Polymer-based Hydrophilic Interaction Chromatography (HILIC) Columns (HILICpak)

Transcription

1 Polymer-based ydrophilic Interaction Chromatography (ILIC) Columns (ILICpak) Features VG-0 VT-0 VC-0 V-0 Suitable for saccharides analysis using ILIC mode Recovers reducing saccharides with high ratio Polymer-based packing material provides excellent chemical stability and imum deterioration over extended time period Easily regenerated by washing in an alkaline solution Appropriate for evaporative light scattering detector, corona charged aerosol detector, and LC/MS Suitable for anionic substances analysis using ILIC mode Use of some eluents add ion exchange mode Polymer-based packing material provides excellent chemical stability and imum deterioration over extended time period Suitable for LC/MS analysis Modified carboxyl group is suitable for cationic substance analysis including aes The doant separation mode is RP or IEX rather than ILIC mode The modified diol groups on the packing material create the ILIC mode Suitable for oligosaccharide separation which is not possible by SEC column or conventional ILIC columns Standard columns VG-0 (ousing Material: SUS) Product ame Plate umber F7000 ILICpak VG-0 D,00. 0 /=0/80 F70 ILICpak VG-0 E 7,00. 0 /=0/80 F7 ILICpak VG-0G A. 0 /=0/80 Product ame Plate umber F7000 ILICpak VG-0 D, /=/8 F700 ILICpak VG-0G A.0 0 /=/8 VT-0 Product ame Plate umber F7000 ILICpak VT-0 D,00 Quaternary ammonium.0 0 mm C aq. /=/8 F700 ILICpak VT-0G A Quaternary ammonium.0 0 mm C aq. /=/8 VC-0 Product ame Plate umber F70700 ILICpak VC-0 D,00 Carboxyl.0 0 F700 ILICpak VC-0G A Carboxyl.0 0 V-0 Product ame Plate umber F7000 ILICpak V-0 D, /=/7 F7 ILICpak V-0G A.0 0 /=/7 F7000 ILICpak V-0 D 0, /=/7 F700 ILICpak V-0G A. 0 /=/7

2 Recovery of reducing sugar Silica-based ao column (company-a) (.mm I.D. x 0mm) Sample : mg/ml each, µl. Fructose. Mannose. Glucose. Sucrose VG-0 D (.mm I.D. x 0mm) Silica-based ao column (company-b) (.mm I.D. x 0mm) VG-0 D Silica-based Silica-based Column Column Column : Shodex ILICpak VG-0 D (company-a) (company-b) Silica based ao columns from other manufacturers Eluent : /=0/80 Flow rate : 0.mL/ (VG-0 D).0mL/ (Silica based ao column) Lactose, epilactose, and lactulose When an ao column is used for analyzing saccharides, the recovery ratio of reducing saccharides such as mannose, arabinose or xylose is low because the ao group forms Schiff base with reducing saccharides. ILICpak VG-0 is an ao column with improved reducing saccharides' recovery ratios. Improved recovery ratio results in enhancing the sensitivity of the analysis. Recovery of Mannose (%) Sample : mg/ml each, µl. Lactulose. Epilactose. Lactose Rare sugar R R R Column : Shodex ILICpak VG-0 E Eluent : //C =/8/0 Flow rate : 0.mL/ Column temp. : 0 C Melae and related substances Sample : 0.% each, 0µL. L-Ribose. D-Psicose. D-Xylitol. D-Tagatose. D-Allose. L-Glucose Sample : 0µL, µg/ml each (in /=0/0) o. R Melae Ammeline Cyanuric acid Ammelide R R Polymer-based ydrophilic Interaction Chromatography (ILIC) Columns (ILICpak) Column : Shodex ILICpak VG-0 E Eluent : //C =/7/0 Flow rate :.0mL/ Column : Shodex ILICpak VG-0 D Eluent : 0mM C aq./=/ Flow rate : 0.mL/ Detector : Corona charged aerosol Simultaneous analysis of saccharides, organic acids and ao acids with LC/MS Leu Ile Phe Met Val Pro Trp Ala Thr Gly Ser Lys + Gln Asn is Arg Tyr Glu Asp Cys m/z 0 ( ) ( ) 8 ( ) ( ) ( ) 0 ( ) 88 ( ) 8 ( ) 7 ( ) 0 ( ) ( ) ( ) ( ) 7 ( ) 80 ( ) ( ) ( ) 9 ( ) Pyruvic acid Lactic acid Glyceric acid Malic acid Tartaric acid Malonic acid xalic acid m/z 87 ( ) 89 ( ) 0 ( ) ( ) 9 ( ) 0 ( ) Maleic acid Citric acid meso-erythritol Arabinose + Xylose -Acetylglucosae ( ) 9 ( ) ( ) 9 ( ) 0 ( ) Fructose, Mannose, Glucose 79 ( ) Glucosae 78 ( ) Sucrose + Lactose Maltose Raffinose ( ) 0 ( ) Glucuronic acid Galacturonic acid 9 ( ) Sample : µg/ml each (in /=/), µl VG-0 D allows simultaneous analysis of saccharides, organic acids and ao acids with LC/MS detection under alkaline conditions. igh anionic substances elute under alkaline conditions. Furthermore, alkaline conditions promote the deprotonation of hydroxyl groups at the time of ionization. Therefore, alkaline conditions are suitable for high sensitive detection of substances with hydroxyl groups such as saccharides under the negative mode. Column : Shodex ILICpak VG-0 D Eluent : (A); 0.% aq./(b); Linear gradient (igh pressure); (B%) 80% (0 to ), 80% to 0% ( to ), 0% ( to ), 80% ( to 0) Flow rate : 0.mL/

3 LC/MS/MS analysis of organic sulfonic acids LC/MS analysis of pantothenic acid and vita C Sample : µl 0.0µM each (in /=/). Taurine. Taurocholic acid Sample : ng/ml each, 0µL. Vita B (Pantothenic acid) as Calcium pantothenate. Vita C (Ascorbic acid) > 80 ( ) 0 (+) 7 ( ) > ( ) Column : Shodex ILICpak VT-0 D Eluent : 0mM C aq./=0/80 Flow rate : 0.mL/ Column temp. : 0 C Column : Shodex ILICpak VT-0 D Eluent : 0mM C aq./=0/70 Flow rate : 0.mL/ Column temp. : 0 C LC/MS analysis of glyphosate and glufosinate LC/MS analysis of phosphorylated saccharides AMPA (methylphosphonic acid) Sample : µg/ml each, µl 0 ( ) Sample : µm each, µl. Glucose--phosphate (GP). Fructose--phosphate (FP). Glucose--phosphate (GP). Fructose--phosphate (FP) Glufosinate 8 (+) Glyphosate 8 ( ) MPPA (-Methylphosphinicopropionic acid) (+) 9 ( ) Column : Shodex ILICpak VT-0 D Eluent : /% C aq./=70/0/0 Flow rate : 0.mL/ Column : Shodex ILICpak VT-0 D Eluent : mm C aq./=80/0 Flow rate : 0.mL/ Column temp. : 0 C LC/MS analysis of aoglycoside antibiotics LC/MS/MS analysis of histae and histidine 97 ( ) S - Sample : glycoside antibiotics 0.µg/mL (in ), 0µL Sample : ng/ml each (in ), 0µL istae 8 (+) 8 (+) 78 (+) Kanamycin Tobramycin Gentamicin istidine (+) eomycin 8 8 (+) Amikacin 0 0 Column : Shodex ILICpak VC-0 D Eluent : (A);.% aq./(b); Linear gradient (igh pressure); (B%) 0% to 0% (0 to ), 0% ( to ) Flow rate : 0.mL/ > 0 (+) > 9 (+) 0 0 Column : Shodex ILICpak VC-0 D Eluent : 0mM C aq./=70/0 Flow rate : 0.mL/

4 LC/MS/MS analysis of monoae neurotransmitters 70 > 07 (+) 8 > (+) > 9 (+) 77 > 0 (+) > 9 (+) > (+) oradrenaline Adrenaline Dopae Serotonin istae > 0 (+) 08 > 7 (+) 8 > 9 (+) 0 > 7 (+). ( ) 89. ( ) 78. ( ) 7. ( ) 90.7 ( ) 0. ( ) Acarbose Miglitol Voglibose Metfor Column : Shodex ILICpak VC-0 D Eluent : (A); 00mM C aq./(b); Linear gradient (igh pressure) ; (B%) 0% (0 to ), 0% to 0% ( to ), 0% ( to 0) Flow rate : 0.mL/ LC/MS/MS analysis of ribavirin Sample : 0µL 0.µM each (in ) Sample : µl. Ribavirin 0.ng/mL (in /=/) LC/MS/MS analysis of oral anti-diabetes drugs Column : Shodex ILICpak VC-0 D Eluent : (A); 00mM C aq./(b); Linear gradient (igh pressure) ; (B%) 0% (0 to ), 0% to 0% ( to ), 0% ( to 0) Flow rate : 0.mL/ LC/MS analysis of oligo DA Sample : µl Synthesized oligo DA 0mer (ATACCGATTAAGCGAAGTTT; crude).mg/ml (in ) mer (TT) mer (TTT) mer (GTTT) mer (AGTTT) mer (AAGTTT) 7mer (GAAGTTT) Sample : µl ng/ml each (in ) Monitored ions -mer : [M-] - -mer : [M-] - -9mer : [M-] - 0mer : [M-] - Polymer-based ydrophilic Interaction Chromatography (ILIC) Columns (ILICpak) ( ) 8mer (CGAAGTTT) Column : Shodex ILICpak VC-0 D Eluent : 0mM C aq./=0/90 Flow rate : 0.mL/ 7. ( ).8 ( ) 88.0 ( ) 9mer (GCGAAGTTT) 0mer (AGCGAAGTTT) mer (AAGCGAAGTTT). ( ) mer (TAAGCGAAGTTT) ydrolyzed dextran 7.9 ( ) mer (TTAAGCGAAGTTT) Degree of polymerization (Dp) Sample : 0µL ydrolyzed dextran 0.% (in /=0/0). ( ).0 ( ) mer (ATTAAGCGAAGTTT) mer (GATTAAGCGAAGTTT) Dp 0 Enlarged view 8. ( ) 7.7 ( ) mer (CGATTAAGCGAAGTTT) 7mer (CCGATTAAGCGAAGTTT) 89.0 ( ) 8mer (ACCGATTAAGCGAAGTTT) ( ). ( ) 9mer (TACCGATTAAGCGAAGTTT) 0mer (ATACCGATTAAGCGAAGTTT) Column : Shodex ILICpak V-0 D Eluent : (A); /(B); Linear gradient ; (B)70% to 0% (0 to 0) Flow rate :.0mL/ Detector : Corona charged aerosol Column : Shodex ILICpak V-0 D Eluent : (A); 0mM C aq./(b); Linear gradient ; (B%) 0% (0 to 0), 0% to % (0 to ), 0% ( to 0) Flow rate : 0.mL/ 9

5 Polymer-based ydrophilic Interaction Chromatography (ILIC) Columns (Asahipak) Features P P-0 Suitable for saccharides analysis using ILIC mode Polymer-based packing material provides excellent chemical stability and imum deterioration over extended time period Easily regenerated by washing in an alkaline solution Appropriate for evaporative light scattering detector, corona charged aerosol detector, and LC/MS Fulfills USP L8 requirements Provides higher theoretical plate number than P-0 series Standard columns Product ame Plate umber Shipping Solvent F7000 Asahipak P-0 B,00. 0 F7000 Asahipak P-0 D,00. 0 F7000 Asahipak P-0 E 7,00. 0 F7 Asahipak P-0G A. 0 F7000 Asahipak P-0 D, F7000 Asahipak P-0G A.0 0 F70007 Asahipak P-0 E 8, F70 Asahipak P-0G A.0 0 F70008 Asahipak P-0 B, F70009 Asahipak P-0 D, F7000 Asahipak P-0 E 7, F70 Asahipak P-LF (line filter) mm I.D columns [Customized columns] Product ame F700 Asahipak P-0 B.0 0 F700 Asahipak P-0 D.0 0 Preparative columns *Preparative columns are made to order. Product ame Plate umber Standard Column F8000 Asahipak P-0 0E 0, P-0 F7 Asahipak P-0G A. 0 F800 Asahipak P-90 0F 0, P-0 F77 Asahipak P-0G 7B

6 Fructooligosaccharide syrup 0 Sample : Fructooligosaccharide syrup,.%, 0µL. Fructose. Glucose. Sucrose. -Kestose. ystose. -Fructofuranosyl-D-nystose 0 0 Column : Shodex Asahipak P-0 E Eluent : /=0/70 Flow rate :.0mL/ Column temp. : C Imidazole dipeptides Sample : 0µL. β-alanine 00µg/mL. -Methyl-L-histidine µg/ml. L-Anserine µg/ml. istidine µg/ml. L-Carnosine µg/ml. itrate (derived from L-Anserine itrate) Cyclodextrins Sample : 0µg/mL each, 0µL. α-cyclodextrin. γ-cyclodextrin. β-cyclodextrin Column : Shodex Asahipak P-0 E Eluent : /=0/0 Flow rate :.0mL/ Simultaneous analysis of water-soluble vitas Sample : 0µL. Vita B 0µg/mL. icotinamide 0µg/mL. Vita B 0µg/mL. icotinic acid 0µg/mL. Folic acid 0µg/mL. Vita C 0µg/mL Stevioside and rebaudioside A 0 0 Ascorbic acid and erythorbic acid =C C C C C C Sample : 0.0% each, 0µL. Stevioside. Rebaudioside A Column : Shodex Asahipak P-0 E Eluent : /=/7 Flow rate :.0mL/ Detector : UV (0nm) Column temp. : 0 C Sample : µg/ml each, 0µL. Erythorbic acid. L-Ascorbic acid =C C C C C C Polymer-based ydrophilic Interaction Chromatography (ILIC) Columns (Asahipak) Column : Shodex Asahipak P-0 E Eluent : 0mM a P aq./=0/0 Flow rate :.0mL/ Detector : UV (0nm) Column : Shodex Asahipak P-0 E Eluent : 0mM P aq./=/ Flow rate :.0mL/ Detector : UV (nm) Column : Shodex Asahipak P-0 E Eluent : 0mM a P + 0mM P aq. /=0/80 Flow rate :.0mL/ Detector : UV (nm) Column temp. : 0 C Comparison of saccharide analysis using corona charged aerosol detector LC/TF-MS analysis of -ao benzoic acid derivatized sugar chains A corona charged aerosol detector measures effluents as particles. Thus, the baseline is significantly affected by all components eluted from the column. The P series polymer-based ao column eliates insignificant amount of interfering components from the column. This results in providing stable and low noise baseline. Sample : µl uman IgG (µg protein) AA-labeled -Glycan * AA : -benzoic acid Silica-based amide column (.mm I.D. x 0mm) Silica-based ao column (.mm I.D. x 0mm) Sample : 0µg/mL each, µl. Fructose. Glucose 0 0 P-0 E (.mm I.D. x 0mm) Column : Shodex Asahipak P-0 E Silica based ao column from other manufacturer Silica based amide column from other manufacturer Eluent : /=0/80 Flow rate :.0mL/ Detector : Corona charged aerosol Column temp : 0 C (P-0 E, Silica based ao column) 80 C (Silica based amide column) 0 0 Migration time () Column : Shodex Asahipak P-0 D Eluent : (A); 9% /0.% Formic acid aq. (B); % /0.% Formic acid aq. Linear gradient; (B%) 0% (0-.), 0-9% (.-0) Flow rate : 0.mL/ Detector : ESI-TF MS (Polarity : egative, Full MS range : 000 ) Column temp. : C Data provided by Michihiro Kinoshita Ph.D., Faculty of Pharmacy, Kinki University