Low molecular weight water-soluble dietary fiber Umami Lignosulfonic acid GS-0 HQ allows to elute monosaccharides, disaccharides, and sugar alcohols after the indigestible component fraction (indicated by an arrow on the chromatogram). This separation makes the method preferable for the quantification of low molecular weight water-soluble dietary fiber. Sample : 0µg/mL each, 0µL. IMP. GMP. AMP. Inosine. Hypoxanthine. Guanosine. Guanine. Adenosine 9. Adenine Sample : 00µL Lignosulfonic acid sodium salt 0.% Column : Shodex Asahipak GS-0 HQ x Eluent : H O Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex Asahipak GS-0 HQ Eluent : 0mM NaH PO aq./0mm Na HPO aq. =000/ Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex Asahipak GS-0 HQ x Eluent : 0mM Na HPO aq. Flow rate : 0.mL/ Detector : UV (nm) Column temp. : 0 C

50 Aqueous/Organic SEC Columns Features GF-HQ Polymer-based SEC columns with high solvent durability Works well with both aqueous and organic solvents Standard columns Shipping Solvent F00000 Asahipak GF-0 HQ 9, H O F0000 Asahipak GF-0 HQ 9, H O/CH OH=0/0 F0000 Asahipak GF-0 HQ 9,000, H O/CH OH=0/0 F0000 Asahipak GF-0 HQ, , H O/CH OH=0/0 F0000 Asahipak GF-M HQ, , H O/CH OH=0/0 F00 Asahipak GF-G B 9. 0 H O/CH OH=0/0 F0000 MSpak GF-0 B, H O F000 MSpak GF-0 D 0, H O F000 MSpak GF-0 E, H O F000 MSpak GF-0 D, H O GF-M HQ is a mixed-gel column capable of analyzing samples over a wide range of molecular weight. Base Material: Polyvinyl alcohol Usable ph range: ph-9 Semi-micro columns *The following semi-micro columns are made to order. F0000 Asahipak GF-0 D 0. 0 F000 Asahipak GF-0 E 0. 0 F0 GF0A-D, F0 GF0A-E, Base Material: Polyvinyl alcohol Preparative columns *Preparative columns are made to order. Standard Column F000 Asahipak GS-0 0F, GF-0 HQ F00 Asahipak GS-0 0F, GF-0 HQ F00 Asahipak GS-0 0F, GF-0 HQ F00 Asahipak GSM-00 0F, GF-M HQ F00 Asahipak GS-0 0G, GF-0 HQ F009 Asahipak GS-0 0G, GF-0 HQ F000 Asahipak GS-0 0G, GF-0 HQ F00 Asahipak GSM-00 0G, GF-M HQ F000 Asahipak GS-0G B 0. 0 Target molecular weight range and exclusion limit Measured with pullulan (eluent: ultrapure water) Measured with *PEG/PEO (eluent: DMF) Target Molecular Weight Range GF-0 00,000 GF ,000 GF-0,000 00,000 GF-0 00,000 *(0,000,000) GF-M 00 *(0,000,000) *Please use the above table for reference purposes only when selecting columns. Exclusion Limit 9,000 0,000 00,000 *(0,000,000) *(0,000,000) GF-0 GF-0 GF-0 GF-0 GF-M Target Molecular Weight Range 00,000 00,000,000 00,000 0,000 **(0,000,000) 00 **(0,000,000) *( ) Estimated value *Please use the above table *PEG: polyethylene glycol for reference purposes only *PEO: polyethylene oxide when selecting columns. **( ) Estimated value

51 Usable solvents Solvent Water 0-0.M sodium concentration Methanol Ethanol Acetonitrile THF DMF Acetone GF-0 GF-0 GF-0 GF-0 GF-M *When replacing acetonitrile, ethyl acetate or chloroform with water, replace with methanol first and then replace with water. *When replacing water with ethyl acetate or chloroform, replace with methanol first and then replace with the required eluent condition. (Note) The usable solvents for preparative columns of GF-0 HQ, GS-0 0F and 0G, are water and methanol. Use of GSM-00 0F or 0G is recommended when other solvents are required. Sodium polystyrene sulfonates Polymers having both hydrophobic and hydrophilic functional groups may exhibit hydrophobic interactions with packing materials. When analyzing such polymers, addition of organic solvents to the eluent can suppress the hydrophobic interaction. Mw :,00 Mw :,00 Mw : 9,000 Sample : 0.% each, 0µL Sodium poly(styrene sulfonate) CH CH SONa n Aqueous/Organic SEC Columns Chloroform Ethylacetate DMSO 0~0% Column : Shodex Asahipak GF-0 HQ Eluent : 0mM LiCl aq./ch CN=0/0 Flow rate : 0.mL/ Detector : UV (nm) Column temp. : 0 C Calibration curves for GF-HQ series using pullulan (eluent: H O) Calibration curves for GF-HQ series using PEG/PEO (eluent: DMF) Polyacrylonitrile 0 0 Sample : Polyacrylonitrile 0.%, 00µL 0 0 Molecular weight (Pullulan) GF-0 HQ GF-0 HQ GF-0 HQ GF-0 HQ GF-M HQ Molecular weight (PEG/PEO) GF-0 HQ GF-0 HQ GF-0 HQ GF-M HQ GF-0 HQ Elution volume (ml) 9 0 Elution volume (ml) Column : Shodex Asahipak GF-HQ series Eluent : H O Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex Asahipak GF-HQ series Eluent : DMF Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex Asahipak GF-0 HQ x Eluent : 0mM LiBr in DMF Flow rate : 0.mL/ Column temp. : 0 C Comparison of two GF column performances for the separation of maltooligosaccharides GF-0 HQ demonstrates an improved separation of low molecular substances. The chromatograms below show that the peaks obtained by GF-0 HQ are separated with deeper notches compared to peaks obtained by GF-0 HQ. GF-0 HQ is capable of separating oligosaccharides (trisaccharides to hexasaccharides) while those oligosaccharides were eluted all together when analyzed by GF-0 HQ. GF-0 HQ x GF-0 HQ x ~ Sample : 0.% each, 0µL. Maltohexaose. Maltopentaose. Maltotetraose. Maltotriose. Maltose. Glucose Comparison of polystyrene separation under three different solvent conditions (A) THF (B) Chloroform (C) DMF Sample : Polystyrene mg/ml each, 0µL. Mw :,090,000. Mw : 90,000. Mw :,900. Mw : 9,00. Mw :,90. Mw : Column : Shodex Asahipak GF-0 HQ x Shodex Asahipak GF-0 HQ x Eluent : H O Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex Asahipak GF-0 HQ + GF-0 HQ Eluent : (A); THF, (B); Chloroform, (C); DMF Flow rate : 0.mL/ Detector : (A),(B) UV (nm), (C) UV (0nm) Column temp. : 0 C 9

52 Organic SEC (GPC) Columns (General Analysis): THF Features KF-00 Standard organic solvent SEC (GPC) column Supports a wide range of applications from low to high molecular weight compounds Fulfills USP L requirements Standard columns [ KF-00 series: Shipping solvent Tetrahydrofuran (THF)] F000 GPC KF-0, F000 GPC KF-0, F00 GPC KF-0., F000 GPC KF-0, F000 GPC KF-0L, F000 GPC KF-0,000, F000 GPC KF-0L,000, F000 GPC KF-0,000 0, F000 GPC KF-0L,000 0, F000 GPC KF-0, , F0090 GPC KF-0M, , F000 GPC KF-0L, , F000 GPC KF-0,000 0, F000 GPC KF-0L,000 0, F0000 GPC KF-G A (GPC KF-G). 0 F090 GPC KF-00D solvent-peak separation column *The columns with L or M at the end of column names are mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. *See page for details of the solvent-peak separation columns. *See pages 0 and for details preparative columns. *See page for applicability of SEC (GPC) columns to solvent replacement. Base Material: Styrene divinylbenzene copolymer Target molecular weight range and exclusion limit Measured with polystyrene (eluent: THF) Target Molecular Weight Range Exclusion Limit Target Molecular Weight Range Exclusion Limit KF ,00 KF-0 0,000,000,000,000,000 KF-0 00,000,000 KF-0L 00,000,000,000,000 KF-0. 00,000 0,000 KF-0 0,000 *(0,000,000) *(0,000,000) KF-0,000 0,000 0,000 KF-0M,000 *(0,000,000) *(0,000,000) KF-0L 00 0,000 0,000 KF-0L 00 *(0,000,000) *(0,000,000) KF-0,000 00,000 00,000 KF-0 00,000 *(00,000,000) *(00,000,000) KF-0L 00 00,000 00,000 KF-0L 00 *(00,000,000) *(00,000,000) *Please use the above tables for reference purposes only when selecting columns. *( ) Estimated value 0

53 Calibration curves for KF-00 series using polystyrene Molecular weight (Polystyrene) KF-0 KF-0 KF-0 KF-0 KF-0 KF-0. KF-0 KF-0 KF-0M 9 0 Elution volume (ml) Column : Shodex GPC KF-00 series Eluent : THF Flow rate :.0mL/ Column temp. : 0 C Calibration curves for KF-00L (linear type) series using polystyrene Molecular weight (Polystyrene) KF-0L KF-0L KF-0L KF-0L KF-0L 9 0 Elution volume (ml) Column : Shodex GPC KF-00L series Eluent : THF Flow rate :.0mL/ Column temp. : 0 C Fat-soluble vitas Sample : 00µL. Vita A palmitate 00µg/mL. Vita E 0µg/mL. Vita D 0µg/mL. Vita K 0µg/mL 0 0 Column : Shodex GPC KF-0 x Eluent : THF Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Organic SEC (GPC) Columns (General Analysis): THF Polystyrene standards Sample : 0µL. Polystyrene (Mw :,000) 0.%. Polystyrene (Mw :,00) 0.%. Polystyrene (Mw : 9,00) 0.%. Polystyrene (Mw :,0) 0.%. Polystyrene (Mw :,00) 0.%. Polystyrene (Mw : 0) 0.%. Toluene (Mw: 9) 0.% Sample : 0µL. Polystyrene (Mw : 9,,000) 0.0%. Polystyrene (Mw :,0,000) 0.%. Polystyrene (Mw :,000) 0.%. Polystyrene (Mw :,0) 0.%. Polystyrene (Mw : 0) 0.%. Toluene (Mw : 9) 0.% Column : Shodex GPC KF-0L x Eluent : THF Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Column : Shodex GPC KF-0L x Eluent : THF Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Styrene isoprene ABA block copolymer Polycarbonate resin Raw rubber Sample : Styrene isoprene ABA block copolymer Sample : Polycarbonate resin 0.%, 00µL Sample : Rubber 0.%, 00µL CH O C O C CH O n Column : Shodex GPC KF-0M x Eluent : THF Flow rate :.0mL/ Column temp. : 0 C Column : Shodex GPC KF-0L x Eluent : THF Flow rate :.0mL/ Column temp. : 0 C Column : Shodex GPC KF-0M x + KF-0 Eluent : Toluene Flow rate :.0mL/ Column temp. : Room temp.

54 Organic SEC (GPC) Columns (General Analysis): Chloroform Features K-00 Standard organic solvent SEC (GPC) column Supports a wide range of applications from low to high molecular weight compounds Fulfills USP L requirements Standard columns [ K-00 series: Shipping solvent Chloroform] F00 GPC K-0, F00 GPC K-0, F0 GPC K-0., F00 GPC K-0, F09 GPC K-0L, F00 GPC K-0,000, F09 GPC K-0L,000, F00 GPC K-0,000 0, F09 GPC K-0L,000 0, F00 GPC K-0, , F090 GPC K-0M, , F09 GPC K-0L, , F00 GPC K-0,000 0, F09 GPC K-0L,000 0, F000 GPC K-G A (GPC K-G). 0 F090 GPC K-00D solvent-peak separation column *The columns with L or M at the end of column names are mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. *See page for details of the solvent-peak separation columns. *See pages 0 and for details preparative columns. *See page for applicability of SEC (GPC) columns to solvent replacement. Base Material: Styrene divinylbenzene copolymer Target molecular weight range and exclusion limit Measured with polystyrene (eluent: Chloroform) Target Molecular Weight Range Exclusion Limit Target Molecular Weight Range Exclusion Limit K ,00 K-0 0,000,000,000,000,000 K-0 00,000,000 K-0L 00,000,000,000,000 K-0. 00,000 0,000 K-0 0,000 *(0,000,000) *(0,000,000) K-0,000 0,000 0,000 K-0M,000 *(0,000,000) *(0,000,000) K-0L 00 0,000 0,000 K-0L 00 *(0,000,000) *(0,000,000) K-0,000 00,000 00,000 K-0 00,000 *(00,000,000) *(00,000,000) K-0L 00 00,000 00,000 K-0L 00 *(00,000,000) *(00,000,000) *Please use the above tables for reference purposes only when selecting columns. *( ) Estimated value

55 Epoxy resin Sample : Epikote 00 0.%, 00µL 0 0 Column : Shodex GPC K-0L x Eluent : Chloroform Flow rate :.0mL/ Detector : UV (nm) Column temp. : Room temp. Polylactic acid Sample : Polylactic acid 0.%, 0µL Low molecular polydimethylsiloxanes Sample : 0.% each, 00µL. Polydimethylsiloxane (MW:0). Polydimethylsiloxane (MW:). Hexamethyldisiloxane (MW:) 0 0 Column : Shodex GPC K-0 x Eluent : Chloroform Flow rate :.0mL/ (polarity : -) Column temp. : 0 C Silicone oil 0 Sample : Silicone oil 0.%, 00µL Organic SEC (GPC) Columns (General Analysis): Chloroform Silicone oil Column : Shodex GPC K-0L Eluent : Chloroform Flow rate :.0mL/ Column temp. : 0 C Column : Shodex GPC K-0M x Eluent : Toluene Flow rate :.0mL/ Column temp. : C Recycling preparative chromatography of lauryl stearyl thiodipropionate Sample : %, 00µL. Distearyl stearyl thiodipropionate. Lauryl stearyl thiodipropionate. Dilauryl thiodipropionate CYCLE CYCLE CYCLE CYCLE0 Column : Shodex GPC K-LG + K-00 Eluent : Chloroform Flow rate :.0mL/ (preparative type) Column temp. : 0 C *See page 0 for K-00

56 Organic SEC (GPC) Columns (General Analysis): DMF Features KD-00 Standard organic solvent SEC (GPC) column Supports a wide range of applications from low to high molecular weight compounds Fulfills USP L requirements Standard columns [ KD-00 series: Shipping solvent Dimethylformamide (DMF)] F00 GPC KD-0, F00 GPC KD-0, F0 GPC KD-0., F00 GPC KD-0, F00 GPC KD-0,000, F00 GPC KD-0,000 0, F00 GPC KD-0, , F090 GPC KD-0M, , F00 GPC KD-0,000 0, F00 GPC KD-G A (GPC KD-G). 0 *The column with M at the end of column names is mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. *See page for applicability of SEC (GPC) columns to solvent replacement. Base Material: Styrene divinylbenzene copolymer Target molecular weight range and exclusion limit Measured with *PEG/PEO (eluent: DMF) Target Molecular Weight Range Exclusion Limit Target Molecular Weight Range Exclusion Limit KD-0 00,00,00 KD-0 0,000 **(,000,000) **(,000,000) KD-0 00,000,000 KD-0 0,000 **(0,000,000) **(0,000,000) KD ,000 0,000 KD-0M,000 **(0,000,000) **(0,000,000) KD-0,000 0,000 0,000 KD-0 0,000 **(00,000,000) **(00,000,000) KD-0,000 00,000 00,000 *Please use the above tables for reference purposes only when selecting columns. *PEG: polyethylene glycol *PEO: polyethylene oxide **( ) Estimated value Solvent-peak Separation Columns for Organic SEC (GPC) Features KF-00D K-00D Use this column in combination with a linear column Accurate molecular weight distribution of polymers and oligomers are achieved by shifting the elutions of monomers, polymer additives, and solvent-peak in the lower molecular region Solvent-peak separation columns Column Combination Shipping Solvent F090 GPC KF-00D KF-0L, 0L, 0M, 0L THF F090 GPC K-00D K-0L, 0L, 0M, 0L Chloroform Base Material: Styrene divinylbenzene copolymer

57 Calibration curves for KD-00 series using PEG/PEO Molecular weight (PEG/PEO) Molecular mass Celluloses 0 KD-0 KD Elution volume (ml) 9 0 Elution volume (ml) Column : Shodex GPC KD-0M Eluent : % LiCl in *DMI Flow rate : 0.mL/, MALS (Multi angle light scattering) Column temp. : 0 C *DMI,-dimethyl--imidazolidinone Potato starch KD-0 KD-0 KD-0 KD-0 KD-0M KD-0. KD-0 Column : Shodex GPC KD-00 series Eluent : DMF Flow rate :.0mL/ Column temp. : 0 C Polyvinylpyrrolidones Sample : Polyvinylpyrrolidone 0.% each (A) K-0 00µL (B) K-0 00µL (C) K-90 00µL (A) (B) (C) Column : Shodex GPC KD-0M x Eluent : 0mM LiBr in DMF Flow rate :.0mL/ Column temp. : 0 C Sample : 00µL Cellulose ca. 0.0% each Cellulose is difficult to dissolve and repeated solvent replacement is required to prepare the cellulose solution. The time required to completely dissolve cellulose depends on the solvent type, crystallinity and molecular weight of the cellulose. This can be to 0 days. Data provided by Dr. Masahiko Yanagisawa, Isogai group, Graduate School of Agricultural and Life Sciences, The University of Tokyo Effects of solvent-peak separation column Melae formaldehyde resin 0 Phenoxy resin Sample : 0µL Melae-formaldehyde resin % 0 Column : Shodex GPC KD-0 x Eluent : 0mM LiBr in DMF Flow rate :.0mL/ Column temp. : 0 C Sample : 0µL Phenoxy resin 0.% 0 Column : Shodex GPC KD-0M x Eluent : 0mM LiBr in DMF Flow rate :.0mL/ Column temp. : 0 C Organic SEC (GPC) Columns (General Analysis): DMF Solvent-peak Separation Columns for Organic SEC (GPC) Sample : 00µL Potato starch in DMSO 0.% *solved at 0 C Sample : Poly(vinyl chloride) DOP (Dioctyl phthalate) KF-0L 0 0 Molecular weight (Polystyrene) KF-0L KF-0L+KF-00D KF-0L + KF-00D Elution volume (ml) Column : Shodex GPC KD-0M Eluent : 0mM LiBr in DMSO/DMF=/ Flow rate :.0mL/ Column temp. : 0 C 0 0 Column : Shodex GPC KF-0L Shodex GPC KF-0L + KF-00D Eluent : THF Flow rate :.0mL/

58 Organic SEC (GPC) Columns: Rapid Analysis, High Performance Analysis Features KF-00 KF-00HQ Achieves approximately halved analysis time compared with standard columns The amount of solvent used is reduced to about a third Improved applicability of solvent replacement Fulfills USP L requirements About. times better separation performance than standard columns, obtains higher resolution About times better sensitivity than that of standard columns, supports high sensitivity analysis The amount of solvent used is reduced to about a third Improved applicability of solvent replacement Fulfills USP L requirements Rapid analysis downsized columns [ KF-00 series] KF-00 series is recommended to be used with semi-micro type devices. F009 GPC KF-0, F009 GPC KF-0, F009 GPC KF-0., F009 GPC KF-0, F009 GPC KF-0,000, F009 GPC KF-0,000 0, F009 GPC KF-0, , F009 GPC KF-0M, , F0099 GPC KF-0,000 0, F0000 GPC KF-G A (GPC KF-G). 0 High performance semi-micro columns [ KF-00HQ series] KF-00HQ series is recommended to be used with semi-micro type devices. F0 GPC KF-0HQ, F0 GPC KF-0HQ, F0 GPC KF-0.HQ, F0 GPC KF-0HQ, F0 GPC KF-0HQ,000,00. 0 F09 GPC KF-0LHQ 0,000 0, F0 GPC KF-0LHQ 0, , F0000 GPC KF-G A (GPC KF-G). 0 [KF-00 series and KF-00HQ series] *The columns with L or M at the end of column names are mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. *See page for applicability of SEC (GPC) columns to solvent replacement. [KF-00 series and KF-00HQ series] Base Material: Styrene divinylbenzene copolymer Shipping Solvent: Tetrahydrofuran (THF) Target molecular weight range and exclusion limit Measured with polystyrene (eluent: THF) Target Molecular Weight Range Exclusion Limit Target Molecular Weight Range Exclusion Limit KF ,00 KF-0HQ 00 00,00 KF-0 00,00,000 KF-0HQ 00,00,000 KF ,000 0,000 KF-0.HQ 00 0,000 0,000 KF ,000 0,000 KF-0HQ 00 0,000 0,000 KF-0,000 00,000,000,000 KF-0HQ,000 00,000,000,000 KF-0 0,000,000,000,000,000 KF-0LHQ 00,000,000,000,000 KF-0 0,000 *(0,000,000) *(0,000,000) KF-0LHQ 00 *(0,000,000) *(0,000,000) KF-0M KF-0,000 *(0,000,000) 00,000 *(00,000,000) *(0,000,000) *(00,000,000) *Please use the above tables for reference purposes only when selecting columns. *( ) Estimated value

59 Calibration curves for KF-00 series using polystyrene Molecular weight (Polystyrene) Elution volume (ml) Column : Shodex GPC KF-00 series Eluent : THF Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Comparison of standard, rapid analysis, and high performance type columns Standard type KF-0. x 0µL injection KF-0 KF-0 KF-0. KF-0 KF-0 KF-0 KF-0 KF-0 KF-0M ml Calibration curves for KF-00HQ series using polystyrene Molecular weight (Polystyrene) KF-0HQ KF-0HQ KF-0LHQ KF-0HQ KF-0.HQ KF-0HQ KF-0LHQ Elution volume (ml) Column : Shodex GPC KF-00HQ series Eluent : THF Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Sample : EPON00 0.% KF-0. provides rapid analysis by reducing the analysis time; less than half of the analysis time of KF-0.. Having. times more theoretical plate number than standard column, KF-0.HQ provides improved resolution especially for the separation of small to medium molecular weight substances. Rapid analysis and high performance type columns use less than one third of solvent per analysis compared to standard type columns do. Organic SEC (GPC) Columns: Rapid Analysis, High Performance Analysis High performance type.ml KF-0.HQ x 0µL injection Rapid analysis type KF-0. x 0µL injection.0ml Column : Shodex GPC KF-0. x Shodex GPC KF-0.HQ x Shodex GPC KF-0. x Eluent : THF Flow rate :.0mL/ (KF-0.) 0.mL/ (KF-0.HQ) 0.mL/ (KF-0.) (conventional type) (KF-0.) RI (small cell volume) (KF-0.HQ, KF-0.) Column temp. : 0 C Styrene acrylonitrile copolymer Liquid paraffin Phthalates Sample : Styrene-Acrylonitrile (0:0) copolymer Sample : Liquid paraffin %, µl Sample : 0µL. Dioctyl phthalate 0.%. Dibutyl phthalate 0.%. Dipropyl phthalate 0.%. Diethyl phthalate 0.%. Dimethyl phthalate 0.%. Propylbenzene 0.%. Ethylbenzene 0.%. Toluene 0.% 9. Benzene 0.% Column : Shodex GPC KF-0M x Eluent : 0mM LiBr in DMF Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC KF-0HQ Eluent : Chloroform Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC KF-0HQ x Eluent : THF Flow rate : 0.mL/ Detector : UV (nm) (small cell volume) Column temp. : 0 C

60 Organic SEC (GPC) Columns: Ultra-Rapid Analysis Features HK-00 Newly developed styrene divinylbenzene copolymer monodisperse particles Analysis time reduced to about one sixth of conventional column's analysis time Low column pressure even under high flow rate does not require its use with UHPLC device The amount of solvent used is reduced to about a sixth HK-HFIP0L is filled with HFIP Fulfills USP L requirements Ultra-Rapid analysis semi-micro columns [ Shipping Solvent: Tetrahydrofuran (THF)] HK-00 series is recommended to be used with semi-micro type devices. F000 GPC HK-0 9, F000 GPC HK-0L 9,000., F000 GPC HK-0,000, *The column with L at the end of column names is mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. Base Material: Styrene divinylbenzene copolymer [ Shipping Solvent: hexafluoroisopropanol (HFIP)] HK-HFIP0L is recommended to be used with semi-micro type devices. F00 GPC HK-HFIP0L 9, *The column with L at the end of column names is mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. *See page for details of other columns filled with HFIP. Base Material: Styrene divinylbenzene copolymer Guard filter for HK series Contents F0000 F0000 GPC HK-G GPC HK-G filter One holder and one filter filters Removes insoluble components in the sample *Allows direct attachment to the analytical column Target molecular weight range and exclusion limit Measured with polystyrene (eluent: THF) Target Molecular Weight Range Exclusion Limit HK-0 HK-0L HK-0 00,00 00,000,000 0,000,00,000,000,000,000,000,000 *Please use the above table for reference purposes only when selecting columns. Measured with *PMMA (eluent: HFIP) HK-HFIP0L *Please use the above table for reference purposes only when selecting columns. Target Molecular Weight Range,000 00,000 Exclusion Limit 00,000 *PMMA: Polymethylmethacrylate

61 Calibration curves for HK-00 series using polystyrene (eluent: THF) Molecular weight (Polystyrene) HK-0L HK-0 HK Elution volume (ml) Column : Shodex GPC HK-00 series Eluent : THF Flow rate :.0mL/ (small cell volume) Column temp. : 0 C Calibration curves for HK-00 series using PEG/PEO (eluent: DMF) Molecular weight (PEG/PEO) HK-0L HK-0 HK Elution volume (ml) Column : Shodex GPC HK-00 series Eluent : DMF Flow rate :.0mL/ (small cell volume) Column temp. : 0 C Calibration curve for HK-HFIP0L using PMMA (eluent: HFIP) Molecular weight (PMMA) Elution volume (ml) Column : Shodex GPC HK-HFIP0L Eluent : mm CF COONa in HFIP Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Organic SEC (GPC) Columns: Ultra-Rapid Analysis Comparison of HK-0L and conventional column (KF-0L) Poly(butyl methacrylate) HK-0L HK-0L keeps low column pressure even at high flow rates using a conventional HPLC instrument. This allows it to achieve ultra-rapid analysis; reducing its analysis time to about / of conventional analysis method's analysis time. Also, its elution volume per column is about.0ml which is about / of the conventional column's elution volume. Sample : µl Poly(n-butyl methacrylate) 0.% Elution volume:.0ml Sample : µl Poly(isobutyl methacrylate) 0.% (Conventional type) KF-0L Elution volume:.0ml Column : Shodex GPC HK-0L, KF-0L Eluent : THF Flow rate :.0mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC HK-0L x Eluent : THF Flow rate :.0mL/ (small cell volume) Column temp. : 0 C Styrene butyl methacrylate copolymer Polyamide (Nylon /9) Polyamide (Nylon ) Sample : µl Styrene butyl methacrylate copolymer 0.% Sample : µl Nylon /9 0.% Sample : µl Nylon 0.% Column : Shodex GPC HK-0L x Eluent : THF Flow rate :.0mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC HK-HFIP0L Eluent : mm CF COONa in HFIP Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC HK-HFIP0L Eluent : mm CF COONa in HFIP Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C 9

62 Organic SEC (GPC) Columns: Preparative Columns Preparative columns *Preparative columns are made to order. [ KF-000 series: Shipping solvent Tetrahydrofuran (THF)] Standard Column F00 GPC KF-00, KF-0 F00 GPC KF-00, KF-0 F0 GPC KF-00., KF-0. F00 GPC KF-00, KF-0 F00 GPC KF-00, KF-0 F00 GPC KF-00 0, KF-0 F00 GPC KF-00 0, KF-0 F009 GPC KF-00M 0, KF-0M F000 GPC KF-G B (GPC KF-LG).0 0 *See page 0 for details of GPC KF-00 series. Base Material: Styrene divinylbenzene copolymer [ K-000 series: Shipping solvent Chloroform] Standard Column F00 GPC K-00, K-0 F0 GPC K-00, K-0 F0 GPC K-00., K-0. F00 GPC K-00, K-0 F00 GPC K-00, K-0 F00 GPC K-00 0, K-0 F00 GPC K-00 0, K-0 F009 GPC K-00M 0, K-0M F000 GPC K-G B (GPC K-LG).0 0 *See page for details of GPC K-00 series. Base Material: Styrene divinylbenzene copolymer 0

63 Preparative columns *Preparative columns are made to order. [ H-000 series: Shipping solvent Chloroform] F000 F000 F00 F000 F000 F000 F000 GPC H-00 GPC H-00 GPC H-00. GPC H-00 GPC H-00 GPC H-00 GPC H-00,000,000,000,000,000,000, Standard Column K-0 K-0 K-0. K-0 K-0 K-0 K-0 Organic SEC (GPC) Columns: Preparative Columns F0009 GPC H-00M, K-0M F000 GPC H-G B (GPC H-G).0 0 *See page for details of GPC K-00 series. Base Material: Styrene divinylbenzene copolymer [KF-000 series: Shipping solvent Tetrahydrofuran (THF)] [Customized columns] Standard Column F000 GPC KF KF-0 F000 GPC KF KF-0 F00 GPC KF KF-0. F000 GPC KF KF-0 F000 GPC KF KF-0 F000 GPC KF-G 0C (GPC KF-LLG) *See page 0 for details of GPC KF-00 series. Base Material: Styrene divinylbenzene copolymer [K-000 series: Shipping solvent Chloroform] [Customized columns] Standard Column F0900 GPC K K-0 F0900 GPC K K-0 F090 GPC K K-0. F0900 GPC K K-0 F0900 GPC K K-0 F0009 GPC K-G 0C (GPC K-LLG) *See page for details of GPC K-00 series. Base Material: Styrene divinylbenzene copolymer

64 LF Organic SEC (GPC) Columns: Linear Calibration Type Features Packed with unique multi-pore gels with a wide pore-size distribution Highly linear calibration curve without inflection points Achieves highly precise molecular weight distribution deteration Enables analysis over a broad range of molecular weights Rapid analysis column (LF-0) and high performance analysis column (LF-0) are also available LF-0 and LF-0 enables reduction of solvent use Fulfills USP L requirements Standard columns F00 GPC LF-0,000, F09 GPC LF-G. 0 *See page for applicability of SEC (GPC) columns to solvent replacement. Rapid analysis downsized column Base Material: Styrene divinylbenzene copolymer Shipping Solvent: Tetrahydrofuran (THF) LF-0 is recommended to be used with semi-micro type devices. F00 GPC LF-0 9,000, F09 GPC LF-G. 0 *See page for applicability of SEC (GPC) columns to solvent replacement. High performance semi-micro column Base Material: Styrene divinylbenzene copolymer Shipping Solvent: Tetrahydrofuran (THF) LF-0 is recommended to be used with semi-micro type devices. F00 GPC LF-0,000, F09 GPC LF-G. 0 *See page for applicability of SEC (GPC) columns to solvent replacement. Target molecular weight range and exclusion limit Measured with polystyrene (eluent: THF) Base Material: Styrene divinylbenzene copolymer Shipping Solvent: Tetrahydrofuran (THF) LF-0 LF-0 Target Molecular Weight Range 00,000,000 00,000,000 Exclusion Limit,000,000,000,000 LF-0 00,000,000,000,000 *Please use the above table for reference purposes only when selecting columns. Schematic diagram of linear calibration type packing Connecting linear calibration type columns (LF series) The linear calibration type column covers a broad range of molecular weights with only one kind of packing material. Connecting mixed-gel columns (KF-0L, etc.) Connecting different single pore-size columns (KF-0 + KF-0 + KF-0, etc.)

65 Calibration curve for LF-0 using polystyrene Molecular weight (Polystyrene) Elution volume (ml) Column : Shodex GPC LF-0 Eluent : THF Flow rate :.0mL/ Column temp. : 0 C Calibration curves for LF-0 and LF-0 using polystyrene Molecular weight (Polystyrene) LF-0 LF Elution volume (ml) Column : Shodex GPC LF-0, LF-0 Eluent : THF Flow rate : 0.mL/ (LF-0) 0.mL/ (LF-0) (small cell volume) Column temp. : 0 C Polyurethane Sample : Polyurethane 0.%, 0µL Column : Shodex GPC LF-0 x Eluent : THF Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Organic SEC (GPC) Columns: Linear Calibration Type Xylan Polyamide (Nylon/) Polymethyl methacrylate Sample : Xylan 0.%, 00µL Sample : Nylon / 0.%, 0µL Sample : 00µL Polymethyl methacrylate Column : Shodex GPC LF-0 Eluent : 0mM H PO + 0mM LiBr in DMSO/DMF=0/0 Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex GPC LF-0 Eluent : mm CF COONa in HFIP Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC LF-0 x Eluent : Methyl ethyl ketone Flow rate :.0mL/ Column temp. : 0 C Polyamic acid Sample : Poly(pyromellitic dianhydride-co-,'-oxydianiline), 00µL Effects of using multiple LF-0 columns for the separation of polystyrenes LF-0 x Sample : 0µL. Polystyrene (Mw :,00,000). Polystyrene (Mw :,000). Polystyrene (Mw :,000). Polystyrene (Mw :,000). Polystyrene (Mw :,00). Polystyrene (Mw : 0). Ethylbenzene LF-0 x Column : Shodex GPC LF-0 x n Eluent : THF Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC LF-0 x Eluent : 0mM LiBr + 0mM H PO in NMP Flow rate : 0.mL/ Column temp. : 0 C LF-0 x

66 Organic SEC (GPC) Columns: High Temperature/Ultra High Temperature Analysis Features HT-00 Wide product lineup to support a broad range of molecular weight analysis Fulfills USP L requirements UT-00 Dedicated to SEC analysis at high/ultra high temperatures with a maximum usable temperature of 0 C Suitable for the analysis of ultra high molecular weight polymer containing samples Fulfills USP L requirements Standard columns Usable Temperature ( C) F000 GPC HT-0, ~ F00 GPC HT-0, ~ 0, F00 GPC HT-0, ~ 0, F00 GPC HT-0, ~ 0 0, F00 GPC HT-0M, ~ 0 0, F00 GPC HT-0, ~ 0 0, F090 GPC HT-G 00 ~ F000 GPC UT-0.,00 00 ~ F00 GPC UT-0M,00 00 ~ 0 0 0, F00 GPC UT-0,00 00 ~ 0 0 0, F0900 GPC UT-G 00 ~ F090 GPC AT-0MS,000 *Ta ~ 0 0, F000 GPC AT-G *Ta ~ *The columns with M at the end of column names is mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. Base Material: Styrene divinylbenzene copolymer Shipping Solvent: Toluene *Ta: Ambient temperature Target molecular weight range and exclusion limit Measured with polystyrene (eluent: o-dichlorobenzene (ODCB)) HT-0 HT-0 HT-0 HT-0 HT-0M HT-0 UT-0. UT-0M UT-0 Target Molecular Weight Range,000 0,000,000 00,000 0,000,000,000 0,000 *(0,000,000),000 *(0,000,000) 00,000 *(00,000,000) 00 0,000,000 *(0,000,000) 00,000 *(00,000,000) Exclusion Limit 0,000 00,000,000,000 *(0,000,000) *(0,000,000) *(00,000,000) 0,000 *(0,000,000) *(00,000,000) AT-0MS,000 *(0,000,000) *Please use the above table for reference purposes only when selecting columns. *(0,000,000) *( ) Estimated value

67 Calibration curves for HT-00 series using polystyrene Molecular weight (Polystyrene) HT-0 HT-0 HT-0 HT-0 HT-0 HT-0M Elution volume (ml) Column : Shodex GPC HT-00 series Eluent : 0.% BHT in ODCB Flow rate :.0mL/ Column temp. : 0 C Molecular weight (Polystyrene) Elution volume (ml) Column : Shodex GPC UT-00 series Eluent : 0.% BHT in ODCB Flow rate :.0mL/ Column temp. : 0 C Effects of gel particle size in high temperature GPC columns High temperature GPC columns are suitable for the analysis of high molecular weight polymers that are difficult to be dissolved in ambient temperature solvents; examples of such polymers are polyethylene and polypropylene. The GPC UT-00 series packed with large particle size (0µm) are recommended for the analysis of macromolecules. The large particle size prevents potential molecular shear degradation of the sample. Column : UT-0M x (Particle size : 0µm) Calibration curves for UT-00 series using polystyrene UT-0. UT-0M UT-0 Column : AT-0MS x (Particle size : µm) Calibration curve for AT-0MS using polystyrene Molecular weight (Polystyrene) Elution volume (ml) Column : Shodex GPC AT-0MS Eluent : 0.% BHT in ODCB Flow rate :.0mL/ Column temp. : 0 C Column : HT-0M x (Particle size : µm) Sample :. Polystyrene (MW : 0,000,000). High density polyethylene (HDPE-A) Organic SEC (GPC) Columns: High Temperature/Ultra High Temperature Analysis Vo Shear degradation Vo Vo Shear degradation 0 Column : Shodex GPC UT-0M Shodex GPC HT-0M Shodex GPC AT-0MS Eluent : 0.% BHT in ODCB Flow rate :.0mL/ Column temp. : 0 C High density polyethylene Low density polyethylene Sample : High density polyethylene (HDPE-B) 0 Sample : Low density polyethylene (LDPE-C) 0 Molecular weight 0 RI Column : Shodex GPC UT-0M x Eluent : 0.% BHT in ODCB Flow rate :.0mL/, MALS (Multi angle light scattering) Column temp. : C Column : Shodex GPC HT-0M x Eluent : 0.% BHT in ODCB Flow rate :.0mL/ Column temp. : 0 C

68 Organic SEC (GPC) Columns: HFIP Features HFIP-00 HFIP-00 Columns exclusively used with hexafluoroisopropanol (HFIP) Fulfills USP L requirements Rapid analysis, solvent saving type Fulfills USP L requirements Standard columns [ HFIP-00 series] F00 GPC HFIP-0, F00 GPC HFIP-0,000, F00 GPC HFIP-0 0,000 0, F00 GPC HFIP-0 0, , F090 GPC HFIP-0M 0, , F00 GPC HFIP-0,000 0, F0000 GPC HFIP-G B (GPC HFIP-LG).0 0 *The columns with M at the end of column names is mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. Base Material: Styrene divinylbenzene copolymer Shipping Solvent: Hexafluoroisopropanol (HFIP) Rapid analysis downsized columns [ HFIP-00 series] HFIP-00 series is recommended to be used with semi-micro type devices. F000 GPC HFIP-0, F000 GPC HFIP-0,000, F000 GPC HFIP-0,000 0, F000 GPC HFIP-0, , F000 GPC HFIP-0M, , F000 GPC HFIP-0,000 0, F00 GPC HFIP-G A (GPC HFIP-G). 0 *The columns with M at the end of column names is mixed-gel column capable of analyzing samples over a wide range of molecular weight distribution. *See page for details of a column enclosed with HFIP. Base Material: Styrene divinylbenzene copolymer Shipping Solvent: Hexafluoroisopropanol (HFIP) Target molecular weight range and exclusion limit Measured with *PMMA (eluent: HFIP) Target Molecular Weight Range Exclusion Limit Target Molecular Weight Range Exclusion Limit HFIP-0,000 0,000 0,000 HFIP-0,000 0,000 0,000 HFIP-0 0,000 00,000 00,000 HFIP-0 0,000 00,000 00,000 HFIP-0 0,000 00,000,000,000 HFIP-0 0,000 00,000,000,000 HFIP-0 0,000 **(,000,000) **(,000,000) HFIP-0 0,000 **(,000,000) **(,000,000) HFIP-0M,000 **(,000,000) **(,000,000) HFIP-0M,000 **(,000,000) **(,000,000) HFIP-0 0,000 **(0,000,000) **(0,000,000) HFIP-0 0,000 **(0,000,000) **(0,000,000) *Please use the above tables for reference purposes only when selecting columns. *PMMA: Polymethylmethacrylate **( ) Estimated value

69 Calibration curves for HFIP-00 series using PMMA Molecular weight (PMMA) HFIP-0 HFIP-0 HFIP-0 HFIP-0 HFIP-0 HFIP-0M 9 0 Elution volume (ml) Calibration curves for HFIP-00 series using PMMA Molecular weight (PMMA) HFIP-0 HFIP-0 HFIP-0 HFIP-0 HFIP-0 HFIP-0M Elution volume (ml) Polyethylene terephthalate (PET) Sample : Polyethylene terephthalate 0.%, 0µL Mw=9, Organic SEC (GPC) Columns: HFIP Column : Shodex GPC HFIP-00 series Eluent : HFIP Flow rate :.0mL/ Column temp. : 0 C Column : Shodex GPC HFIP-00 series Eluent : HFIP Flow rate : 0.mL/ (HFIP-0, 0) 0.mL/ (HFIP-0, 0, 0M, 0) (small cell volume) Column temp. : 0 C Column : Shodex GPC HFIP-0M x Eluent : mm CF COONa in HFIP Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Polyamide (effects of added salt) Polybutylene terephthalate (PBT) Sample : Polycaprolactum (Nylon ) Sample : Polybutylene terephthalate 0.0%, 00µL HFIP mm CF COONa in HFIP Some samples analyzed under SEC mode with HFIP solvent may show abnormal peaks resulting from the ionic interaction. This interaction can be suppressed by adding sodium trifluoroacetate to the HFIP eluent Column : Shodex GPC HFIP-0M x Eluent : HFIP (solid line), mm CF COONa in HFIP (broken line) Flow rate :.0mL/ Column temp. : 0 C Column : Shodex GPC HFIP-0 + HFIP-0 Eluent : mm CF COONa in HFIP Flow rate :.0mL/ Column temp. : 0 C Polyamides (Nylon /0 and Nylon ) Polyacetal Sample : Nylon /0 0.%, 0µL Sample : Nylon 0.%, 0µL Sample : Polyacetal 0.%, 0µL Mw=9,00 Mw=,00 Mw=, Column : Shodex GPC HFIP-0M x Eluent : mm CF COONa in HFIP Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C Column : Shodex GPC HFIP-0M x Eluent : mm CF COONa in HFIP Flow rate : 0.mL/ (small cell volume) Column temp. : 0 C

70 Solvent Replacement Applicability of SEC (GPC) Columns Shipping Solvent: THF Shipping Solvent: DMF Solvent KF-0 KF-0 KF-0. KF-0L KF-0L KF-0 KF-0 KF-0 KF-0 KF-0 KF-0M KF-0L KF-0L KF-0L KF-0 KF-0 KF-0. KF-0 KF-0 KF-0 KF-0 KF-0 KF-0M LF-0 LF-0 LF-0 KD-0 KD-0 KD-0. KD-0 KD-0 KD-0 KD-0 KD-0 KD-0M Shipping Solvent: Chloroform Shipping Solvent: THF K-0 K-0 K-0 K-0. K-0L K-0L K-0 K-0 K-0 K-0 K-0M K-0L K-0L K-0L KF-0HQ KF-0HQ KF-0.HQ KF-0HQ KF-0HQ KF-0LHQ KF-0LHQ Tetrahydrofuran (THF) Chloroform Carbon tetrachloride Benzene Toluene p-xylene o-dichlorobenzene (ODCB) Trichlorobenzene (TCB) Dioxane Diethyl ether Ethyl acetate Acetone Methyl ethyl ketone Dimethylformamide (DMF) Dimethylacetamide (DMAc) Hexafluoroisopropanol (HFIP) m-cresol o-chlorophenol Quinolin N-Methylpyrrolidone (NMP) Dimethylsulfoxide (DMSO) 0% m-cresol/chloroform 0% o-chlorophenol/chloroform 0% HFIP/Chloroform Hexane Acetonitrile Methanol Water : Solvent replacement possible : Solvent replacement possible, but this may cause column performance to deteriorate slightly : Usable at 0 C or higher : Solvent replacement not possible

71 Calibration Standards for SEC [ Polystyrene (PS)] Features For organic solvent SEC (GPC) Less branched polystyrene with anionic polymerization Easily soluble in tetrahydrofuran (THF), chloroform, toluene, and o-dichlorobenzene (ODCB) Standard kit SL-0 SM-0 SH- Std. No. Mp Mw/Mn Std. No. Mp Mw/Mn Std. No. S-0 S- S-9. S-. S-. S-.0 S-.9 S-. S-0.9 S-0. F00 F00 F00 9,900,000 9,90,0,0,90,90,0 0 0 [Pullulan] Features S-0 S-90 S-0 S-0 S-9 S- S-0 S-. S-.0 S-.,0,000,90,000 0,000 0,000 9,000,00 9,00,0,90,0 [ Polymethylmethacrylate (PMMA)] Features S-0 S-90 S-0 S-0 S-000 S-99 S-0 For aqueous SEC (GFC) Unbranched pullulan standard High solubility in water eliates the possibility of recrystallization Mp,0,000,90,000,0,000,0,000,000,000 99,000 0,000 For organic solvent SEC (GPC) Narrow molecular weight distribution range Easily soluble in hexafluoroisopropanol (HFIP) and dimethylformamide (DMF) Standard kit Contents MW Range STANDARD SL-0 STANDARD SM-0 STANDARD SH- 0.g x 0 kinds 0.g x 0 kinds 0.g x kinds 0 9,900,0,0,000 0,000,0,000 Contents MW Range F00 STANDARD M- 0.g x kinds,0,00,000 (Note) Molecular weights (Mp, Mw/Mn) of a standard kit may vary depending on production lots. Mw/Mn Structural formula of S series M-00 M-0 M- M- M- M-. M-.9 C H 9 CH CH (Note) Molecular weights (Mp, Mw/Mn) of each standard kit may vary depending on production lots. Std. No. Mp Mw/Mn,00,000 0,000,000,00,00,0,0 n H Solvent Replacement Applicability of SEC (GPC) Columns Calibration Standards for SEC Standard kit Contents MW Range Structural formula of P series F00000 STANDARD P- Single type 0.g x kinds,00,000 O CH H H H O OH OH H H OH O H CH OH H H CH OH H H O H O OH H O OH H H OH H OH n Contents Mp Mw/Mn F0000 F0000 F0000 F0000 F0000 F0000 F0000 F0000 STD P-00 STD P-00 STD P-00 STD P-00 STD P-0 STD P-0 STD P-0 STD P- 0.g 0.g 0.g 0.g 0.g 0.g 0.g 0.g,000,000 9,000 0,000,00,000 9,00, Std. No. Mp Mw/Mn STD P-00 STD P-00 STD P-00 STD P-00 STD P-0 STD P-0 STD P-0 STD P-,000,000 9,000 0,000,00,000 9,00, (Note) Molecular weights (Mp, Mw/Mn) of a standard kit or each single type may vary depending on production lots. 9

72 Anion Exchange Chromatography Columns Features QA- DEAE- DEAEN-T DEAE-B ES-0N C WA- Suitable for analyzing relatively high molecular weight compounds: proteins, peptides, DNA, and RNA Usable in a wide ph range from ph to QA- fulfills USP L requirements Non-porous base material For rapid analysis Non-porous base material Can be used with UHPLC (available under hyperbaric conditions up to 0 MPa) Compared to IEC series columns, polyvinyl alcohol is used as base material and this offers different separation pattern Low hydrophobic interaction of proteins allows analysis under mild conditions Suitable for anion exchange analysis of low molecular weight compounds such as nucleotides Standard columns [ Strong anion exchange resin] Functional Group: Quaternary ammonium Ion Exchange Capacity (meq/g) Base Material Particle Size Column Size (mm) Shipping Solvent F00 IEC QA- 0. Polyhydroxymethacrylate, mM Na SO aq. [Weak anion exchange resin] Functional Group: Diethylaoethyl Ion Exchange Capacity (meq/g) Base Material Particle Size Column Size (mm) Shipping Solvent F IEC DEAE- 0. Polyhydroxymethacrylate, mM Na SO aq. F00 IEC DEAEN-T 0. Polyhydroxymethacrylate.. H O F000 Asahipak ES-0N C 0. Polyvinyl alcohol 9, mM,-Diaopropane + 0mM NaCl (ph0.0) F0 AXpak WA-. Polyhydroxymethacrylate 0, M Sodium phosphate buffer (ph.0)/ch CN =0/0 F00 AXpak WA-G Polyhydroxymethacrylate M Sodium phosphate buffer (ph.0)/ch CN =0/0 [Weak anion exchange resin] Functional Group: Diethylaoethy (UHPLC column) Ion Exchange Capacity (meq/g) Base Material Particle Size Column Size (mm) Shipping Solvent F0 PIKESS DEAE-B 0. Polyhydroxymethacrylate..0 0 H O Preparative columns *Preparative columns are made to order. Standard column F000 IEC QA QA- F090 IEC QA-G B (IEC QA-LG) F00 IEC DEAE DEAE- F090 IEC DEAE-G B (IEC DEAE-LG) F000 Asahipak ES-0N 0C ES-0N C F00 Asahipak GS-0G B

73 Proteins in human serum Sample : Human serum 0.%, 00µL. IgG. Transferrin. (Unknown). Serum albu 0 0 Column : Shodex IEC QA- Eluent : (A); 0mM Tris-HCl buffer (ph.) (B); (A) + 0.M NaCl Linear gradient; 00% (A) to 0% (B), 0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : Room temp. Effects of eluent ph on DEAE- analysis ph ph ph ph Sample : 00µL. Conalbu 0.%. Transferrin 0.%. Ovalbu 0.%. Trypsin inhibitor 0.%, ph Column : Shodex IEC DEAE- Eluent : (A); 0mM Piperazine-HCl buffer (ph.0), 0mM Bis-Tris-HCl buffer (ph.0) 0mM Tris-HCl buffer (ph.0), 0mM Ethanolae-HCl buffer (ph9.0) 0mM,-Diaopropane-HCl buffer (ph0.0) (B); (A) + 0.M NaCl Linear gradient; (A) to (B), 0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : C Anion Exchange Chromatography Columns Comparison of porous DEAE- and non-porous DEAEN-T for protein separation IEC DEAEN-T is a weak anion exchange column, having diethylaoethyl functional group modified on non-porous gel. The non-porous gel enables rapid analysis of proteins and peptides. DEAEN-T is also suitable for the analysis of small-volume samples, as it provides sharp peaks even with small injection volume. porous gel DEAE- non-porous gel DEAEN-T Gibberellin Isomers. GA CH HO HOOC COOH Sample : Gibberellin : Diethylaoethyl : Diethylaoethyl. endo GA CH Sample :. Conalbu 0.mg/mL. Ovalbu.mg/mL. Trypsin inhibitor.0mg/ml HO HOOC COOH Column Eluent Flow rate Detector Column temp. : Room temp. Injection vol. : 00µL : Shodex IEC DEAE- : (A); 0mM Piperazine-HCl buffer (ph.0) (B); (A) + 0.M NaCl Linear gradient; (A) to (B), 0 :.0mL/ : UV (0nm) Column Eluent Flow rate Detector Column temp. : Room temp. Injection vol. : 0µL : Shodex IEC DEAEN-T : (A); mm Piperazine-HCl buffer (ph.0) (B); (A) + 0.M NaCl Linear gradient; (A) to (B), 0 :.ml/ : UV (0nm) Column : Shodex Asahipak ES-0N C Eluent : CH COOH/H O/CH OH =0./0./99. Flow rate :.ml/ Detector : UV (0nm) Column temp. : 0 C Data was provided by Prof. Yamaguch, Faculty of Agliculture, University of Tokyo. Mercaptoalbu and non-mercaptoalbu Nucleotides Sulfide ion and cyanide ion Sample : Normal control serum. Globulin. Uric acid. HMA (Human Mercaptoalbu). HNA (Human Nonmercaptoalbu) Sample : 0µL. 'CMP 0µg/mL. 'UMP 0µg/mL. 'TMP 0µg/mL. 'CMP 0µg/mL. 'ADP 00µg/mL. 'UMP 0µg/mL. 'GMP 0µg/mL. 'AMP 0µg/mL 9. 'AMP 0µg/mL 0. 'GMP 0µg/mL 9 Sample : 0µL. HS - 0.mg/L. CN - 0.0mg/L Column : Shodex Asahipak ES-0N C Eluent : 0mM N-methylpiperazine-HCl buffer (ph.) + 00mM Na SO + 0.% C H OH Flow rate :.0mL/ Detector : UV (0nm) Column temp. : C Column : Shodex AXpak WA- Eluent : 0.M CH COOH aq. /0.M CH COONH aq.=0/00 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex IEC DEAE- Eluent : 0mM Na CO + mm Ethylenediae aq. + 0% CH OH Flow rate :.0mL/ Detector : Electrochemical (Electrode; Silver, 0mV SCE) Column temp. : C

74 Cation Exchange Chromatography Columns Features SP- CM- SP-0N SP-B SP-FT A ES-0C C P-S Suitable for analyzing relatively high molecular weight compounds: proteins, peptides, DNA, and RNA Usable in a wide ph range from ph to Non-porous base material For rapid analysis Non-porous base material Provides ultra-rapid analysis using conventional devices Non-porous base material Can be used with UHPLC (available under hyperbaric conditions for up to 0 MPa) Compared to IEC series columns, polyvinyl alcohol is used as base material offering different separation pattern Low hydrophobic interaction with proteins allows analysis under mild conditions Column for ao acids analysis by cation exchange mode Provides simultaneous analysis of different ao acids Fulfills USP L and L requirements Standard columns [ Strong cation exchange resin] Functional Group: Sulfopropyl Ion Exchange Particle Column Size Capacity Base Material Size (mm) (meq/g) Shipping Solvent F0 F000 F00 IEC SP- IEC SP-0N IEC SP-FT A Polyhydroxymethacrylate Polyhydroxymethacrylate Polyhydroxymethacrylate.., mM Na SO aq. 0mM Sodium acetate buffer + 0.M Na SO (ph.0) 0mM *MES buffer (ph.) Housing Material of SP-FT A: PEEK *MES: -(N-Morpholino)ethanesulfonic acid [Strong cation exchange resin] Functional Group: Sulfopropyl (UHPLC column) Ion Exchange Capacity (meq/g) Base Material Particle Size Column Size (mm) F0 PIKESS SP-B 0. Polyhydroxymethacrylate..0 0 Shipping Solvent 0mM Sodium acetate buffer + 0.M Na SO (ph.0) [ Weak cation exchange resin] Functional Group: Carboxymethyl Ion Exchange Capacity (meq/g) Base Material Particle Size Column Size (mm) Shipping Solvent F000 F000 IEC CM- Asahipak ES-0C C Polyhydroxymethacrylate Polyvinyl alcohol 9,000, mM Na SO aq. 0.M Sodium phosphate buffer (ph.) [For ao acid analysis] Functional Group: Sulfo (Na + ) Base Material Particle Size Column Size (mm) Shipping Solvent F CXpak P-S,00 Styrene divinylbenzene copolymer. 0 H O F000 CXpak P-G Styrene divinylbenzene copolymer. 0 H O Preparative columns *Preparative columns are made to order. Standard column F00 IEC SP SP- F090 IEC SP-G B (IEC SP-LG) F00 IEC CM CM- F090 IEC CM-G B (IEC CM-LG) F000 F00 Asahipak ES-0C 0C Asahipak GS-0G B ES-0C C

75 Protein separation using cation exchange columns ( I ) CM- (Weak cation exchange) 90µL injection 0 0 ( II ) SP- (Strong cation exchange) 0µL injection Column : ( I ) Shodex IEC CM-, ( II ) Shodex IEC SP-, ( III ) Shodex IEC SP-0N Eluent : (A); 0mM Sodium phosphate buffer (ph.0) (B); (A) + 0.M NaCl ( I,II ) Linear gradient; (A) to (B), 0 ( III ) Linear gradient; (A) to (B), 0 Flow rate : ( I,II ).0mL/ ( III ).ml/ Detector : UV (0nm) Column temp. : Room temp. ( III ) SP-0N (Strong cation exchange) non-porous type gel Sample :. Myoglobin. Trypsinogen. Ribonuclease A. α-chymotrypsinogen A. Cytochrome c. Lysozyme Ultra-rapid analysis of protein standards Sample : µl. Trypsinogen 0.%. α-chymotrypsinogen A 0.0%. Ribonuclease A 0.%. Cytochrome c 0.%. Lysozyme 0.0% Column : Shodex IEC SP-FT A Eluent : (A); 0mM MES buffer (ph.) (B); (A) + 0.M Na SO Linear gradient; (A) to (B), Flow rate :.ml/ Detector : UV (0nm) Column temp. : 0 C Cation Exchange Chromatography Columns Ultra-rapid analysis of hemoglobins Sample : µl AFSC Hemoglobin Control (-fold diluted) F A S C Analysis of nitrogen compounds following the testing methods for fertilizers Sample : 0µg/mL each, 0µL. Urea. Biuret. Dicyandiamide. Guanidine. Guanylurea Catecholaes Sample : 00µg/mL each, 0µL. DOPA HO HO CH CH NH COOH. Adrenaline HO CH CH NH HO OH CH. Noradrenaline HO CH CH NH HO OH. Dopae HO HO CH CH NH Column : Shodex IEC SP-FT A Eluent : (A); 0mM MES buffer (ph.) (B); (A) + 0.M Na SO Linear gradient; % (B) to 00% (B), Flow rate :.ml/ Detector : VIS (nm) Column temp. : 0 C Column : Shodex Asahipak ES-0C C Eluent :.9g KH PO + 0.g H PO in 000mL of H O Flow rate : 0.mL/ Detector : UV (90nm) Column temp. : 0 C 0 0 Column : Shodex Asahipak ES-0C C Eluent : 0mM Sodium malonate buffer (ph.0) + 0.M NaCl Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Paraquat and diquat Standard ao acids Paraquat HC N + + N CH Cl - Diquat + N + N Br - Sample : 0µL 0 9 Sample : 0.µM each, 00µL. Asp 0. Met. Thr. Ile. Ser. Leu. Glu. Tyr. Pro. Phe. Gly. Lys. Ala. NH. Cys. His 9. Val. Arg Column : Shodex Asahipak ES-0C C Eluent : 0mM Sodium phosphate buffer (ph.0) + 0mM NaCl Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Column Eluent Reagent Flow rate Detector Column Temp. : C Reaction Temp. : 0 C : Shodex CXpak P-S : MCI Buffer L-00-PH Kit (Mitsubishi Chemical Corporation) Low pressure gradient: 0; PH-, 0.; PH-,.; PH-,.; PH ; PH-RG : Ninhydrin Coloring Solution Kit for HITACHI (Wako Pure Chemical Industries, Ltd.) 0-; R:R=0:0 : (Eluent) 0.mL/ (Reagent) 0.mL/ : VIS (0nm)

76 Special Separation Modes Columns Hydrophobic Interaction Chromatography Column Features PH- Standard columns Product Code Separates proteins without denaturation Applicable to samples obtained after ammonium sulfate fraction treatment F000 HIC PH- Phenyl 0,000.0 H O Base Material: Polyhydroxymethacrylate Affinity Chromatography Columns Features AFpak Rigid polymer-based packing materials enable high speed analysis Functional group modified with chemically stable ligand (spacer) Minimum detachment of functional groups ensures highly reproducible analysis Product Code F9 F9 Chiral Separation Columns Features CDBS- CRX- Standard columns AFpak APA-9 AFpak ACH-9 Functional Group Ligand Protein A Choline oxydase, Acetylcholine esterase Ligand Load/Gel (g) mg Separates optical isomers by using their conformational compatibility differences Versatile column for chiral separation Fulfills USP L requirements Separates optical isomers by using their differences in metal complex formation capacities Suitable for ao acids, hydroxyl acids, and their derivatives Shipping Solvent Shipping Solvent 0.M Sodium phosphate buffer + 0.M NaCl + 0.0% NaN (ph.0) 0mM Sodium Phosphate buffer +.0M NaCl (ph.) Base Material: Polyhydroxymethacrylate Standard columns Product Code F00 ORpak CDBS- Functional Group β -Cyclodextrin derivative Base Material Silica. 0 Shipping Solvent.0% CH COOH + 0.M NaCl aq. /CH CN=0/0 F000 ORpak CRX- L-Ao acid derivative Polyhydroxymethacrylate mM CuSO aq. F0900 ORpak CRX-G Polyhydroxymethacrylate. 0 0.mM CuSO aq. High Temperature Reversed Phase Chromatography Column Features ET-RP Standard columns Product Code Capable of high temperature analysis up to 0 C High temperature analysis improves column efficiency and enables rapid analysis Fulfills USP L requirements Functional Group Shipping Solvent F00 ET-RP D,000 Octadecyl 0. 0 H O/CH CN=/ Base Material: Polyvinyl alcohol Pretreatment Column for Column Switching Method Feature GF-A Higher protein removal rate Column for column switching method Shipping Solvent F000 MSpak GF-A H O Base Material: Polyvinyl alcohol

77 Protein separation by hydrophobic interaction chromatography Column : Shodex HIC PH- Eluent : (A);.M Ammonium sulfate + (B) (B); 0.M Phosphate buffer (ph.0) Linear gradient; (A) to (B), 0 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : Room temp. Sample : 0µL. Cytochrome c 0.0%. Myoglobin 0.0%. Ribonuclease A 0.%. Ovalbu 0.%. Lysozyme 0.0%. α-chymotrypsinogen 0.0% Choline and acetylcholine 0 0 Sample : 0µL. Choline mg/l. Ethylhomocholine 0mg/L. Acetylcholine 0mg/L After choline and acetylcholine are separated using DE- polymer-based reversed phase column, solutes are passed through ACH-9 to generate hydrogen peroxide. The resulting hydrogen peroxide is detected using an electrochemical detector to enable highly sensitive analysis. *See page for DE- Column : Shodex RSpak DE- Post column : Shodex AFpak ACH-9 Eluent : 0.M H PO + 00mg/L Sodium -decansulfonate + mg/l Tetramethylammonium chloride (ph.0 adjusted by.0m NaOH) Flow rate :.0mL/ Detector : Electrochemical (Electrode : Pt, 0mV SCE) Column temp. : C Special Separation Modes Columns Chiral separation of epinephrines Chiral separation of lactic acids L-Epinephrine Sample : 0µL Epinephrine 0µg/mL Sample : Lactic acid 0µg/mL, 0µL. L-Lactic acid. D-Lactic acid HO HO OH NH D-Epinephrine OH HO NH HO Column : Shodex ORpak CDBS- Eluent : (0.0%(w/v) CH COOH + 0.M NaCl) aq./ch CN=9/ Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex ORpak CRX- Eluent : 0.mM CuSO aq. Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Chiral separation of mandelic acids Sample : Mandelic acid 00µg/mL, 0µL. D-Mandelic acid. L-Mandelic acid Comparison of ET-RP s column efficiencies (theoretical plate height) observed at high and normal temperature conditions high temp. (0 C).mL/ normal temp. (0 C) 0.mL/ Sample :. Uracil. Pyridine. Acetophenone. Benzene Sample Acetophenone Benzene Reduced plate height * 0 C 0 C.... * Plate height / particle diameter of the packed resin Column : Shodex ORpak CRX- Eluent : 0.mM CuSO aq. Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Column : Shodex ET-RP D Eluent : (Left) H O/CH CN=0/0 (Right) H O/CH CN=/ Detector : Photodiode array (0nm) Column Oven : Polaratherm 9000 Series (SandraSelerity Technologies, Inc) Note: The eluent was introduced into the column after being preheated and was cooled after column elution, then introduced into the detector. Data provided by Research Institute for Chromatography bvba

78 GPC Clean-up Columns Features EV Suitable for fractionation of residual pesticides in foods EV-000 AC is used in Shoku-An No (October rd, 00, Japan) of the Pharmaceutical and Food Safety Bureau, MHLW, Section Simultaneous GC/MS (LC/MS) Analyses of Agricultural Chemicals in Livestock and Marine Products. EV000AC-F is used in Shoku-An No. 0 (February th, 0, Japan) of the Pharmaceutical and Food Safety Bureau, MHLW, Section LC/MS Analyses of Agricultural Chemicals in Livestock and Marine Products. PAE Suitable for cleaning up high-moisture samples such as blood and bottom sediment Highly effective for fractionation of endocrine disruptors in environmental samples Eluent Column No Ethylacetate/Cyclohexane EV-000, EV-00 Appropriate columns for GPC Clean-up Does the sample contain water? Acetone/Cyclohexane Acetonitrile EV-000 AC, EV000AC-F PAE-000, PAE-00 Yes Acetone PAE-000 AC, PAE-00 AC GPC Clean-up for residual pesticides in foods, etc. Shipping Solvent F09000 CLNpak EV000AC-F Acetone/Cyclohexane=/ F09000 CLNpak EV-G ACC.0 00 Acetone/Cyclohexane=/ F09000 CLNpak EV-000 AC Acetone/Cyclohexane=/ F09000 CLNpak EV-G AC Acetone/Cyclohexane=/ F09000 CLNpak EV Ethylacetate/Cyclohexane=/ F09000 CLNpak EV-G Ethylacetate/Cyclohexane=/ F09000 CLNpak EV Ethylacetate/Cyclohexane=/ Base Material: Styrene divinylbenzene copolymer GPC Clean-up for phthalic acid esters in sediments, biological samples, blood, etc. Shipping Solvent F00 CLNpak PAE Acetonitrile F00 CLNpak PAE-G Acetonitrile F000 CLNpak PAE Acetonitrile F00 CLNpak PAE-000 AC Acetone F00 CLNpak PAE-G AC Acetone F000 CLNpak PAE-00 AC Acetone Base Material: Polyvinyl alcohol

79 Sample preparation outline for simultaneous GC/MS and LC/MS analysis of agricultural chemicals in livestock and marine products (part ) [Outline] Extraction Liver, Kidney Acetone/n-Hexane (/) GPC Muscle, Fat, Fish Milk, Egg Honey GPC Acetonitrile Salting-out Preparaion range of agricultural chemicals using EV-000 AC Tricyclazole (mg/l) (agricultural chemical marker) Acrinathrin (mg/l) (agricultural chemical marker) GPC Clean-up Columns Purification Fraction- [*] [*] Fraction- Agricultural chemicals fraction Agricultural chemicals fraction [*] [*] muscle, fat, fish, milk, egg liver, kidney agricultural chemicals fraction fraction- fraction- Test sample GPC column : Shodex CLNpak EV-000 AC + EV-G AC * Purification with ethylenediae-n-propylsilyled silica gel i-column * Purification with silica gel i-column Column : Shodex CLNpak EV-G AC + EV-000 AC Eluent : Acetone/Cyclohexane=/ Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Injection vol. : ml Sample preparation outline for simultaneous LC/MS analysis of agricultural chemicals in livestock and marine products (part ) [Outline] Extraction Other than honey Honey Acetone/n-Hexane (/) under acidic conditions with acetic acid Preparaion range of agricultural chemicals using EV000AC-F Acrinathrin (mg/l) (agricultural chemical marker) Tricyclazole (mg/l) (agricultural chemical marker) GPC Clean-up of fatty tuna and beef tallow Sample : ml Beef tallow Fatty tuna. Acrinathrin mg/l. Tricyclazole mg/l Purification Macroporous diatomaceous earth column chromatography GPC Agricultural chemicals fraction [*] [*] Fluvalinate (mg/l) fraction range GPC Clean-up of beef tallow GPC Clean-up of fatty tuna [*] [*] fraction range (when purification is insufficient) Test sample GPC column : Shodex CLNpak EV000AC-F + EV-G ACC * Purification with trimethyl aopropylsilyled silica gel i-column * Purification with ethylenediae- N-propylsilyled silica gel i-column Column : Shodex CLNpak EV-G ACC + EV000AC-F Eluent : Acetone/Cyclohexane=/ Flow rate :.0mL/ Detector : UV (nm) Column temp. : C Injection vol. : ml Column : Shodex CLNpak EV-G AC + EV-000 AC Eluent : Acetone/Cyclohexane=/ Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Injection vol. : ml Separation of PSB and insulating oil using PAE-00 Sample : 0µL PCB std. KC-mixture Insulating oil dissolved by Hexane 00mg/L,000mg/L GPC Clean-up of carcinogens in diesel dust measured using PAE-00 AC Benzo[a]fluoranthene,-Dinitropyrene Bisphenol A Benzo[a]pyrene Hydroxybenzo[a]pyrene mixture Eluting positions of phthalic acid esters using PAE-00 AC RI Corn oil Sulfer H O CO Insulating oil PCB RI Bis(-ethylhexyl) adipate methanol RI Phthalic acid esters acetone hexane Retention time () Column : Shodex CLNpak PAE-00 Eluent : Methanol, Acetone, Hexane Flow rate : 0.mL/ Detector : Photodiode array (09nm) Column temp. : 0 C Source: Mr. Tetsuya Sawatsubashi (Mitsubishi Heavy Industries, Ltd.) et al., Search of Liquid Chromatographic Clean-up Materials for Rapid PCB Analysis and Evaluation of Their Separation Characteristics. Journal of Environmental Chemistry, 00, Vol., No., p Compound Rt() Compound Rt() Anthracene Chrysene Fluoranthene Benzo[a]fluoranthene Benzo[b]fluoranthene Benzo[k]fluoranthene Pyrene -Hydroxypyrene Benzo[a]pyrene Hydroxybenzo[a]pyrene compound Bisphenol A,-Dinitronaphthalene -Nitropyrene,-Dinitropyrene,-Dinitropyrene,-Dinitropyrene Column : Shodex CLNpak PAE-00 AC Eluent : Acetone Flow rate : 0.mL/ Detector : UV (0nm) Column temp. : Room temp. Data provided by Kazuichi Hayakawa Ph.D., Faculty of Pharmaceutical Sciences, Kanazawa University. RI RI UV (0nm) UV (0nm) -Nonylphenol DDT Bisphenol A Anthracene Column : Shodex CLNpak PAE-00 AC Eluent : Acetone Flow rate : 0.mL/ Detector : UV (0nm), RI Column temp. : Room temp.

80 Changes Notices Some Shodex guard columns have been renamed. There is no change in their product codes. Renamed products list Page New Former RSpak DE-G A RSpak DE-G F000 RSpak DE-G A RSpak DE-SG F00 RSpak DM-G A RSpak DM-G F000 RSpak DE-G B RSpak DE-LG F0090 RSpak DM-G B RSpak DM-LG F000 SUGAR SC-G B SUGAR SC-LG F00090 SUGAR SP-G B SUGAR SP-G F000 SUGAR KS-G B SUGAR KS-G F0000 RSpak DC-G A RSpak DC-G F000 SUGAR SCG A SUGAR SC-G F000 SUGAR KS-G B SUGAR KS-LG F0000 RSpak DC-G B RSpak DC-LG F000 0 RSpak KC-G B RSpak KC-G F RSpak KC-G B RSpak KC-LG F0000 PROTEIN KW-G B PROTEIN KW-G F00 9 PROTEIN KW-G B PROTEIN KW-LG F09 OHpak SB-G B OHpak SB-G F090 OHpak SB-G B OHpak SB-LG F09 0, GPC KF-G A GPC KF-G F0000 GPC K-G A GPC K-G F000 GPC KD-G A GPC KD-G F00 0 GPC KF-G B GPC KF-LG F000 0 GPC K-G B GPC K-LG F000 GPC H-G B GPC H-G F000 GPC KF-G 0C GPC KF-LLG F000 GPC K-G 0C GPC K-LLG F0009 GPC HFIP-G B GPC HFIP-LG F0000 GPC HFIP-G A GPC HFIP-G F00 0 IEC QA-G B IEC QA-LG F090 0 IEC DEAE-G B IEC DEAE-LG F090 IEC SP-G B IEC SP-LG F090 IEC CM-G B IEC CM-LG F090

81 USP0-NF Column List No. Packing Material Recommended Column Page L L L L L0 L L L9 L0 L L L L L L L L L9 L L L9 L L L L Octadecyl silane chemically bonded to porous or non-porous silica or ceramic micro-particles,. to 0µm in diameter, or a monolithic rod. Porous silica particles,. to 0µm in diameter, or a monolithic silica rod. Octylsilane chemically bonded to totally or superficially porous silica particles,. to 0µm in diameter, or a monolithic silica rod. An essentially monomolecular layer of aopropylsilane chemically bonded to totally porous silica gel support,.-0µm in diameter, or a monolithic silica rod. Nitrile groups chemically bonded to porous silica particles,.-0µm in diameter, or a monolithic silica rod. Phenyl groups chemically bonded to porous silica particles,.-0µm in diameter, or a monolithic silica rod. Strong cation-exchange resin consisting of sulfonated cross-linked styrene-divinylbenzene copolymer in the hydrogen form, to µm in diameter. Strong cation-exchange resin consisting of sulfonated cross-linked styrene-divinylbenzene copolymer in the calcium form, about -µm in diameter. Dihydroxypropane groups chemically bonded to porous silica or hybrid particles,.-0µm in diameter, or a monolithic silica rod. A rigid, spherical styrene-divinylbenzene copolymer, to 0µm in diameter. A cation-exchange resin made of porous polystyrene gel with sulfonic acid groups, about -µm in diameter. An anion-exchange resin made of porous polymethacrylate or polyacrylate gel with quartenary ammonium groups, -µm in size. Packing having the capacity to separate compounds with a molecular weight range from (as detered by polyethylene oxide), applied to neutral, anionic, and cationic water-soluble polymers. A polymethacrylate resin base, cross-linked with polyhydroxylated ether (surface contained some residual carboxyl functional groups) was found suitable. Packing having the capacity to separate dextrans by molecular size over a range of,000 to 00,000 Da. It is spherical, silica-based, and processed to provide ph stability. Strong cation-exchange resin consisting of sulfonated cross-linked styrene-divinylbenzene copolymer in the lead form, about to 9µm in diameter. Packing having the capacity to separate proteins by molecular size over a range of,000 to 0,000 Da. It is a polymethacrylate gel. A methacrylate-based size-exclusion packing for water-soluble samples. A hydrophilic polyhydroxymethacrylate gel of totally porous spherical resin. Beta cyclodextrin, R,S-hydroxypropyl ether derivative, bonded to porous silica particles, -0µm in diameter. Strong cation-exchange resin consisting of sulfonated cross-linked styrene-divinylbenzene copolymer in the sodium form, about to 0µm in diameter. Packing for the size-exclusion separations of proteins (separation by molecular weight) over the range of to 000 kda. The packing is a spherical.- to 0-µm, silica or hybrid packing with a hydrophilic coating. Porous vinyl alcohol copolymer with a C alkyl group attached to the hydroxyl group of the polymer, to 0µm in diameter. A rigid, spherical polymetacrylate, to µm in diameter. Silica-based, weak cation-exchange material, µm in diameter. Substrate is surface polymerized polybutadiene-maleic acid to provide carboxylic acid functionalities. Capacity not less than 9µEq/column. Polyae chemically bonded to cross-linked polyvinyl alcohol polymer, µm in diameter. C Silica CM Silica CP Silica SIL Silica C Silica NH Silica CN Silica NPE SUGAR SH0 SUGAR SH RSpak KC- IC Y- SUGAR SC0 SUGAR SC SUGAR SC EP SC0-F USPpak MN- PROTEIN KW-00 series PROTEIN LW-0 KW00 series RSpak RP- RSpak DS- RSpak DS- GPC KF, K, KD, HK, LF, HT, UT, AT, HFIP series SUGAR SC0 SUGAR SC SUGAR SP00 SUGAR KS-00 series RSpak DC- SUGAR SZ SUGAR SC EP SC0-F USPpak MN- SUGAR SH0 SUGAR SH RSpak KC- IC Y- CXpak P-S IEC QA- OHpak SB-0 HQ OHpak SB-0. HQ PROTEIN KW-00 series PROTEIN LW-0 KW00 series SUGAR SP00 OHpak SB-0 HQ OHpak LB-0 OHpak SB-00 HQ series OHpak LB-00 series ODP HP RSpak DM- OHpak SB-00 HQ series OHpak LB-00 series ORpak CDBS- RSpak DC- SUGAR KS-00 series CXpak P-S PROTEIN KW-00 series PROTEIN LW-0 KW00 series Asahipak ODP-0 Asahipak ODP-0 ET-RP RSpak DE- RSpak DE- RSpak DE- IC YK- Asahipak NHP ,,,,,, Changes Notices USP0-NF Column List 9

82 Column Cleaning Procedures Change in peak shapes, elution tig, and the elevated column pressure may be resolved by cleaning the column. This section describes general indications of column deterioration and column cleaning procedures. For detailed column cleaning procedures, refer to operating manual packaged with each column. Typical indicators of column deterioration. Elevated column pressure. Abnormal peak shapes (broadening, leading, or tailing) and split peaks. Change in retention time. Unstable baseline Cleaning solvent selection guide Solvents capable of dissolving the adsorbed substances Solvents with high eluting power (variable depending on separation mode) *Use the solvent specified in the operation manual. Standard cleaning procedures For an efficient cleaning, reverse the direction and reduce the flow rate to / of the regular flow. Reversed phase chromatography columns Sugar analysis columns Aqueous SEC (GFC) chromatography columns Ion exchange chromatography columns Clean the columns with solvent containing higher concentration of organic solvent such as methanol, acetonitrile, or THF. (In case of using buffer as a mobile phase, miscibility of the buffer solution and the organic solvents need to be checked) [Ligand exchange columns (SUGAR series)] In case of counter ion detachment Flush or inject solvent containing the salt corresponding to the modified counter-ligand. [Polymer-base ao columns (NHP series)] In cases where an acidic substance has been bound to the ao functional group Flush with solvents in the following sequence: water, 0.M perchloric acid (aq.), water, 0.M NaOH (aq.), water, and mobile phase. In cases where an ionic substance has been adsorbed Use a solvent with higher salt concentration or solvent with different ph from the mobile phase. In cases where a hydrophobic substance has been adsorbed Use a solvent containing organic solvent. (In case of using buffer as a mobile phase, miscibility of the buffer solution and the organic solvents need to be checked) In cases where an ionic substance has been adsorbed Use a solvent with higher salt concentration or solvent with different ph from the mobile phase. In cases where a hydrophobic substance has been adsorbed Use a solvent containing organic solvent. (In case of using buffer as a mobile phase, miscibility of the buffer solution and the organic solvents need to be checked) In cases where protein have been adsorbed Inject - ml of 0. M NaOH (aq.) or 0% (v/v) acetic acid (aq.) several times. Hydrophobic interaction chromatography columns In cases where protein have been adsorbed Inject - ml of 0. M NaOH (aq.) or 0% (v/v) acetic acid (aq.) several times. *The volume of the cleaning solvent required is -0 times the column volume. *Avoid pressure elevation during the cleaning. *The cleaning is limited and does not guarantee the full regeneration of the column to its original condition. For your information One typical cause of the column pressure elevation is the solid substance being clogged at the inlet filter of the column. In this case, reverse the direction and reduce the flow to / of the regular flow rate. This may remove the solid substance causing the elevated pressure. 0 *Use the solvent specified in the operation manual.

83 General Precautions for Column Handling For the best performance of the column, please follow the instructions given below. Column mounting Before mounting the column, replace the eluent within all the HPLC system with the mobile phase used for the analysis. *If the mobile phase of the choice is not miscible with the eluent already in the system, use solvent that is miscible with both solvents first to clean the system. *Buffer or salt solution may precipitate when mixed with organic solvent of different concentrations. Attach the column in the direction as indicated by arrow marked on the column. Gradually increase the flow rate of the solvent introduced to the column. When heating the column, be sure to pump the eluent at a low flow rate until the specified temperature is reached, and then gradually increase the flow rate up to the requirement after the column has been heated sufficiently. Column dismounting If the column is heated, turn off the heater while keeping the flow rate at / of the regular flow. Turn off the pump when the column is cooled to room temperature. Remove the column from the system securely tighten the end caps. Column storage For long-term storage, replace the solvent with shipping solvent and securely tighten the end caps. Column Cleaning Procedures General Precautions for Column Handling Store the column in a location with stable temperature. For long-term storage of SEC columns, immersion method is recommended. *Please refer to the immersion method on the operation manual. Other Avoid physical shock on the column. Be cautious not to drop the column from a high position. Do not bend the column. Avoid opening the column s end-fitting, it can cause alteration of column s performance. *Read the operation manual before using the column.

84 Column Trouble Shooting Common causes for abnormal chromatograms Abnormal peak shapes Main cause Solution Frequent problem Peak tailing Selection of column and/ or eluent appropriate NO YES Strong sample retention Void existing at top of column Change column and/or eluent Replace column Peak split, shoulders Adsorption of impurities in column Channeling in column Wash column Check column performance Replace column Replace column Peak leading Leading caused by sample properties (ionic and micellar properties) Change column and/or eluent Broad peak Problem solved by reducing injection volume NO YES Adsorption of impurities in column Deterioration of column Sample overload Wash column Check column performance Replace column Reduce injection volume Ghost peak Contaation Impurities existing in eluent Prepare fresh sample Wash system flow line Replace eluent No peak System trouble Eluent not flowing Injector at wrong position (load/inject) Detector deactivated Check system Sample adsorbed in column Repeat sample injection Insufficient column equilibration Pressure elevation Pump A B C Column Detector Main cause START Injector Solution Frequent problem Salt precipitated in the eluent YES Pressure still high after washing NO Salting out Change eluent composition Wash system before analysis NO YES Pressure still high when C is disconnected NO Detector piping blocked Clean detector Replace piping YES Pressure still high when B is disconnected YES NO Column blocked Pressure under maximum column pressure YES NO Screen eluent and sample through 0.µm filter YES NO Column deteriorated Column end-fitting blocked Check column performance Replace column Replace column Pressure still high when A is disconnected NO Injector blocked Clean injector Replace injector YES Used line filter NO Pump piping blocked Replace filter in pump Clean pump Replace pump piping YES Line filter blocked Wash line filter Replace line filter

85 Unstable baseline START Column Pressure normal YES Baseline stable when pump stopped YES Leakage observed YES HPLC System Trouble Shooting NO NO NO Common causes for abnormal chromatograms YES Monotonic drift NO Main cause Solution Malfunction of check valve Temperature fluctuation Deterioration of detector lamp Insufficient grounding Malfunction of recorder Bubbles in flow cell Contaation of flow cell Insufficient eluent replacement (with different solvent, salt or others) Frequent problem Replace check valve Clean check valve Warm up detector sufficiently Shield detector from wind Check column oven Check detector temperature control Replace lamp Establish sufficient grounding Repair recorder Wash inside of detector Wash inside of detector Wash flow line of HPLC Column Trouble Shooting HPLC System Trouble Shooting Flow rate fluctuation Contaation of column Pulsation of pump Wash column Check column performance Replace column Use damper Tighten connections Deterioration of eluent Use eluent containing stabilizer (for THF, use THF containing BHT) Noise Main cause Solution Frequent problem START Insufficient grounding Establish sufficient grounding Baseline stable when pump stopped NO Irregular noise Deterioration of detector lamp Replace detector lamp YES Malfunction of recorder Repair recorder Shodex DEGAS used NO Insufficient degassing eluent Use Shodex DEGAS YES Spike noise YES OK Spike noise found from beginning NO YES Air in column Problem solved by applying back pressure to column(*) (*) Do not apply back pressure to detector Column temperature exceeding eluent boiling point NO Check column performance Replace column Reduce temperature of column oven and/or post-column reaction coil Noise shape leading NO Contaation of flow cell Wash flow cell YES Bubbles in flow cell Repair detector

86 Index by Columns are listed in alphabetical order without their series names. [Series name] AFpak Asahipak AXpak CLNpak CXpak EP GPC HIC HILICpak IC IEC MSpak OHpak ORpak PIKESS PROTEIN RSpak Silica STANDARD STD SUGAR USPpak A H P ACH-9 APA-9 AT-0MS C C CM CP CP-0 C CP-0 CDBS- CM CN CRX- D DC DE DEAE DM DS E ET-RP D ES-0C ES-0N EV F 0 0,, 0, 0 FL-, FL- filter, G GF-0 GF-0 GF-A GF-0 GF-0 GF-M HQ GS-0 GS-0 GS-0 GS-0 GS-0 GS-0 GS-0 GSM-00 H-000 HFIP-00 HFIP-00 HK-00 HK-HFIP0L HT-00 I I-A J JJ-0 K K-000 K-000 K-00 K-00D KC KD-00 KF-000 KF-000 KF-00HQ KF-00 KF-00D KF-00 KS-000 KS-00 KW00 KW-00 KW-000 L LB-00 LF LW-0 M M- MN- N NH NHP NI- NN NPE D NY- O ODP HP ODP 0, 0 0 0, , 0 P-S P- P PAE PH- PYE D 9 9 Q QA- 0 R RP- S SB-000 SB-00 HQ SC0, SC SC0-F SC SH0, SH SH- SI- SI-0 E SI- E SI-90 E SIL SL-0 SM-0 SP00 SP ST-R SZ T T- U UT-00 V VC-0 VG-0 VN-0 VT-0 W WA- 0 Y Y- YK- YS-0

87 Index by F000 F000 F000 F000 F00 F00 F00 F000 F000 F000 F000 F000 F000 F000 F00 F000 F000 F000 F000 F000 F000 F000 F00 F000 F000 F000 F000 F000 F0090 F009 F009 F009 F009 F009 F009 F009 F009 F0099 F00 F0 F0 F0 F0 F0 F09 F00 F0 F0 F00 F00 F00 F00 F00 F090 F09 NY- ST-R HFIP-0 HFIP-0 LF-0 LF-0 LF-0 HFIP-0 HFIP-0 HFIP-0 HFIP-0M HK-0 HK-0 HK-0L HK-HFIP0L KF-0L KF-0L KF-0L KF-0L KF-0L KF-0 KF-0 KF-0. KF-0 KF-0 KF-0 KF-0 KF-0 KF-0M KF-0 KF-0 KF-0. KF-0 KF-0 KF-0 KF-0 KF-0M KF-0 K-0 KF-0HQ KF-0HQ KF-0.HQ KF-0HQ KF-0HQ KF-0LHQ K-0 KF-0LHQ K-0. K-0 K-0 K-0 K-0 K-0 K-0M K-0L Page F09 F09 F09 F09 F00 F00 F0 F00 F00 F00 F00 F00 F090 F00 F00 F00 F00 F00 F090 F09000 F09000 F09000 F09000 F09000 F09000 F09000 F000 F000 F000 F000 F000 F0009 F00 F00 F00 F00 F00 F00 F009 F0 F0 F00 F00 F00 F00 F00 F00 F009 F0 F000 F000 F00 F000 F000 F000 K-0L K-0L K-0L K-0L KD-0 KD-0 KD-0. KD-0 KD-0 KD-0 KD-0 KD-0 KD-0M HFIP-0 HFIP-0 HFIP-0 HFIP-0 HFIP-0 HFIP-0M EV-000 EV-G EV-000 AC EV-G AC EV-00 EV000AC-F EV-G ACC H-00 H-00 H-00 H-00 H-00 H-00M H-00. K-00 K-00 K-00 K-00 K-00 K-00M K-00 K-00. KF-00 KF-00 KF-00 KF-00 KF-00 KF-00 KF-00M KF-00. KF-00 KF-00 KF-00. KF-00 KF-00 CM Page F000 F00 F00 F0 F000 F00 F0 F0 F F090 F000 F00 F00 F000 F00 F00 F00 F00 F00 F F0 F00 F00 F0 F00 F0 F0 F00 F00 F00 F0 F0 F0 F0 F90 F900 F900 F90 F90 F90 F90 F90 F90 F90 F90 F90 F90 F000 F000 F0009 F000 F00 F00 F00 F000 PH- QA- DEAEN-T DEAE-B SP-0N SP-FT A SP-B SP- DEAE- AT-0MS UT-0. UT-0M UT-0 HT-0 HT-0 HT-0 HT-0 HT-0M HT-0 P-S WA- KS-0 KS-0 KS-0 KC- KC- E KS-0 KS-0 KS-0 SH0 SH SC0 SC SP00 MN- SC0-F SB-0 HQ SB-0. HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0 HQ SB-0M HQ SB-0 HQ LB-0 LB-0M LB-0 KS-00 KS-00 KS-00 KS-00 KS-00 KS-00 KC-0 KW Page Column Trouble Shooting Index by

88 Page F00 F00 F0 F0 F0 F0 F0 F0 F0 F0 F0 F0 F000 F00 F00 F00 F000 F00 F00 F00 F00 F00 F000 F00 F00 F00 F00 F009 F000 F00 F00 F00 F00 F0 F0000 F0000 F0000 F0000 F0000 F000 F00090 F0000 F000 F000 F00 F00 F00 KW-00 KW-00 DE-0 DC-0 DM-0 SB-00 SB-00. SB-00 SB-00 SB-00 SB-00 SB-00M QA-0 DEAE-0 SP-0 CM-0 CM D CM E CM D CP D CP E CP D SIL D SIL E C D C E CN D CN E NH D NH E NPE D PYE D C-D C-E KS-G B (KS-LG) KC-G B (KC-LG) KS-G B (KS-G KC-G B (KC-G) SH-G SP-G B (SP-G) SC-G B (SC-LG) HK-G filter SZ-G SCG A (SC-G) KW-G B (KW-G) KW00G-A LW-G B , Page F000 DS-G F000 DE-G A (DE-G) F00 F000 F000 F0090 F0000 F000 F000 F00 F000 F0000 F000 F0000 F000 F000 F000 F000 F000 F000 F0009 F000 F0900 F090 F0900 F090 F090 F09 F09 F090 DE-G B (DE-LG) HK-G P-G Y-G WA-G AT-G 0 H-G B (H-G) IA-G F00 KD-G A (KD-G) F00 T-G F0000 HFIP-G B (HFIP-LG) F000 NN-G F00 HFIP-G A (HFIP-G) YS-G CRX-G KF-00D UT-G HT-G SB-G B (SB-G) SB-0G LB-G B K-00D 0 0 0,, SB-G B F09 (SB-LG) 9 F09 DE-G A (DE-SG) DM-G A (DM-G) DC-G A (DC-G) KF-G A (KF-G) K-G A (K-G) DC-G B (DC-LG) DM-G B (DM-LG) KF-G B (KF-LG) K-G B (K-LG) KF-G 0C (KF-LLG) K-G 0C (K-LLG) KW-G B (KW-LG) 0, 9 Page F09 F090 F090 F090 F090 F090 F09 F090 F09 F09 F09 F09 F090 F090 F000 F000 F000 F000 F00 F00 F00 F009 F000 F00 F00 F00 F000 F000 F00 F00 F00 F00 F00 F00 F000 F00 F00 F00 F00 F00 F00 F0 F0 F0 F0 F00 F00 F009 F000 F00 RP-G QA-G B (QA-LG) DEAE-G B (DEAE-LG) SP-G B (SP-LG) CM-G B (CM-LG) YK-G NI-G SI-90G LF-G SI-0G SI-9G SI-9G SI-GF SI-GF filter ODP-0G A CP-0G A CP-0G A ODP-0G B NHP-0G A NHP-0G B GF-G B GS-G B GS-0G B GS-0G B ODP-0G A ODP-0 B NHP-0G A NHP-LF VG-0G A VG-0G A VT-0G A VN-0G A VN-0G A VC-0G A NHP-0G A ODP-0G A CP-0G B CP-0G B PAE-G PAE-G AC ODP HPG-A ODP HPG-A ODP-0G A ODP HPG-A ODP HPG-B GS-0 0F GS-0 0F GS-0 0F GS-0 0F PAE ,0,

89 Page F00 F000 F00 F00 F00 F00 F00 F00 F00 F00 F009 F000 F00 F000 F000 F000 F00 F00 F000 F00 F000 F000 F99000 F990 F990 F990 F990 F990 F990 F990 F990 F990 F99 F99 F99 F990 F990 F9990 F999 F0000 F0000 F0000 F0000 F0000 F0000 F000 F0000 F0000 F000 F000 F000 F000 F000 F F00900 PAE-000 AC GS-0 0F GS-0 0F GS-0 0F GSM-00 0F GS-0 0G GS-0 0G GS-0 0G GS-0 0G GS-0 0G GS-0 0G GS-0 0G GSM-00 0G ODP-0 0E CP-0 0E CP-0 0E ODP-90 0F ODP HP-0E NHP-0 0E NHP-90 0F ES-0C 0C ES-0N 0C KW-0. KW-0 KW-0 KW0.-F KW0-F KW0-F KW0-F LW-0 Y- I-A NI- SI-90 E SI-0 E T- SI- E SI- D SI- B DS- DM- DC- DE- DE- DE- DS- SZ SC NN- NN- NN- JJ-0 D JJ-0 D RP- DE-L Page F9 F9 F00 F000 F000 F00 F000 F00 F000 F00 F000 F00 F00 F00 F00000 F0000 F0000 F0000 F0000 F0000 F0000 F0000 F0000 F000 F000 F000 F0000 F000 F000 F0000 F000 F000 F000 F000 F000 F000 F000 F000 F000 F0009 F00 F00 F0 F0 F00 F00 F00 F00 F00 F00 F00 F00 F000 F000 F000 APA-9 ACH-9 YK- YS-0 CRX- CDBS- CM 0E CM 0E SIL 0E SIL 0E NH 0E NH 0E C 0E C 0E GF-0 HQ GF-0 HQ GF-0 HQ GF-0 HQ GF-M HQ GS-0 HQ GS-0 HQ GS-0 HQ GS-0 HQ GF-0 E PAE-00 PAE-00 AC GF-0 B GF-0 D GF-0 D GF-0 D GF-0 E ODP-0 E ODP-0 D ODP-0 E ODP-0 D CP-0 E CP-0 D CP-0 E CP-0 D ODP-0 D ODP-0 D ODP-0 E ODP-0 B ODP-0 D ODP HP-B ODP HP-D ODP HP-E ODP HP-B ODP HP-D ODP HP-B ODP HP-D ET-RP D NHP-0 E NHP-0 D NHP-0 B Page F000 F000 F000 F0009 F000 F00 F00 F000 F000 F000 F000 F000 F000 F000 F000 F000 F0 F0 F0 F0 F0 F0 F0 F0 F0 F00000 F0000 F0000 F0000 F0000 F0000 F0000 F0000 F0000 F000 F000 F00 F00 F00 F00 F000 NHP-0 D NHP-0 E NHP-0 B NHP-0 D NHP-0 E NHP-0 B NHP-0 D VG-0 E VG-0 D VG-0 D VT-0 D VN-0 D VN-0 D VC-0 D ES-0C C ES-0N C GS0A-E GS0A-D GF0A-E GF0A-D ODP0-D ODP0-B DE-E DE-B NN-D P- P- P-0 P-0 P-0 P-00 P-00 P-00 P-00 FL- FL- filter SL-0 SM-0 SH- M- GF-A ,, Index by

90 Shodex Support is available worldwide in many languages. Please check your local Shodex website. Showa Denko Europe GmbH Service area: Europe Africa Middle East Russia Languages available in: German and English URL Showa Denko America, Inc. Service area: North America Latin America Languages available in: English, French, Spanish and Portuguese URL Shoko Scientific Co, Ltd. Service area: Japan Language available in: Japanese URL Shodex China Co., Ltd. Service area: China Hong Kong Macau Language available in: Chinese URL Showa Denko K.K. Service area: Taiwan Languages available in: English and Japanese URL Shoko Korea Co., Ltd. Service area: Korea Language available in: Korean URL Showa Denko Singapore (Pte) Ltd. Service area: Southeast Asia India Oceania Language available in: English URL