Modified CAROTENOID CLEAVAGE DIOXYGENASE8 expression correlates with altered branching in kiwifruit (Actinidia chinensis)

Transcription

1 Research Modified CAROTENOID CLEAVAGE DIOXYGENASE8 expression correlates with altered branching in kiwifruit (Actinidia chinensis) Susan E. Ledger, Bart J. Janssen, Sakuntala Karunairetnam, Tianchi Wang and Kimberley C. Snowden Zealand Institute for Plant & Food Research Limited, Auckland 1142, Zealand Summary Author for correspondence: Kimberley Snowden Tel: kimberley.snowden@plantandfood.co.nz Received: 17 May 21 Accepted: 14 June 21 (21) 188: doi: /j x Key words: Arabidopsis (Arabidopsis thaliana), branching, CAROTENOID CLEAVAGE DIOXYGENASE, kiwifruit (Actinidia chinensis), leaf senescence, perennial. CAROTENOID CLEAVAGE DIOXYGENASE (CCD) genes have been demonstrated to play an integral role in the control of branch development in model plants, including Arabidopsis, pea (Pisum sativum), petunia (Petunia hybrida) and rice (Oryza sativa). Actinidia chinensis is a woody perennial plant grown for commercial production of kiwifruit. CCD7 and CCD8 genes were isolated from A. chinensis and these genes are predominantly expressed in the roots of kiwifruit. AcCCD7 and AcCCD8 were able to complement the corresponding Arabidopsis mutants max3 and max4. The function of AcCCD8 in branch development was determined in transgenic kiwifruit plants containing an RNAi construct for AcCCD8. Reduction in expression of AcCCD8 correlated with an increase in branch development and delayed leaf senescence. The CCD pathway for control of branch development is conserved across a wide range of species, including kiwifruit, a woody perennial. Introduction Branching is an integral factor in determining the architecture and productivity of a plant. The huge range of growth forms observed in plants is largely dependent on developmental decisions made at two major checkpoints: firstly, the formation of axillary meristems in the leaf axils; and, secondly, the outgrowth of these meristems. Axillary meristem outgrowth is controlled by multiple interacting environmental and genetic signals. Although the phenomenon of apical dominance is one point of control for meristem outgrowth (Sachs & Thimann, 1964; Cline, 1994), investigations of mutant plants from annual species exhibiting altered branching phenotypes have also revealed the presence of a root-derived branching signal. These mutants include the decreased apical dominance (dad) mutants of petunia (Petunia hybrida) (Napoli, 1996; Napoli & Ruehle, 1996), the ramosus (rms) mutants of pea (Pisum sativum) (Beveridge, 2; Morris et al., 21; Rameau et al., 22), the more axillary growth (max) mutants of Arabidopsis (Arabidopsis thaliana) (Booker et al., 1999; Stirnberg et al., 22; Sorefan et al., 23) and the high-tillering dwarf (htd) and dwarf (d) mutants of rice (Oryza sativa) (Zou et al., 25; Arite et al., 27). Identification of the CAROTENOID CLEAVAGE DIOXYGENASE (CCD) genes CCD7 and CCD8 that are affected in a group of these branching mutants (Sorefan et al., 23; Booker et al., 24; Snowden et al., 25; Johnson et al., 26; Zou et al., 26; Arite et al., 27; Drummond et al., 29) has demonstrated that there are conserved pathways acting in diverse plants involving a carotenoid-derived signal. DAD1, MAX4, RMS1 and D1 are orthologous genes encoding CCD8, while DAD3, MAX3, RMS5 and D17 are orthologous genes encoding CCD7. The CCD family includes proteins in animals and plants that act on carotenoid substrates. The first plant member to be identified was Vp14 from maize, which encodes a 9-cis-epoxycarotenoid dioxygenase (NCED) (Schwartz et al., 1997). A number of other CCD genes have been shown to have carotenoid cleavage activity (Schwartz et al., 24; Auldridge et al., 26; Huang et al., 29). Studies in pea and rice have revealed the involvement of strigolactones in the branch signal (Gomez-Roldan et al., 28; Umehara et al., 28). These investigations have shown that branching mutants lacking CCD7 or CCD8 have reduced concentrations of strigolactone and applications of synthetic strigolactones can restore the wild-type Journal compilation Ó Trust (21) (21) 188:

2 84 Research branching phenotype to the mutant. Strigolactones are a group of terpenoid lactones initially characterized as a plantderived signal promoting germination of the parasitic plants Striga and Orobanche (Bouwmeester et al., 27) and have also been shown to be involved in symbiotic interaction with arbuscular mycorrhizal fungi (Akiyama et al., 25). Although annual plants have been the focus for investigating the control of branch development, perennial plants, such as kiwifruit and fruit trees, have the potential for many additional points of regulation. The architectural framework of a perennial plant is dependent on growth in the previous year, any pruning of that growth, and the organogenesis of the new season s meristems. Exogenous signals from the environment, including extremes in temperatures and day length, are integrated over months by the whole plant and influence the progress of axillary meristems through the stages of dormancy induction and release (Arora et al., 23). To determine the role of the CCD pathway in the control of branch development in the more complex system of a perennial plant, we investigated branch development in kiwifruit (Actinidia chinensis). Kiwifruit, a deciduous woody perennial, as grown in commercial orchards commonly consists of a single trunk with two horizontal branches (leaders) trained in opposite directions along a support. Shoots that have developed from the leaders are tied down in winter and the next season s shoots arise from axillary buds formed during the previous season (Snowball, 1997; Walton et al., 1997). The architecture of the kiwifruit plant is important for obtaining good yields of fruit and allowing adequate light for flower initiation in the following season (Sale & Lyford, 199). Currently this is managed through manual pruning. The development of shoots and the potential to produce flowers and fruit are influenced by low winter temperatures, which increase the proportion of buds that break dormancy (McPherson et al., 1994, 1995). In kiwifruit, both the shoot architecture and yield can also be influenced by the rootstock (Wang et al., 1994; Clearwater et al., 24, 26), suggesting that root-derived signals, such as strigolactones, may be important for controlling kiwifruit branching. In this paper we show that kiwifruit contain CCD7 and CCD8 genes that are predominantly expressed in the roots. Furthermore, we report that reducing the expression of AcCCD8 alters branch development and delays leaf senescence. Therefore, we conclude that the control of branch development observed in model annuals is conserved in a woody perennial plant. Materials and Methods Plant material Plant tissue used in the analysis of AcCCD7 and AcCCD8 expression in wild type plants was harvested from Actinidia chinensis Planch. var. chinensis plants grown in orchards in KeriKeri and Bay of Plenty, Zealand. Arabidopsis mutants max3-1 and max4-1 (a kind gift from O. Leyser) and wild-type Columbia were used in the complementation experiment. Arabidopsis plants were grown under glasshouse conditions with natural light supplemented when required to provide 16 h of light. Isolation of AcCCD7 and AcCCD8 Degenerate primers (Table 1) were designed based on published Arabidopsis, petunia and rice CCD7 and CCD8 sequences and used for the isolation of the initial portion of the CCD7 gene from A. chinensis genomic DNA and of the CCD8 gene from Actinidia deliciosa genomic DNA (kindly donated by R. Atkinson). PCR amplification used Platinum Taq (Invitrogen) and the following conditions: 94 C for 2 min, followed by 35 cycles of 94 C for 3 s, 58 C for 3 s, 72 C for 2 min, followed by 72 C for 5 min. All further genomic DNA and RNA used in this study was from A. chinensis. Additional genomic sequence was isolated using successive rounds of gene walking (BD GenomeWalker; BD Biosciences, Franklin Lakes, NJ, USA). The 3 -region of AcCCD7 was isolated by 3 -RACE (GeneRacer Kit; Invitrogen) using root mrna. Full-length cdna copies of CCD7 and CCD8 were then isolated from root mrna using PCR with primers shown in Table 1. Generation of transgenic A. chinensis plants To generate a construct to reduce the expression of AcCCD8, a 134 bp fragment from the genomic sequence of the AcCCD8 gene was cloned as an inverted repeat into the vector ptko2 (Snowden et al., 25) to produce Table 1 Primers used for amplification of kiwifruit (Actinidia chinensis) genes Purpose of primers Target gene Sequence 5 to 3 Degenerate primers for CCD7 ACNGTNCAYCCIYTIGAYGGNCAYGGNTA NGTRTTIGCIACRTTYTTCATNACYTT gene isolation CCD8 GGNMGNGGNATGGAYATGTG GGATCCAGCAACCATGCAAGCC cdna isolation CCD7 GTTCATTAAAGGCCAAAAATGC CTCGAGAATCTAGGAGGGTGCCCA CCD8 GCACTCGCTAGTACTAGTACCTCTC GTATAGAGTTCTAGTTCTTTGGGAYCCAG qrtpcr CCD7 CTATTGATGGGGTCAGTGGA CCATCTTGCCACCTTTCAAC CCD8 CTAATGTCGCGACGGAATTG CAACAAGTTCTCCCTCCCAC UBC TTGCTTTAATGGCACATCCA TCATTTCACCCCTTCTTTGG ACTIN CCAAGGCCAACAGAGAGAAG GACGGAGGATAGCATGAGGA (21) 188: Journal compilation Ó Trust (21)

3 Research 85 ptko2sacccd8. The construct was introduced into Agrobacterium tumefaciens and used to generate 11 independent RNAi transgenic A. chinensis plants (R1 11) following the procedure described in Wang et al. (27). Six control transgenic plants (C1 6) were generated using the control vector part27-1 (Yao et al., 1996), which contains a uida gene under the control of the 35S promoter from Cauliflower mosaic virus (CaMV). Plants were transferred into potting mix and cultivated in a glasshouse under natural daylight and temperature conditions for 15 months, incorporating an initial spring summer growth soon after transfer from tissue culture, a winter dormancy and a second spring summer growth. At the end of the first spring summer growth, the main shoots of plants were pruned to 1.7 m to allow for glasshouse management. Root tissue was collected from the transgenic plants at three time points after transfer of the plants to the glasshouse (4, 8 and 13 months) by carefully removing the plants from the pots and harvesting root tissue from several regions around the root mass before repotting the plants. Root tissue was quickly washed free of potting mix, frozen in liquid nitrogen and stored at )8 C. At the first time point, roots from only five of the six control plants were collected. Quantitative RT-PCR Total RNA was extracted using the procedure of Chang et al. (1993) modified with the addition of a 1 min polytron of the tissue with the extraction buffer, filtration of the aqueous phase through autoclaved miracloth following the first chloroform extraction and a final concentration of 2 M LiCl in the first precipitation. The extracted total RNA was treated with DNase (using Turbo DNA-free; Ambion) and the quality and concentration of RNA determined using an Agilent 2 Bioanalyser (Agilent Technologies, Palo Alto, CA, USA). cdna was synthesized with Superscript III Reverse Transcriptase (Invitrogen) using poly(dt) 23 V primer and 1 lg RNA. Quantitative RT-PCR was performed with the primer sets shown in Table 1 to detect the level of expression of AcCCD7 and AcCCD8 and the control genes UBIQUITIN CONJUGATING ENZYME E2 (UBC, accession number FG518635) and ACTIN (accession number FG44519; Walton et al., 29). At least three technical replicate RT- PCR reactions were performed per primer pair using an aliquot of cdna (1 5th), Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA) and 2 nm of each primer on an ABI Prism 79 HT machine (Applied Biosystems). Data were analysed with the SDS 2. software (Applied Biosystems), and relative expression was calculated using the comparative cycle threshold method (Pfaffl, 21) with normalization of data to the geometric average of the internal control genes (Vandesompele et al., 22). Chlorophyll analysis Leaf tissue for the chlorophyll analysis was collected from three leaves on the main stem of each of the 17 transgenic plants. To collect tissue of similar age and experiencing similar environmental conditions, leaf discs (1 cm diameter) were harvested from the blade of leaves at three sequential nodes starting 2 cm from the base of each plant. Leaf tissue was frozen in liquid nitrogen and stored at )8 C. Ground leaf discs were resuspended in 8% acetone (saturated with Na 2 CO 3 ) and incubated for 1 h in the dark. The solutions were centrifuged at 16 g for 1 min and the absorbance of the supernatant was determined at 663 and 646 nm. The total chlorophyll (C a+b ) content was calculated according to Lichtenthaler (1988) (C a+b =7.15A A 646 ) and the average C a+b was determined for each plant. Complementation of Arabidopsis mutants To generate constructs for the overexpression of AcCCD7 and AcCCD8, the full-length cdna clone of AcCCD7 was inserted into psak778s (Drummond et al., 29) and the full-length cdna clone of AcCCD8 was inserted into phex2 (Hellens et al., 25) both under the control of the CaMV 35S promoter. The overexpression constructs were transformed into A. tumefaciens strain LBA444 and used to transform the Arabidopsis mutants max3-1 (for AcCCD7)or max4-1 (for AcCCD8) using the floral dip method of Clough & Bent (1988). T 2 seeds were selected on kanamycin in tissue culture and then transferred to the glasshouse under long days. Control plants containing phex2, an empty CaMV 35S vector (Hellens et al., 25), were germinated on kanamycin, while the Col, max3 and max4 seeds were germinated without kanamycin but under the same tissue culture conditions. The number of rosette branches was recorded 1 wk after planting, when flowering was almost complete. Statistical analysis The principal components analysis (PCA) was fitted in R 2.9 using the FactoMiner 1.12 package, while the Mann Whitney U-test (P =.5), Spearman s correlations and nonhierarchical clustering were calculated in Genstat 1.1 (VSN International, Hemel Hempstead, UK). For the analysis of the transgenic Arabidopsis branch number, Tukey s multiple comparison ANOVAs (P =.5) were performed using Genstat 1.1. Results Isolation of kiwifruit CCD7 and CCD8 Searches of the available kiwifruit EST libraries (Crowhurst et al., 28) failed to identify sequences with homology to Journal compilation Ó Trust (21) (21) 188:

4 86 Research published CCD7 and CCD8 genes. Therefore the kiwifruit CCD7 and CCD8 genes were isolated using a combination of degenerate primer PCR and gene walking. A large portion (5.6 kb) of genomic sequence for the AcCCD7 gene was isolated, lacking the 3 -end of the proposed coding region, which was subsequently isolated from root RNA using 3 -RACE. For the AcCCD8 gene, 6.4 kb of genomic sequence was isolated, including 134 bp of sequence upstream of the start codon and 177 bp downstream of the stop codon. Full-length cdna clones for AcCCD7 (including an open reading frame of 1814 bp, accession number GU26813) and for AcCCD8 (including an open reading frame of 168 bp, accession number GU26812) were isolated from root RNA. The predicted AcCCD7 and AcCCD8 amino acid sequences were used in a phylogenetic analysis of the CCD family (Fig. 1). This included the full-length CCD7 and CCD8 sequences from other plant species identified using multiple BLAST searches (Altschul et al., 199), all of the Arabidopsis members of the NCED clade, and the first identified plant member of the CCD family from maize ZmVP14. The AcCCD7 gene falls into the clade that includes the Arabidopsis, pea, petunia and rice CCD7 genes identified through the max3, rms5, dad3 and htd1 branching mutants, as well as the predicted genes from Zea mays, Vitis vinifera and Medicago truncatula. Likewise, the AcCCD8 gene falls into the CCD8 clade with the Arabidopsis, pea, petunia and rice CCD8 genes identified through the max4, rms1, dad1 and d1 branching mutants as well as the predicted genes from Populus trichocarpa, M. truncatula, V. vinifera and the moss Physcomitrella patens. The kiwifruit CCD7 and CCD8 genes complement the Arabidopsis branching mutants To investigate the function of the kiwifruit CCD7 and CCD8 genes, we tested for the ability of AcCCD7 and AcCCD8 to complement the corresponding Arabidopsis branching mutants, max3 or max4. The kiwifruit genes were introduced into Arabidopsis mutants under the control of the CaMV 35S promoter. Three of the five Arabidopsis AcCCD7 overexpression lines and four of the Fig. 1 Unrooted phylogenetic tree of the CAROTENOID CLEAVAGE DIOXYGENASE (CCD) gene family. Only full-length members of the family are included. The predicted protein sequences were clustered using ClustalX (Thompson et al., 1997) and then further aligned manually with MacClade (Maddison & Maddison, 2). Phylogenetic relationships were calculated using the maximum-likelihood principle, and bootstrap values with replicates were determined using the Geneious software package (Guindon & Gascuel, 23; Drummond et al., 27). Scale bar is the number of substitutions per site. Accession numbers for the sequences used are as follows: Actinidia chinensis AcCCD7 (GU26813), AcCCD8 (GU26812); Arabidopsis AtCCD1 (At3g6352), AtCCD4 (At4g1917), AtCCD7 (At2g4499), AtCCD8 (At4g3281), AtNCED2 (At4g1835), AtNCED3 (At3g1444), AtNCED5 (At1g3), AtNCED6 (At3g2422), AtNCED9 (At1g7839); Chlamydomonas reinhardtii CrCCD (XP_ ); Medicago truncatula MtCCD7 (AC ), MtCCD8 (CR956392); Oryza sativa OsCCD7 (AL663.4), OsCCD8a (AP3296.3), OsCCD8b (AP3376.3); Petunia hybrida PhCCD7 (FJ79878), PhCCD8 (AY743219); Physcomitrella patens PpCCD8 (XP_ ); Pisum sativum PsCCD7 (ABD67496), PsCCD8 (AY ); Populus trichocarpa PtCCD8a (EEE9366.1), PtCCD8b (EEF3362.1); Vitis vinifera VvCCD7 (CAO7581.1), VvCCD8 (CAO4421.1); Zea mays ZmCCD7 (AC211432), ZmVP14 (U ). (21) 188: Journal compilation Ó Trust (21)

5 Research 87 six AcCCD8 overexpression lines showed reversion to the low branch number of wild-type plants and phex2 control plants (Fig. 2, Tukey s multiple comparison ANOVA, P =.5). In conclusion, the kiwifruit genes were able to functionally complement the corresponding Arabidopsis branching mutants. The AcCCD7 and AcCCD8 genes are predominantly expressed in roots To determine the tissues where AcCCD7 and AcCCD8 are expressed in wild-type A. chinensis plants qrt-pcr was performed on RNA isolated from a range of plant tissue: root, expanding leaf, stem segments from current season shoots, vegetative buds at bud break, flowers at anthesis, young fruit 13 d after anthesis (DAA), mature fruit pre-harvest (266 DAA) and seeds extracted from ripe fruit. The highest level of expression of both AcCCD7 and AcCCD8 was detected in the root tissue of A. chinensis plants (Fig. 3a), and AcCCD7 was expressed at a substantially lower (42-fold) level than AcCCD8 in the roots. A low level of expression (-fold lower) was also detected for both genes in young fruit and seeds from ripe fruit. Expression of AcCCD7 and AcCCD8 was not detected in the leaf, stem, vegetative bud, flowers or mature fruit. (a) 16 Number of branches (b) 16 Number of branches (c) Col Col phex2 phex2 max4 max S-AcCCD7 in max S-AcCCD8 in max4 (d) Identification of kiwifruit RNAi lines with altered phenotype To investigate the role of AcCCD8 in controlling branch development in kiwifruit, transgenic AcCCD8 RNAi lines were generated. Owing to the relatively slow growth rate of woody perennials compared with annual species, all of the 11 RNAi lines and six control lines were maintained and analysed over the 15 month growth period. During this growth period, the expression of AcCCD8 was determined at three time points, the chlorophyll content of leaves were determined and branch development over two growing seasons was recorded (Supporting Information, Fig. S1). A PCA on all 17 transgenic lines was used to investigate the relationship between the expression data, chlorophyll content and number of branches (Fig. 4). The PCA reduced the number of variables in the data set to two principal components; dimension 1 combines the negative correlation of two of the variables (branch number and chlorophyll content) with the expression level of AcCCD8 and accounts for 49% of the variation in the data, while dimension 2 indicates the variation in the expression data over the three time points and accounts for 25% of the variation (Fig. 4). The PCA plot also highlighted the variation between the different RNAi lines and suggested that some RNAi lines had not been altered in their AcCCD8 expression levels or phenotype, compared with the control plants. A nonhierarchical clustering analysis identified three RNAi lines (R5, phex2 max S-AcCCD7 in max3 R1 and R11) that were clustered with the control plants (Fig. 4). These three lines were excluded from subsequent analysis. Expression of AcCCD8 in transgenic A. chinensis roots The expression of AcCCD8 in the roots of the transgenic plants was determined at three time points after the plants phex2 max4 35S-AcCCD8 in max4 Fig. 2 Complementation of Arabidopsis branching mutants with AcCCD7 and AcCCD8. Number of rosette branches in five independent transgenic lines of 35S-AcCCD7 in max3 (a) and six independent transgenic lines of 35S-AcCCD8 in max4 (b) compared with wild-type plants (Col), plants containing a control vector (phex2) and max3 or max4. Values are mean ± SE, n = Representative plants from lines containing 35S-AcCCD7 in max3 (c) or 35S-AcCCD8 in max4 (d). Differences in the number of rosette branches are most obvious at the base of the plants. Journal compilation Ó Trust (21) (21) 188:

6 88 Research (a) Relative expression (b) Expression of AcCCD Root Leaf Stem Bud 4 8 Age of plants (months) Fig. 3 Expression of CAROTENOID CLEAVAGE DIOXYGENASE (CCD) genes in kiwifruit (Actinidia chinensis). (a) Expression of AcCCD7 and AcCCD8 in wild-type kiwifruit. Real-time qrt-pcr expression of AcCCD7 (grey bars) and AcCCD8 (black bars) in a range of tissues relative to AcCCD8 expression in root. Values are means of three technical replicates ± SE, normalized to internal control genes. Tissues without visible bars had expression levels below the threshold of detection. (b) Expression of AcCCD8 in roots of transgenic kiwifruit plants. Real-time qrt-pcr expression in RNAi (black bars) and control (grey bars) lines at three time points after transfer of plants to the glasshouse, relative to the expression in control line C3 at 13 months after transfer. Values are normalized to internal control genes and are means ± SE (n = 8 for RNAi and 5 6 for control). were transferred to the glasshouse and compared between the RNAi and control plants (Fig. 3b). Analysis of the expression data using the Mann Whitney U-test revealed that at 4 months after transfer there was no significant difference in the relative level of AcCCD8 expression between the control plants and the RNAi plants. However, there was a significant difference in AcCCD8 expression between the two populations of plants at the two later time points analysed, with the RNAi plants having a significantly reduced level of expression (8 months, P =.5, and 13 months, P =.8; Fig. 3b). The individual RNAi lines varied considerably in the level of AcCCD8 expression (Fig. S1a c). For example, at 13 months after transfer, no AcCCD8 Flower Young fruit Mature fruit 13 Seeds Dimension 2 (25%) e8 C2 C4 e4 e13 C1 R5 C3 C6 C5 R1 R Dimension 1 (49%) Chlor Branches 1 4 Fig. 4 Principal components analysis and nonhierarchical cluster analysis of AcCCD8 expression, number of branches and chlorophyll content in transgenic kiwifruit (Actinidia chinensis). Values for individual RNAi lines are shown as closed squares and labelled R1 R11. Values for control lines are shown as open squares and labelled C1 C6. Mean values are shown as a closed circle for RNAi lines and an open circle for control lines. Vectors (black arrows with grey text) indicate the AcCCD8 expression at three time points (4, 8 and 13 months) after transfer (e4, e8 and e13), the number of branches and the chlorophyll content (chlor). The length of a vector relative to the unit circle (dotted circle) indicates the level that the vector is represented in the two-dimensional graph. Vectors that are close to the unit circle are well represented and can be reliably interpreted. Vectors in opposite directions indicate a negative correlation, while acute angles between vectors signify positive correlations. Variance explained by dimension 1 = 49% and dimension 2 = 25%. Two clusters of the transgenic plants are shown by the shaded ovals and were determined by nonhierarchical cluster analysis. expression could be detected in line R8 and a very low level was detected for line R9 compared with RNAi line R6, which had levels of expression equivalent to the control lines (Fig. S1a c). Branch development in transgenic A. chinensis plants The total number of primary and higher-order branches that developed on the transgenic plants was recorded during the two spring summer seasons (Fig. 5). The RNAi plants produced significantly more branches than the control plants (Mann Whitney U-test, P =.5; Fig. 5a). The RNAi lines R8 and R9 developed the highest number of branches (59 and 66 branches), double that of control line C5 which had the highest branch number among the control plants (29 branches; Fig. S1d). As the main axis of the plants was pruned to a maximum of 1.7 m at the end of the first spring summer season, fixing the maximum number of nodes for primary branch development, the difference in R3 R1 R4 R7 R6 R2 R9 R8 (21) 188: Journal compilation Ó Trust (21)

7 Research 89 the branch number reflects the development of secondary and higher order branches as shown in Fig. 5(c) and (d). The total number of branches produced over 2 yr of growth was divided into three different length categories: short (< 5 cm), medium (between 5 and cm) and long (> cm) (Fig. 5b). The RNAi plants showed a large increase in the number of short branches compared with the control plants, while there was less of an increase in the number of medium and long branches (Fig. 5b). The length of 1 internodes on the main stem was measured on all transgenic plants (starting 2 cm above the base of the plant) and there was no significant difference in internode length between the RNAi and control groups of plants (data not shown). (a) Number of branches RNAi Control (b) 35 Leaf senescence in transgenic A. chinensis plants Kiwifruit are deciduous with leaves senescing each autumn. At the end of the first growth season, it was observed that the leaves on some of the RNAi plants were slower to senesce than the control plants (Fig. 6a,b). Chlorophyll degradation is an early indicator of leaf senescence, so to quantify our observation we analysed the amount of chlorophyll in leaf discs collected from the transgenic plants. The total chlorophyll (C a+b ) detected in the leaves from the group of RNAi plants was significantly higher than in the control plants (Mann Whitney U-test, P <.1; Fig. 6c). Two of the RNAi lines (R1 and R8) contained the highest amounts of chlorophyll (89 and 73 lg per disc, respectively), while the highest amount of chlorophyll detected in the control plants was 47 lg per disc in line C5 (Fig. S1e). To determine if there is a correlation between the AcCCD8 expression and the phenotype (total branch number and chlorophyll content) of the transgenic plants, a Spearman s rank correlation coefficient analysis was performed using data from the 14 transgenic kiwifruit plants (Table 2). The analysis confirmed a significant negative correlation between the total number of branches and the relative expression levels of AcCCD8 at each of the three time points after transfer to the glasshouse. A significant negative correlation was also shown between AcCCD8 expression levels at 8 and 13 months and the chlorophyll Number of branches (c) (d) # < 5 5 > Length of branches (cm) * * * RNAi Control Fig. 5 Branch development on transgenic kiwifruit (Actinidia chinensis). (a) Total number of branches formed on RNAi and control plants over 2 yr of growth. (b) Length of branches on transgenic kiwifruit. Branches formed on RNAi (black bars) or control (grey bars) transgenic plants over 2 yr of growth were divided into three different length categories: < 5 cm, between 5 and cm and > cm. Values are means ± SE; n = 8 for RNAi and n = 6 for control. (c) Branch of RNAi line R9 showing four secondary branches, including three branches < 5 cm in length (*) and one branch between 5 and cm in length (#). (d) Branch of control line C4 showing one secondary branch > cm (arrow) at node 1. No other secondary branches developed on this branch. Journal compilation Ó Trust (21) (21) 188:

8 81 Research (a) (c) 8 C a+b (µg per disc) Table 2 Spearman s rank correlation coefficient and P-values (in brackets) for AcCCD8 expression at three time points (4, 8 or 13 months after transfer of plants to the glasshouse) and phenotype (number of branches and chlorophyll content) of transgenic kiwifruit (Actinidia chinensis) plants content in the leaves, and the positive correlation between the chlorophyll content and the branch number in the kiwifruit plants was confirmed (Table 2). Therefore, the reduction of AcCCD8 expression resulted in an increase in branching and a delay in leaf senescence. The PCA plot and nonhierarchical clustering analysis (Fig. 4) highlight the RNAi lines that are most dramatically altered in their AcCCD8 expression level and phenotype (R8 and R9) and these lines will be propagated for further investigation. Discussion RNAi Branches Chlorophyll AcCCD8 expression 4 months ).521 (.17*) ).286 (.84) 8 months ).559 (.12*) ).621 (.6*) 13 months ).579 (.1*) ).571 (.11*) Chlorophyll.769 (.1*) *Significant at P <.5, n = 13. Control Fig. 6 Leaf senescence of transgenic kiwifruit (Actinidia chinensis). Example of leaf appearance at the end of the first growing season on RNAi plant R4 (a) and control plant C1 (b). Bar, 42 mm. (c) Total chlorophyll (C a+b ) in leaves of RNAi or control transgenic plants. Values are means ± SE; n = 8 for RNAi and n = 6 for control. Mutants in the CCD7 and CCD8 genes resulting in an increased branching phenotype have been identified in (b) petunia, Arabidopsis, pea and rice, indicating that there is a conserved pathway that controls branch development in both monocots and eudicots. Recently, the reduction of CCD7 expression in tomato has been shown to increase branching (Vogel et al., 21) and the tomato mutant Sl- ORT1, which is deficient in strigolactones, has been shown to have reduced CCD7 expression and increased branching (Koltai et al., 21). Genome sequencing from evolutionary diverse species such as the moss P. patens, M. truncatula,black cottonwood P. trichocarpa, and grape V. vinifera has revealed the presence of predicted CCD7 and CCD8 genes. However, proof of function of these genes in the control of branch development is yet to be determined in these species. We have isolated the CCD7 and CCD8 genes from A. chinensis, a deciduous woody perennial, and have demonstrated that a reduction in expression of AcCCD8 correlates with an increase in branch development. The AcCCD7 and AcCCD8 genes, under the control of the CaMV 35S promoter, were also sufficient to restore the branching of the corresponding Arabidopsis mutants to a wild-type phenotype. This provides functional evidence that the CCD pathway controlling branch development is conserved in a woody perennial even though kiwifruit exhibits quite a different plant form to previously studied species. The AcCCD8 gene has been mapped to the linkage group 3 using a microsatellite marker (Fraser et al., 29). In the future it would be worthwhile determining if architectural traits, such as branch number, branch length and bud burst, co-segregate with the marker for AcCCD8. The expression of the AcCCD7 and AcCCD8 genes predominantly in roots of A. chinensis is consistent with the patterns of expression observed in petunia (Snowden et al., 25; Drummond et al., 29) and Arabidopsis (Sorefan et al., 23; Booker et al., 24). The significantly lower level of expression detected for AcCCD7 than AcCCD8 in kiwifruit roots is also similar to that found for PhCCD7 in petunia (Drummond et al., 29). Reciprocal grafting experiments in petunia with the dad1 and dad3 mutants and wild-type plants have shown that both CCD7 and CCD8 are required in the roots for the generation of a signal controlling branching (Simons et al., 27). Therefore, the co-localization of expression of these genes in kiwifruit roots is reasonable. In rice and pea, the expression of CCD7 and CCD8 is required for the production of strigolactones (Gomez-Roldan et al., 28; Umehara et al., 28), which have been shown to be involved in the inhibition of branch development. In tomato plants with reduced CCD7 expression, there was also a reduction in the concentration of strigolactones detected in root exudates (Koltai et al., 21; Vogel et al., 21). The isolation and identification of strigolactones have been carried out in a wide range of plants and have revealed a diverse range and mixtures of known and unknown strigolactones (Yoneyama et al., 28). Strigolactones have been shown to be involved in a range of (21) 188: Journal compilation Ó Trust (21)

9 Research 811 activities, such as interaction with parasitic plants and arbuscular mycorrhizal fungi, nutrient acquisition and the control of branch development. However, it is yet to be determined if the different strigolactones isolated vary in their specificity (or efficacy) in these different activities. The expression of the AcCCD7 and AcCCD8 genes in the young fruit and seeds of wild-type A. chinensis suggests that these genes may have a role in fruit and seed development. The effect of reducing AcCCD8 expression on fruit development and flavour will be determined when the transgenic plants reach reproductive maturity. The reduction of AcCCD8 expression in transgenic A. chinensis plants is correlated with an increase in the total number of branches produced by the plants over two growing seasons. The increase in the total number of branches reflected the large increase in branches < 5 cm in length. Increasing the number of short branches could increase the number of flowers produced on kiwifruit vines by increasing the proportion of nodes with the potential to flower (normally nodes one to nine) (Snowball & Considine, 1986). It will be interesting to determine if there is an increase in the number of flowers and fruit produced on the AcCCD8 RNAi plants when they reach flowering maturity. Different Actinidia rootstocks, such as Actinidia hemsleyana, have been shown to increase the percentage bud burst and the number of flowers produced per shoot on the scion (Wang et al., 1994). Low-vigour rootstocks (Actinidia polygama and Actinidia kolomikta) have also increased the proportion of short shoots on the scion and increased the fruit load relative to total leaf area compared with the scions on high-vigour rootstocks (Clearwater et al., 24, 26). The mechanism of this effect is not clear, but a recent investigation in cherry has revealed differential expression of genes involved in brassinosteroid signalling, flavonoid metabolism and cell wall biosynthesis between the scions grafted to dwarfing or semivigorous rootstock (Prassinos et al., 29). The delayed leaf senescence observed in RNAi plants with reduced levels of CCD8 expression is similar to that seen in the dad1 (ccd8) mutant of petunia (Snowden et al., 25), showing a conserved link between CCD8 expression, branch development and leaf senescence in both perennial and annual species. Another Arabidopsis branching mutant max2 (Stirnberg et al., 22) was originally isolated as the ore9 mutant through a screen for delayed onset of agedependent leaf senescence (Oh et al., 1997) and was also shown to have delayed hormone-induced leaf senescence (Woo et al., 21). The ORE9 gene was shown to be a member of the F-box leucine-rich repeat gene family and involved in ubiquitin-dependent proteolysis (Woo et al., 21). A similar relationship between leaf senescence and branch development was observed in the rice tillering dwarf mutant d3, an orthologue of the Arabidopsis mutant max2 ore9 (Yan et al., 27). However, the pea orthologue rms4 does not display delayed leaf senescence (Johnson et al., 26), suggesting that the interaction between leaf senescence and branch development is not conserved in all plant species. An inherent difficulty in the study of the regulation of branching in woody perennial plants is the length of time required for plants to develop branches. Consequently the length of time for screening transgenic plants for altered phenotypes is also an extended process. The first time point (4 months after transfer) selected for screening the transgenic kiwifruit plants for the expression of CCD8 provided an indication that there had been a reduction in the expression in the RNAi lines compared with the control lines; however, it was not until the two later time points that a significant reduction could be shown. An understanding of the timing of expression of CCD8 over the growth of a perennial plant and the relationship between the timing of CCD8 expression and the visible growth of a branch would assist in selecting the best time for screening RNAi transgenic plants as well as providing further insights into the role of CCD8 in the control of branch development. We have demonstrated that the CCD pathway controlling branch development and leaf senescence observed in model plant systems is also conserved in a woody perennial plant. The effect of reducing root expression of AcCCD8 on fruit production is yet to be determined. However, the ability of low-vigour rootstocks (A. polygama and A. kolomikta) to increase the number of short branches on the scion, and consequently increase the fruit load (Clearwater et al., 24, 26), suggests that this aspect of plant development will be worth investigating further when the plants reach reproductive maturity. Acknowledgements We thank Marcela Martínez-Sánchez for assistance with Arabidopsis transformation, Mark Wohlers for assistance with statistics and Tim Holmes for photography of the kiwifruit leaves. We thank Revel Drummond and Marion Wood for critical reading and discussion of the manuscript. References Akiyama K, Matsuzaki K-I, Hayashi H. 25. Plant sesquiterpenes induce hyphal branching in arbuscular mycorrhizal fungi. Nature 435: Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ Basic local alignment search tool. Journal of Molecular Biology 215: Arite T, Iwata H, Ohshima K, Maekawa M, Nakajima M, Kojima M, Sakakibara H, Kyozuka J. 27. DWARF1, an RMS1 MAX4 DAD1 ortholog, controls lateral bud outgrowth in rice. Plant Journal 51: Arora R, Rowland LJ, Tanino K. 23. Induction and release of bud dormancy in woody perennials: a science comes of age. HortScience 38: Auldridge M, McCarty D, Klee H. 26. Plant carotenoid cleavage oxygenases and their apocarotenoid products. Current Opinion in Plant Biology 9: Journal compilation Ó Trust (21) (21) 188:

10 812 Research Beveridge CA. 2. Long-distance signalling and a mutational analysis of branching in pea. Plant Growth Regulation 32: Booker J, Auldridge M, Wills S, McCarty D, Klee H, Leyser O. 24. MAX3 CCD7 is a carotenoid cleavage dioxygenase required for the synthesis of a novel plant signaling molecule. Current Biology 14: Booker J, van de Sande K, Leyser HMO max3, anarabidopsis mutant with a modified pattern of aerial branching. Biologia Plantarum 42: S41. Bouwmeester HJ, Roux C, Lopez-Raez JA, Bécard G. 27. Rhizosphere communication of plants, parasitic plants and AM fungi. Trends in Plant Science 12: Chang S, Puryear J, Cairney J A simple and efficient method for isolating RNA from Pine trees. Plant Molecular Biology Reporter 11: Clearwater MJ, Lowe RG, Hofstee BJ, Barclay C, Mandemaker AJ, Blattmann P. 24. Hydraulic conductance and rootstock effects in grafted vines of kiwifruit. Journal of Experimental Botany 55: Clearwater MJ, Seleznyova AN, Thorp TG, Blattmann P, Barnett AM, Lowe RG, Austin PT. 26. Vigor-controlling rootstocks affect early shoot growth and leaf area development of kiwifruit. Tree Physiology 26: Cline M The role of hormones in apical dominance. approaches to an old problem in plant development. Physiologia Plantarum 9: Clough SJ, Bent AF Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal 16: Crowhurst R, Gleave A, MacRae E, Ampomah-Dwamena C, Atkinson R, Beuning L, Bulley S, Chagne D, Marsh K, Matich A et al. 28. Analysis of expressed sequence tags from Actinidia: applications of a cross species EST database for gene discovery in the areas of flavor, health, color and ripening. BMC Genomics 9: 351. Drummond A, Ashton B, Cheung M, Heled J, Kearse M, Moir R, Stones-Havas S, Thierer T, Wilson A. 27. Geneious v3.. URL [accessed on 14 July 21]. Drummond RSM, Martinez-Sanchez NM, Janssen BJ, Templeton KR, Simons JL, Quinn BD, Karunairetnam S, Snowden KC. 29. Petunia hybrida CAROTENOID CLEAVAGE DIOXYGENASE7 is involved in the production of negative and positive branching signals in petunia. Plant Physiology 151: Fraser L, Tsang G, Datson P, De Silva HN, Harvey C, Gill G, Crowhurst R, McNeilage M. 29. A gene-rich linkage map in the dioecious species Actinidia chinensis (kiwifruit) reveals putative X Y sexdetermining chromosomes. BMC Genomics 1: 12. Gomez-Roldan V, Fermas S, Brewer PB, Puech-Pages V, Dun EA, Pillot J-P, Letisse F, Matusova R, Danoun S, Portais J-C et al. 28. Strigolactone inhibition of shoot branching. Nature 455: Guindon S, Gascuel O. 23. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52: Hellens R, Allan A, Friel E, Bolitho K, Grafton K, Templeton M, Karunairetnam S, Gleave A, Laing W. 25. Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1: 13. Huang F-C, Molnar P, Schwab W. 29. Cloning and functional characterization of carotenoid cleavage dioxygenase 4 genes. Journal of Experimental Botany 6: Johnson X, Brcich T, Dun EA, Goussot M, Haurogné K, Beveridge CA, Rameau C. 26. Branching genes are conserved across species. Genes controlling a novel signal in pea are coregulated by other long-distance signals. Plant Physiology 142: Koltai H, LekKala SP, Bhattacharya C, Mayzlish-Gati E, Resnick N, Wininger S, Dor E, Yoneyama K, Yoneyama K, Hershenhorn J et al. 21. A tomato strigolactone-impaired mutant displays aberrant shoot morphology and plant interactions. Journal of Experimental Botany 61: Lichtenthaler HK Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods in Enzymology 148: Maddison DR, Maddison WP. 2. MacClade4: analysis of phylogeny and character evolution, version 4. Sunderland, MA, USA: Sinauer Associates. McPherson H, Hall AJ, Stanley CJ Seasonal and regional variation in budbreak and flowering of kiwifruit vines in Zealand. Zealand Journal of Crop and Horticultural Science 22: McPherson H, Stanley CJ, Warrington IJ The response of bud break and flowering to cool winter temperatures in kiwifruit (Actinidia deliciosa). Journal of Horticultural Science 7: Morris S, Turnbull C, Murfet I, Beveridge C. 21. Mutational analysis of branching in pea. Evidence that Rms1 and Rms5 regulate the same novel signal. Plant Physiology 126: Napoli C Highly branched phenotype of the petunia dad1-1 mutant is reversed by grafting. Plant Physiology 111: Napoli CA, Ruehle J mutations affecting meristem growth and potential in Petunia hybrida Vilm. Journal of Heredity 87: Oh SA, Park J-H, Lee GI, Paek KH, Park SK, Nam HG Identification of three genetic loci controlling leaf senescence in Arabidopsis thaliana. Plant Journal 12: Pfaffl MW. 21. A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Research 29: e45. Prassinos C, Ko J-H, Lang G, Iezzoni AF, Han K-H. 29. Rootstockinduced dwarfing in cherries is caused by differential cessation of terminal meristem growth and is triggered by rootstock-specific gene regulation. Tree Physiology 29: Rameau C, Murfet IC, Laucou V, Floyd RS, Morris SE, Beveridge CA. 22. Pea rms6 mutants exhibit increased basal branching. Physiologia Plantarum 115: Sachs T, Thimann KV Release of lateral buds from apical dominance. Nature 21: Sale PR, Lyford PB Cultural, management and harvesting practices for kiwifruit in Zealand. In: Warrington IJ, Weston GC, eds. Kiwifruit: science and management. Auckland, Zealand: Zealand Society for Horticultural Science, Schwartz SH, Qin X, Loewen MC. 24. The biochemical characterization of two carotenoid cleavage enzymes from Arabidopsis indicates that a carotenoid-derived compound inhibits lateral branching. The Journal of Biological Chemistry 279: Schwartz SH, Tan BC, Gage DA, Zeevaart JAD, McCarty DR Specific oxidative cleavage of carotenoids by VP14 of maize. Science 276: Simons JL, Napoli CA, Janssen BJ, Plummer KM, Snowden KC. 27. Analysis of the DECREASED APICAL DOMINANCE genes of petunia in the control of axillary branching. Plant Physiology 143: Snowball AM Seasonal cycle of shoot development in selected Actinidia species. Zealand Journal of Crop and Horticultural Science 25: Snowball A, Considine J Flowering in kiwifruit (Actinidia deliciosa Liang et Ferguson): positional effects and development. Acta Horticulturae 175: Snowden K, Simkin A, Janssen B, Templeton K, Loucas H, Simons J, Karunairetnam S, Gleave A, Clark D, Klee H. 25. The decreased apical dominance1 Petunia hybrida CAROTENOID CLEAVAGE DIOXYGENASE8 gene affects branch production and plays a role in leaf senescence, root growth, and flower development. Plant Cell 17: Sorefan K, Booker J, Haurogne K, Goussot M, Bainbridge K, Foo E, Chatfield S, Ward S, Beveridge C, Rameau C et al. 23. MAX4 and (21) 188: Journal compilation Ó Trust (21)

11 Research 813 RMS1 are orthologous dioxygenase-like genes that regulate shoot branching in Arabidopsis and pea. Genes and Development 17: Stirnberg P, van de Sande K, Leyser HMO. 22. MAX1 and MAX2 control shoot lateral branching in Arabidopsis. Development 129: Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu K, Yoneyama K et al. 28. Inhibition of shoot branching by new terpenoid plant hormones. Nature 455: Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. 22. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3: research Vogel JT, Walter MH, Giavalisco P, Lytovchenko A, Kohlen W, Charnikhova T, Simkin AJ, Goulet C, Strack D, Bouwmeester HJ et al. 21. SlCCD7 controls strigolactone biosynthesis, shoot branching and mycorrhiza-induced apocarotenoid formation in tomato. Plant Journal 61: Walton EF, Fowke PJ, Weis K, McLeay PL Shoot axillary bud morphogenesis in kiwifruit (Actinidia deliciosa). Annals of Botany 8: Walton EF, Wu R-M, Richardson AC, Davy M, Hellens RP, Thodey K, Janssen BJ, Gleave AP, Rae GM, Wood M et al. 29. A rapid transcriptional activation is induced by the dormancy-breaking chemical hydrogen cyanamide in kiwifruit (Actinidia deliciosa) buds. Journal of Experimental Botany 6: Wang T, Atkinson R, Janssen B. 27. The choice of Agrobacterium strain for transformation of Kiwifruit. Acta Horticulturae 753: Wang Z-Y, Patterson KJ, Gould KS, Lowe RG Rootstock effects on budburst and flowering in kiwifruit. Scientia Horticulturae 57: Woo HR, Chung KM, Park J-H, Oh SA, Ahn T, Hong SH, Jang SK, Nam HG. 21. ORE9, an F-Box protein that regulates leaf senescence in Arabidopsis. Plant Cell 13: Yan H, Saika H, Maekawa M, Takamure I, Tsutsumi N, Kyozuka J, Nakazono M. 27. Rice tillering dwarf mutant dwarf3 has increased leaf longevity during darkness-induced senescence or hydrogen peroxide-induced cell death. Genes & Genetic Systems 82: Yao J-L, Wu J-H, Gleave AP, Morris BAM Transformation of citrus embryogenic cells using particle bombardment and production of transgenic embryos. Plant Science 113: Yoneyama K, Xie X, Sekimoto H, Takeuchi Y, Ogasawara S, Akiyama K, Hayashi H, Yoneyama K. 28. Strigolactones, host recognition signals for root parasitic plants and arbuscular mycorrhizal fungi, from Fabaceae plants. 179: Zou J, Chen Z, Zhang S, Zhang W, Jiang G, Zhao X, Zhai W, Pan X, Zhu L. 25. Characterizations and fine mapping of a mutant gene for high tillering and dwarf in rice (Oryza sativa L.). Planta 222: Zou J, Zhang S, Zhang W, Li G, Chen Z, Zhai W, Zhao X, Pan X, Xie Q, Zhu L. 26. The rice HIGH-TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant Journal 48: Supporting Information Additional supporting information may be found in the online version of this article. Fig. S1 Expression and phenotype data for individual transgenic kiwifruit plants. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the Central Office. Journal compilation Ó Trust (21) (21) 188: