Cloning an iron-regulated metal transporter from rice
|
|
- Sibyl Tucker
- 6 years ago
- Views:
Transcription
1 Journal of Experimental Botany, Vol. 53, No. 374, pp. 1677±1682, July 2002 DOI: /jxb/erf004 Cloning an iron-regulated metal transporter from rice Naimatullah Bughio 1, Hirotaka Yamaguchi 1,3, Naoko K. Nishizawa 2,3, Hiromi Nakanishi 1 and Satoshi Mori 1,3,4 1 Laboratory of Plant Molecular Physiology, Department of Applied Biological Chemistry, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo, Japan 2 Laboratory of Plant Biotechnology, Department of Global Agricultural Sciences, The University of Tokyo, 1-1 Yayoi, Bunkyo-ku, Tokyo, Japan 3 Core Research for Evolutional Science and Technology, Japan Science and Technology Corporation, Honcho, Kawaguchi-shi, , Saitama, Japan Received 21 September 2001; Accepted 20 March 2002 Abstract Rice cdna and genomic libraries were screened in order to clone an Fe(II) transporter gene. A cdna clone highly homologous to the Arabidopsis Fe(II) transporter gene IRT1 was isolated from Fe-de cient rice roots. The cdna clone was named OsIRT1. A genomic clone corresponding to the cdna was also obtained, sequenced and analysed. When expressed in yeast cells, OsIRT1 cdna reversed the growth defects of the yeast iron-uptake mutant. Northern blot analysis revealed that OsIRT1 mrna was predominantly expressed in roots and was induced by Fe- and Cu-de ciency. This suggests that OsIRT1 is a functional metal transporter for iron, and is actively engaged in Fe uptake from soils, especially under limiting conditions. Key words: Copper, Fe(II) transporter, iron, IRT1, rice. Introduction Decades of research on plants have established that there are two distinct iron-uptake systems based on the response of plants to Fe-de ciency. These are known as Strategy I and Strategy II (RoÈmheld, 1987; RoÈmheld and Marschner, 1986). Strategy I plants include all dicots and nongraminaceous monocots. These plants respond to Fede ciency by decreasing rhizosphere ph and reducing sparingly soluble ferric iron. These mechanisms employ releasing protons and reductants, and morphological changes in the roots. The most important step of the mechanism is the reduction of ferric iron at the root surface by membrane-resident ferric chelate reductase (Chaney et al., 1972). In Arabidopsis, this reductase is encoded by FRO2 (Robinson et al., 1999). Reduced ferrous iron is absorbed into root cells by the Fe(II) transporter. IRT1 in Arabidopsis, a member of the ZIP metal transporter family, was the rst metal transporter involved in Fe(II) transport to be identi ed in higher plants (Eide et al., 1996). IRT1 was also the rst member of the ZRT, IRT-like protein (ZIP) family to be described (Guerinot, 2000). To date, IRT1-like Fe(II) transporters have been isolated from several dicotyledonous species (Eckhardt et al., 2001; Vert et al., 2001). Strategy II iron-uptake systems are limited to graminaceous monocots. These plants release mugineic acid-family phytosiderophores to the rhizosphere, where they solubilize sparingly soluble iron by chelation. The chelated complex is then absorbed into the roots. Genes for the synthesis of phytosiderophores have been isolated from barley (Higuchi et al., 1999; Kobayashi et al., 2001; Okumura et al., 1994; Takahashi et al., 1999). The rst step of phytosiderophore synthesis is also crucial in Strategy I plants (Ling et al., 1999), which is conversion of three molecules of S-adenosyl methionine to nicotianamine. Recently, a strong candidate for the transporter of the iron±phytosiderophore complex was cloned from maize (Curie et al., 2001). It is generally believed that plants depend on a single system (either Strategy I or II) for iron acquisition. In graminaceous plants, such as barley and maize, the inducible Fe-de ciency Fe(II) transport system is either absent or is expressed only at very low levels (Zaharieva 4 To whom correspondence should be addressed. Fax: asmori@mail.ecc.u-tokyo.ac.jp ã Society for Experimental Biology 2002
2 1678 Bughio et al. and RoÈmheld, 2001). It is possible that some plants have both uptake systems. Rice is a strategy II plant and releases phytosiderophores under Fe-de ciency. In fact, rice is the rst plant in which the root-secreted iron-solubilizing substance, the phytosiderophore, was observed (Takagi, 1976). Under submerged conditions, such as in a paddy eld where rice is normally grown, however, ferrous iron is more abundant than ferric iron. Up until now, quite limited information has been available as to the existence of an Fe(II) transport system for iron uptake in rice (Eide et al., 1996). This paper reports the isolation of cdna and a genomic clone for a functional Fe(II) transporter from rice. This is the rst report of the isolation of a functional Fe(II) transporter from a Strategy II plant. It is proposed that the Fe(II) transport system participates in iron uptake in rice in the reductive environment in which rice is normally grown. Materials and methods Plant material Two varieties of rice plants, Oryza sativa cv. Notohikari or Nihonbare, were used for cdna library construction or Northern analysis, respectively. Seeds were germinated and seedlings were hydroponically grown as previously described (Mori and Nishizawa, 1987). For micronutrient de ciency treatment, 3-week-old plants were transferred to nutrient solution without Cu, Fe, Mn, or Zn, and grown for three more weeks. cdna cloning The OsIRT1 cdna clone, identical to a rice expression sequence tag (EST) (accession no. D49213) homologous to IRT1, was isolated as follows. RNA was extracted from the roots of rice plants grown under Fe-de cient conditions for 2 weeks. A cdna library was constructed according to the SUPER SCRIPT Plasmid System for cdna Synthesis and Plasmid Cloning instruction manual (Gibco- BRL, USA). The OsIRT1 cdna clone was isolated using a PCRbased strategy. Approximately 10 5 independent colonies of Escherichia coli from the library were divided into 96 sublibraries. Ninety-six pools of plasmid were prepared, and each sublibrary was screened for the EST clone by PCR using speci c primers (5 -CGAGCTGCAGGATCCGAATTCTCGGCGGCTGCATCCTGC and 5 -GGGCAACGTCCGTCTTGAAC). Any sub-library in which a fragment was ampli ed was further analysed. Repeated subdivision and screening allowed an OsIRT1 cdna clone to be isolated. Cloning a genomic sequence A commercial genomic library of rice Oryza sativa L. cv. IR36 was used for screening (CLONTECH Inc., USA) by plaque hybridization. A DNA fragment used as a probe was ampli ed using the above primer set from a cdna pool prepared from RNA isolated from 3- month-old rice leaves. DNA and RNA procedures Plasmid puri cation, subcloning, electrophoresis, blotting, and hybridization were carried out according to standard protocols (Sambrook et al., 1989). For Northern analysis, total RNA was extracted from plant materials by the SDS-phenol method (Naito et al., 1988). Total RNA (20 mg) was electrophoresed and blotted onto nylon membranes. The membranes were hybridized with 32 P- labelled probes speci c for the cdna fragments for OsIRT1. Yeast strains and growth media The following strains of the yeast, Saccharomyces cerevisiae, were used in this study: CM3260 (parent strain) MATalpha trp1-63 leu2-3,112 gcn4-101 his3-609 ura3-52, YH001 MATalpha trp1-63 leu2-3,112 gcn4-101 his3-609 ura3-52 Dftr1::URA3, YH003 MATalpha trp1-63 leu2-3,112 gcn4-101 his3-609 ura3-52 Dftr1::URA3 Dfre1::HIS3 Dfet4::TRP1, M3 MATalpha trp1-63 leu2-3,112 gcn4-101 his3-609 ura3-52 FRE1-HIS3::URA3 ctr1-3, FTRUNB1 MATa ino1-13 leu2-3,112 gcn4-101 his3-609 ura3-52 Dctr1::URA3. Yeast disruption mutant strains, YH001 and YH003, were made by homologous recombination. Yeast cells were grown in 1% yeast extract, 2% peptone, and 2% glucose (YPD), 1% yeast extract, 2% peptone, and 2% glycerol (YPG), and synthetic de ned medium (SD) supplied with appropriate amino acids. Two per cent agar was added for solid plate media (Sherman, 1991). For iron- or copper-depleted media, bathophenanthroline disulphonic acid disodium salt (BPDS) or bathocuproine disulphonic acid disodium salt (BPCS) (Wako Pure Chemical Industries, Ltd., Japan) was added, respectively. Functional expression in yeast A yeast expression vector (pyh23) was constructed as follows. The plasmid YEplac181 (Gietz and Sugino, 1988) was cleaved with XbaI and EcoRI, blunt ended with T4 DNA polymerase, and re-ligated in order to remove most of the multiple cloning sites. The HindIII site was similarly deleted. The plasmid was digested with SphI and the 728 bp fragment from pvt100u (Vernet et al., 1987) containing the ADH1 expression cassette was inserted. To insert a NotI site in the multicloning site of the cassette, the plasmid was cleaved with BamHI and blunt ended with T4 DNA polymerase and the phosphorylated linker AGCGGCCGCT (TaKaRa Shuzo, Japan) was inserted. The new plasmid pyh23 has HindIII, PvuII, PstI, XhoI, SstI, XbaI, and NotI sites in the ADH1 expression cassette. For constitutive expression of OsIRT1 in yeast cells, OsIRT1 cdna was inserted into the XhoI±NotI site in pyh23 to form pyh23-osirt1. Yeast transformation was carried out using the Li-acetate transformation method (Gietz and Schiestl, 1995). Results Cloning the cdna and genomic sequences of OsIRT1 The database contains expression sequence tag (EST) from rice (accession no. D49213) that is highly homologous to the metal transporter IRT1 from Arabidopsis (Eide et al., 1996). Speci c PCR primers were designed based on the EST sequence in order to isolate a corresponding cdna clone. These primers were used to amplify a fragment (280 bp) clone from cdna prepared from leaves of rice with 91% identity to the EST. The PCR-based strategy successfully allowed the isolation of a cdna clone identical to the ampli ed fragment from a cdna library made from Fe-de cient rice roots. This cdna clone had high sequence similarity to IRT1. The cdna was designated as OsIRT1. A rice genomic library was also screened by hybridization using the 280 bp ampli ed fragment as a probe. After several rounds of screening, a clone containing the genomic sequence of OsIRT1 cdna was isolated.
3 Cloning rice Fe(II) transporter 1679 Fig. 2. Growth of the Dftr1 Dfet4 Dfre1 yeast mutants on irondepleted media containing 50 mm BPDS, transformed with vector only (left) or pyh23-osirt1 (right). Fig. 1. Alignment of the deduced OsIRT1 protein and ZIP proteins from higher plants. Residues conserved in all sequences are shaded in gray. Slashes indicate a gap. Transmembrane domains and a variable region are indicated. The histidine-rich metal-binding domain is underlined. An arrowhead indicates the corresponding position of an intron in OsIRT1 gene. The rst (699 bp) and second (679 bp) exons of OsIRT1 cdna are separated by an intron (4.3 kb). Sequence of OsIRT1 cdna and the deduced amino acid sequence of OsIRT1 protein The OsIRT1 cdna is 1395 bp long and contains an open reading frame of 374 amino acids (accession no. AB070226). OsIRT1 protein has a strong similarity to the metal transport protein IRT1 from Arabidopsis (53% amino acid identity, accession no. U27590). IRT1 and related metal transporters comprise the ZIP metal transporter family (Guerinot, 2000). Within the ZIP family, Rit1, an iron transport protein from pea, has the highest amino acid identity to OsIRT1 (55%, AF065444). LeIRT1 and LeIRT2 from tomato have a strong similarity as well (55% and 55%, AF2(6266 and AF2(6266, respectively) (Eckhardt et al., 2001). The amino acid alignment of these proteins is shown in Fig. 1. The hydrophobicity pro le reveals that OsIRT1 has eight transmembrane domains with a `variable region' between domains 3 and 4. These are typical features found in the ZIP metal transporter family (Guerinot, 2000). The variable region was less similar among these proteins. The region of OsIRT1 contains a potential metal-binding domain rich in histidine residues, which was also found in IRT1. OsIRT1 has only one intron, while IRT1 has two. However, the position of the rst intron of IRT1 is same as OsIRT1 (Fig. 1). OsIRT1 reversed growth defect of ferrous uptake mutants of yeast The yeast strain YH003 (Dftr1 Dfet4 Dfre1) has disrupted null mutations in the genes for high- and low-af nity iron transporters and ferric reductase (Dancis et al., 1992; Dix et al., 1994; Stearman et al., 1996). YH003 could not be grown on SD media containing 50 mm of BPDS, a strong chelator of the ferrous iron. Heterologous expression of OsIRT1, however, reversed the growth defect of the mutant on iron-depleted media (Fig. 2). The effect of OsIRT1 expression in copper uptake mutant ctr1 was also checked. Two strains, M3 (ctr1-3) and FTRUNB1 (Dctr1) (Dancis et al., 1994) were tested. However, no signi cant effect on the growth defect of these strains could be found on media containing non-fermentable carbon source (YPG) or SD media containing 50 mm or 100 mm BPCS, a strong chelator of the copper ion (data not shown). Expression of OsIRT1 under trace metal nutrient de ciency Induction of OsIRT1 expression in rice roots and leaves under trace metal-limiting conditions was examined by Northern hybridization (Fig. 3). Transcripts of OsIRT1 from plants grown under nutrient-suf cient conditions were very faint in roots, and not visible in shoots. In roots, Fe-de ciency signi cantly increased the level of OsIRT1 transcripts. Cu-de ciency also increased the transcript level. Under Mn- and Zn-de ciency, induction was not observed. In shoots, however, no increase in transcript level was found under any metal de ciency conditions.
4 1680 Bughio et al. Fig. 3. Transcript levels of the OsIRT1 gene in the roots and leaves of rice plants grown under trace metal de ciency conditions. Ten mg of total RNA were used. `C' indicates plants grown in normal nutrient solution. Discussion In this paper, the isolation of a cdna and genomic clone of OsIRT1, an IRT1-like metal transport protein from rice is reported. OsIRT1 has features typical of the ZIP metal transporter family, such as eight transmembrane domains and a variable region with a histidine-rich metal binding domain (Guerinot, 2000). So far, several members of this family have been isolated from dicotyledonous species (Eckhardt et al., 2001; Eide et al., 1996; Vert et al., 2001). OsIRT1 is the rst member of the ZIP metal transporter family to be isolated from a graminaceous plant. It was also shown that OsIRT1 cdna reversed the growth defect of the yeast iron-uptake mutant ftr1 fet4 fre1 on iron-depleted media when expressed in the yeast cells. This suggests that OsIRT1 encodes a functional iron transporter. OsIRT1 transcripts were predominantly expressed in the roots, and were induced by Fe-de ciency. The fact that expression of OsIRT1 is limited to the roots and is induced by Fe-de ciency indicates the direct involvement of OsIRT1 in uptake of iron from soil. It has been reported that IRT1 is a metal transporter with a broad substrate speci city (Eide et al., 1996; Korshunova et al., 1999; Rogers et al., 2000). In addition to ferrous iron, IRT1 can transport manganese, zinc, and probably cadmium and cobalt, when expressed in yeast cells. LeIRT1 and LeIRT2 from tomato can also complement yeast mutants defective in the uptake of iron, zinc, manganese, and copper (Eckhardt et al., 2001). Although IRT1 has a broad substrate speci city, the transcript level was not increased by any of these metal de ciency conditions other than iron (Eide et al., 1996; Korshunova et al., 1999). Therefore, it is interesting that expression of OsIRT1 was also induced by Cu-de ciency in addition to Fe-de ciency. It was reported that LeIRT1 and LeIRT2 from tomato could reverse the growth defects of the yeast high-af nity copper uptake mutant, ctr1 (Dancis et al., 1994), while IRT1 from Arabidopsis could not (Eckhardt et al., 2001). Although no effects of OsIRT1 expression on the growth defects of ctr1 could be found in these experiments, OsIRT1 may participate in copper uptake when it is Cu-limited. The effects of OsIRT1 expression on manganese or zinc uptake yeast mutants were not tested. Although OsIRT1 was not induced by these metal de ciency conditions, it may have a broad substrate speci city for these metals similar to IRT1, LeIRT1, and LeIRT2. To date, it has been generally accepted that graminaceous plants can utilize only ferric iron in the rhizosphere in a phytosiderophore-dependent manner (RoÈmheld, 1987; RoÈmheld and Marschner, 1986). Compared with dicotyledonous plants, Fe-de ciency inducible Fe(II) transport systems are absent or expressed at lower levels in the roots of barley and maize (Zaharieva and RoÈmheld, 2001). This report on the isolation of a root-speci c IRT1-like Fe(II) transporter clearly demonstrates that rice possesses an iron uptake system for Fe(II), in addition to a phytosiderophore-mediated Fe(III) transport system. This is a new mechanism of iron uptake that combines both Strategy I and Strategy II. Rice is grown under submerged conditions in which the dominant form of soil iron is ferrous iron (Yoshida, 1981). Therefore, it seems reasonable that rice may have an iron uptake system for Fe(II) as well as Fe(III) in its roots. Rice also transports oxygen from the shoots to the roots, and secretes oxygen from roots to oxidize the rhizosphere. Therefore, rice plants may induce one or the other of these iron transport systems by sensing the concentration of ferrous iron or the redox potential around their rhizoplane. Perhaps rice is unique among graminaceous plants in possessing a transport system for Fe(II). There is another class of metal transporters, the Nramp family, involved in Fe(II) transport in higher plants. Nramp genes are widely distributed in mammals, yeasts, and higher plants, and are known to be involved in a variety of processes, including metal transport and resistance to microbial infection (Cellier et al., 1996; Cohen et al., 2000; Gunshin et al., 1997). AtNramp1 and OsNramp1 can complement the fet3 fet4 yeast mutant defective both in low- and high-af nity iron transporters. The expression of AtNramp1, however, did not enhance iron uptake in yeast mutant cells. These proteins were speculated to be localized to intracellular compartments, such as chloroplasts, and to facilitate intracellular iron transport (Curie et al., 2000). In another paper, it was reported that AtNramp3 and AtNramp4 could complement the yeast metal uptake-de cient strain smf1, in addition to the fet3 fet4 mutant. The authors suggested the involvement of Arabidopsis Nramp proteins in the transport of iron, manganese, and cadmium, including Fe-de ciency inducible iron transport, especially AtNramp3 (Thomine et al., 2000). There are at least three isologues of Nramp proteins in rice (Belouchi et al., 1997). However, the function of these proteins remains unclear. Recently, yellow stripe 1 (YS1), a strong candidate for the gene for the transport
5 protein for the ferric phytosiderophore complex, was isolated from maize (Curie et al., 2001). Several other rice YS1 homologues were found in the database. Further study might elucidate the function of each of these three classes of metal transport proteins (IRT, Nramp, and YS1), and how the expression of these proteins is regulated developmentally and spatially. Analysis of these genes will allow an understanding of iron nutrition from the viewpoint not only of iron uptake from soils, but iron transport in planta, as well as organellar iron transport. Acknowledgements The authors thank Dr Andrew Dancis for the gift of the yeast strains used for the complementation analysis. We also thank Dr Kyoko Higuchi for her gift of a cdna library and help interpreting data. This work was supported by the Japan Science and Technology Corporation (JST). References Belouchi A, Kwan T, Gros P Cloning and characterization of the OsNramp family from Oryza sativa, a new family of membrane proteins possibly implicated in the transport of metal ions. Plant Molecular Biology 33, 1085±1092. Chaney RL, Brown JC, Tif n LO Obligatory reduction of ferric chelates in iron uptake by soybeans. Plant Physiology 50, 208±213. Cellier M, Belouchi A, Gros P Resistance to intracellular infections: comparative genomic analysis of Nramp. Trends in Genetics 12, 201±204. Cohen A, Nelson H, Nelson N The family of SMF metal ion transporters in yeast cells. Journal of Biological Chemistry 275, 33388± Curie C, Alonso JM, Jean MLE, Ecker JR, Briat JF Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochemical Journal 347, 749±755. Curie C, Panaviene Z, Loulergue C, Dellaporta SL, Briat JF, Walker EL Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature 409, 346± 349. Dancis A, Roman DG, Anderson GJ, Hinnebusch AG, Klausner RD Ferric reductase of Saccharomyces cerevisiaeð molecular characterization, role in iron uptake, and transcriptional control by iron. Proceedings of the National Academy of Sciences, USA 89, 3869±3873. Dancis A, Yuan DS, Haile D, Askwith C, Eide D, Moehle C, Kaplan J, Klausner RD Molecular characterization of a copper transport protein in S. cerevisiae: an unexpected role for copper in iron transport. Cell 76, 393±402. Dix DR, Bridgam JT, Broderius MA, Byersdorfer CA, Eide DJ The FET4 gene encodes the low-af nity Fe(II) transport protein of Saccharomyces cerevisiae. Journal of Biological Chemistry 269, 26092± Eckhardt U, Marques AM, Buckhout TJ Two ironregulated cation transporters from tomato complement metal uptake-de cient yeast mutants. Plant Molecular Biology 45, 437± 448. Eide D, Broderius M, Fett J, Guerinot ML A novel ironregulated metal transporter from plants identi ed by functional expression in yeast. Proceedings of the National Academy of Sciences, USA 93, 5624±5628. Cloning rice Fe(II) transporter 1681 Gietz RD, Schiestl RH Transforming yeast with DNA. Methods in Molecular and Cellular Biology 5, 255±269. Gietz RD, Sugino A New yeast and Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 72, 527±534. Guerinot ML The ZIP family of metal transporters. Biochimica et Biophysica Acta 1465, 190±198. Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, Hediger MA Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388, 482±488. Higuchi K, Suzuki K, Nakanishi H, Yamaguchi H, Nishizawa NK, Mori S Cloning of nicotianamine synthase genes, novel genes involved in the biosynthesis of phytosiderophores. Plant Physiology 119, 471±479. Kobayashi T, Nakanishi H, Takahashi M, Kawasaki S, Nishizawa NK, Mori S In vivo evidence that Ids3 from Hordeum vulgare encodes a dioxygenase that converts 2 Â - deoxymugineic acid to mugineic acid in transgenic rice. Planta 212, 864±871. Korshunova YO, Eide D, Clark WG, Guerinot ML, Pakrasi HB The IRT1 protein from Arabidopsis thaliana is a metal transporter with a broad substrate range. Plant Molecular Biology 40, 37±44. Ling HQ, Koch G, Baumlein H, Ganal MW Map-based cloning of chloronerva, a gene involved in iron uptake of higher plants encoding nicotianamine synthase. Proceedings of the National Academy of Sciences, USA 96, 7098±7103. Mori S, Nishizawa NK Methionine as a dominant precursor of phytosiderophores in Gramineae plants. Plant and Cell Physiology 28, 1081±1092. Naito S, Duke PH, Beachy RN Differential expression of conglycinin alpha and beta subunit genes in transgenic plants. Plant Molecular Biology 11, 109±124. Okumura N, Nishizawa NK, Umehara Y, Ohata T, Nakanishi H, Yamaguchi H, Chino M, Mori S A dioxygenase gene (Ids2) expressed under iron de ciency condition in the roots of Hordeum vulgare. Plant Molecular Biology 25, 705±719. Robinson NJ, Procter CM, Connolly EL, Guerinot ML A ferric-chelate reductase for iron uptake from soil. Nature 397, 694±697. Rogers EE, Eide DJ, Guerinot ML Altered selectivity in an Arabidopsis metal transporter. Proceedings of the National Academy of Sciences, USA 97, 12356±1260. RoÈmheld V Different strategies for iron acquistion in hgher plants. Physiologia Plantarum 70, 321±234. RoÈmheld V, Marschner H Evidence for a speci c system for iron phytosiderophores in roots of grasses. Plant Physiology 80, 175±180. Sambrook J, Fritsch E, Maniatis T Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory Press. Sherman F Getting started with yeast. Methods in Enzymology 194, 3±21. Stearman R, Yuan DS, Yamaguchi-Iwai Y, Klausner RD, Dancis A A permease-oxidase complex involved in highaf nity iron uptake in yeast. Science 271, 1552±1557. Takagi S Naturally occurring iron-chelating compounds in oat- and rice-root washing. I. Activity measurement and preliminary characterization. Soil Science and Plant Nutrition 22, 423±433. Takahashi M, Yamaguchi H, Nakanishi H, Nishizawa NK, Mori S Cloning two genes for nicotianamine aminotransferase, a critical enzyme in iron acquisition (Strategy II) in graminaceous plants. Plant Physiology 121, 947±956. Thomine S, Wang R, Ward JM, Crawford NM, Schroeder JI.
6 1682 Bughio et al Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proceedings of the National Academy of Sciences, USA 97, 4991± Vernet T, Dignard D, Thomas DV A family of yeast expression vectors containing the phage f1 intergenic region. Gene 52, 225±233. Vert G, Briat JF, Curie C Arabidopsis IRT2 gene encodes a root-periphery iron transporter. The Plant Journal 26, 181±189. Yoshida S Fundamentals of rice crop science. Laguna: International Rice Research Institute. Zaharieva T, RoÈmheld V Speci c Fe 2+ uptake system in Strategy I plants inducible under Fe de ciency. Journal of Plant Nutrition 23, 1733±1744.
Edited by Maarten J. Chrispeels, University of California, San Diego, CA, and approved August 17, 2000 (received for review May 12, 2000) Methods
Altered selectivity in an Arabidopsis metal er Elizabeth E. Rogers*, David J. Eide, and Mary Lou Guerinot* *Department of Biological Sciences, Dartmouth College, Hanover, NH 03755; and Nutritional Sciences
More information2. Yeast two-hybrid system
2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates
More informationModel plants and their Role in genetic manipulation. Mitesh Shrestha
Model plants and their Role in genetic manipulation Mitesh Shrestha Definition of Model Organism Specific species or organism Extensively studied in research laboratories Advance our understanding of Cellular
More informationHereditary Hemochromatosis
Hereditary Hemochromatosis The HFE gene Becky Reese What is hereditary hemochromatosis? Recessively inherited Iron overload disorder Inability to regulate iron absorption No cure http://www.consultant360.com/article/genetics-gastroenterology-what-you-need-know-part-1
More informationThe geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia
From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)
More informationIron. Presented to you by Karl, Carl, Rebecca and Rose.
Iron Presented to you by Karl, Carl, Rebecca and Rose. Iron is an essential micronutrient, meaning that it is used in small quantities by plants. It is one of the most abundant elements on Earth (which
More informationAnalysis of Escherichia coli amino acid transporters
Ph.D thesis Analysis of Escherichia coli amino acid transporters Presented by Attila Szvetnik Supervisor: Dr. Miklós Kálmán Biology Ph.D School University of Szeged Bay Zoltán Foundation for Applied Research
More informationCharacterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach
Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach ABSTRACT SUBMITTED TO JAMIA MILLIA ISLAMIA NEW DELHI IN PARTIAL FULFILMENT OF
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More informationMolecular aspects of Cu, Fe and Zn homeostasis in plants
Biochimica et Biophysica Acta 1763 (2006) 595 608 www.elsevier.com/locate/bbamcr Review Molecular aspects of Cu, Fe and Zn homeostasis in plants Natasha Grotz, Mary Lou Guerinot Dartmouth College, Biological
More informationEmitting Tracer Imaging System (PETIS): Evidence for the Direct Translocation of Fe from Roots to Young Leaves via Phloem
Special Issue Regular Paper 52 Fe Translocation in Barley as Monitored by a Positron- Emitting Tracer Imaging System (PETIS): Evidence for the Direct Translocation of Fe from Roots to Young Leaves via
More informationAND MOLECULAR CHARACT~RIZATION. By DEBORAH MARIE LONG,
NITRATE REDUCTA3E IN MAIZE ROOTS: LOCALIZATION AND MOLECULAR CHARACT~RIZATION By DEBORAH MARIE LONG, B.Sc. A Thesis Submitted to the School of Graduate Studies in Partial Fulfilment of the Requirements
More informationEST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
More informationIntroduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationTransition metal transporters in plants
Journal of Experimental Botany, Vol. 54, No. 393, pp. 2601±2613, December 2003 DOI: 10.1093/jxb/erg303 REVIEW ARTICLE Transition metal transporters in plants J. L. Hall* and Lorraine E. Williams School
More informationGenetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
More informationLipid transfer proteins confer resistance to trichothecenes
Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationCHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
More informationAgrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis
Agrobacterium tumefasciens, the Ti Plasmid, and Crown Gall Tumorigenesis BOM-11: 10.9 Plasmids: General Principles (review) p. 274 10.11 Conjugation: Essential Features (review) p. 278 19.21 Agrobacterium
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationArabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport
Ph.D. thesis Arabidopsis PPR40 connects abiotic stress responses to mitochondrial electron transport Zsigmond Laura Supervisor: Dr. Szabados László Arabidopsis Molecular Genetic Group Institute of Plant
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationDNA Technology, Bacteria, Virus and Meiosis Test REVIEW
Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by
More informationEukaryotic Gene Expression
Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes
More informationSmall RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
More informationLecture 12. Metalloproteins - II
Lecture 12 Metalloproteins - II Metalloenzymes Metalloproteins with one labile coordination site around the metal centre are known as metalloenzyme. As with all enzymes, the shape of the active site is
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More informationchapter 5 the mammalian cell entry 1 (mce1) operon of Mycobacterium Ieprae and Mycobacterium tuberculosis
chapter 5 the mammalian cell entry 1 (mce1) operon of Mycobacterium Ieprae and Mycobacterium tuberculosis chapter 5 Harald G. Wiker, Eric Spierings, Marc A. B. Kolkman, Tom H. M. Ottenhoff, and Morten
More informationArabidopsis thaliana. Lucia Strader. Assistant Professor, Biology
Arabidopsis thaliana Lucia Strader Assistant Professor, Biology Arabidopsis as a genetic model Easy to grow Small genome Short life cycle Self fertile Produces many progeny Easily transformed HIV E. coli
More informationCytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark
Cytokinin Abundant in young, dividing cells Shoot apical meristem Root apical meristem Synthesized in root tip, developing embryos, young leaves, fruits Transported passively via xylem into shoots from
More informationREVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
More informationAnalysis of iron transporters in the soybean (Glycine max (L.) Merr.) genome
Graduate Theses and Dissertations Iowa State University Capstones, Theses and Dissertations 2012 Analysis of iron transporters in the soybean (Glycine max (L.) Merr.) genome Dan Stribe Iowa State University
More informationImportance of Protein sorting. A clue from plastid development
Importance of Protein sorting Cell organization depend on sorting proteins to their right destination. Cell functions depend on sorting proteins to their right destination. Examples: A. Energy production
More informationIron-Induced Turnover of the Arabidopsis IRON-REGULATED TRANSPORTER1 Metal Transporter Requires Lysine Residues 1[W][OA]
Iron-Induced Turnover of the Arabidopsis IRON-REGULATED TRANSPORTER1 Metal Transporter Requires Lysine Residues 1[W][OA] Loubna Kerkeb 2, Indrani Mukherjee 3, Iera Chatterjee, Brett Lahner, David E. Salt,
More informationTHE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D.
THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING AnitaHajdu Thesis of the Ph.D. dissertation Supervisor: Dr. LászlóKozma-Bognár - senior research associate Doctoral
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationCellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More informationRegulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
More informationProtein-Protein Interactions of the Cytoplasmic Loops of the Yeast Multidrug Resistance Protein,PDR 5: A Two -Hybrid Based Analysis.
Researcher : Rao Subba G (2001) SUMMARY Guide :Gupta,C.M.(Dr.) Protein-Protein Interactions of the Cytoplasmic Loops of the Yeast Multidrug Resistance Protein,PDR 5: A Two -Hybrid Based Analysis. Mukidrug
More informationWERE FE(II) OXIDIZING PHOTOAUTOTROPHS INVOLVED IN THE DEPOSITION OF PRECAMBRIAN BANDED IRON
19 1. Introduction WERE FE(II) OXIDIZING PHOTOAUTOTROPHS INVOLVED IN THE DEPOSITION OF PRECAMBRIAN BANDED IRON FORMATIONS? Banded Iron Formations (BIFs) are ancient sedimentary rocks characterized by laminations
More informationFRD3, a Member of the Multidrug and Toxin Efflux Family, Controls Iron Deficiency Responses in Arabidopsis
The Plant Cell, Vol. 14, 1787 1799, August 2002, www.plantcell.org 2002 American Society of Plant Biologists FRD3, a Member of the Multidrug and Toxin Efflux Family, Controls Iron Deficiency Responses
More informationOptimization of Immunoblot Protocol for Use with a Yeast Strain Containing the CDC7 Gene Tagged with myc
OPTIMIZATION OF IMMUNOBLOT PROTOCOL 121 Optimization of Immunoblot Protocol for Use with a Yeast Strain Containing the CDC7 Gene Tagged with myc Jacqueline Bjornton and John Wheeler Faculty Sponsor: Anne
More information7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
More informationPlant transformation
Plant transformation Objectives: 1. What is plant transformation? 2. What is Agrobacterium? How and why does it transform plant cells? 3. How is Agrobacterium used as a tool in molecular genetics? References:
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationGene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
More informationThree types of RNA polymerase in eukaryotic nuclei
Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationEthylene involvement in the regulation of Fe-deficiency stress responses by Strategy I plants
CSIRO PUBLISHING www.publish.csiro.au/journals/fpb Functional Plant Biology, 2004, 31, 315 328 Review: Ethylene involvement in the regulation of Fe-deficiency stress responses by Strategy I plants Francisco
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationBIOCHEMISTRY. František Vácha. JKU, Linz.
BIOCHEMISTRY František Vácha http://www.prf.jcu.cz/~vacha/ JKU, Linz Recommended reading: D.L. Nelson, M.M. Cox Lehninger Principles of Biochemistry D.J. Voet, J.G. Voet, C.W. Pratt Principles of Biochemistry
More informationMidterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer.
Midterm Review Guide Name: Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. 4. Fill in the Organic Compounds chart : Elements Monomer
More informationBi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationNitrogen-Fixing Symbioses
Research for Tomorrow Pathway to Stable Products of Photosynthetic Energy Conversion. CHOH CHOH CH2OPO3" CH2OPO3 2 CHOH COOH CH2OPO3 COO Photosynthetic COo Fixation CH2OPO3 *^ Respiration j With Loss CHOH
More informationQuiz answers. Allele. BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA)
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 17: The Quiz (and back to Eukaryotic DNA) http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Quiz answers Kinase: An enzyme
More informationRegulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
More informationArabidopsis IRT2 cooperates with the high-aynity iron uptake system to maintain iron homeostasis in root epidermal cells
Planta (2009) 229:1171 1179 DOI 10.1007/s00425-009-0904-8 ORIGINAL ARTICLE Arabidopsis IRT2 cooperates with the high-aynity iron uptake system to maintain iron homeostasis in root epidermal cells Grégory
More informationSection Objectives: Section Objectives: Distinguish mixtures and solutions. Define acids and bases and relate their importance to biological systems.
Section Objectives: Relate the structure of an atom to the identity of elements. Relate the formation of covalent and ionic chemical bonds to the stability of atoms. Section Objectives: Distinguish mixtures
More informationREGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationTiffany Samaroo MB&B 452a December 8, Take Home Final. Topic 1
Tiffany Samaroo MB&B 452a December 8, 2003 Take Home Final Topic 1 Prior to 1970, protein and DNA sequence alignment was limited to visual comparison. This was a very tedious process; even proteins with
More informationPyridoxal kinase knockout of Dictyostelium complemented by the human homologue
FEMS Microbiology Letters 189 (2000) 195^200 www.fems-microbiology.org Pyridoxal kinase knockout of Dictyostelium complemented by the human homologue Kunde Guo, Peter C. Newell * Department of Biochemistry,
More informationIRT1, an Arabidopsis Transporter Essential for Iron Uptake from the Soil and for Plant Growth
The Plant Cell, Vol. 14, 1223 1233, June 2002, www.plantcell.org 2002 American Society of Plant Biologists IRT1, an Arabidopsis Transporter Essential for Iron Uptake from the Soil and for Plant Growth
More informationGACE Biology Assessment Test I (026) Curriculum Crosswalk
Subarea I. Cell Biology: Cell Structure and Function (50%) Objective 1: Understands the basic biochemistry and metabolism of living organisms A. Understands the chemical structures and properties of biologically
More informationTE content correlates positively with genome size
TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot
More informationThe bhlh Transcription Factor POPEYE Regulates Response to Iron Deficiency in Arabidopsis Roots W OA
The Plant Cell, Vol. 22: 2219 2236, July 2010, www.plantcell.org ã 2010 American Society of Plant Biologists The bhlh Transcription Factor POPEYE Regulates Response to Iron Deficiency in Arabidopsis Roots
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationMini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for
Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationBCH 400/600 Introductory Biochemistry
BCH 400/600 Introductory Biochemistry Instructor: David Shintani Office: 311C Fleischmann Ag. Lab: 308 Fleischmann Ag. E-mail: shintani@unr.edu Phone: (775) 784-4631 Before BCH 400 BCH 400 is heavy on
More informationThe geneticist s questions
The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does
More informationGene Control Mechanisms at Transcription and Translation Levels
Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationSaccharomyces cerevisiae Mutants Altered in Vacuole Function Are Defective in Copper Detoxification and Iron-Responsive Gene Transcription
Saccharomyces cerevisiae Mutants Altered in Vacuole Function Are Defective in Copper Detoxification and Iron-Responsive Gene Transcription MARK S. SZCZYPKA, ZHIWU ZHU, PHILIPPE SILAR AND DENNIS J. THIELE*
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationSlide 1 / Describe the setup of Stanley Miller s experiment and the results. What was the significance of his results?
Slide 1 / 57 1 Describe the setup of Stanley Miller s experiment and the results. What was the significance of his results? Slide 2 / 57 2 Explain how dehydration synthesis and hydrolysis are related.
More informationWhat Organelle Makes Proteins According To The Instructions Given By Dna
What Organelle Makes Proteins According To The Instructions Given By Dna This is because it contains the information needed to make proteins. assemble enzymes and other proteins according to the directions
More informationPROPERTIES OF THE MAMMALIAN AND YEAST METAL-ION TRANSPORTERS DCT1 AND Smf1p EXPRESSED IN XENOPUS LAEVIS OOCYTES
The Journal of Experimental Biology 24, 153 161 (21) Printed in Great Britain The Company of Biologists Limited 21 JEB3195 153 PROPERTIES OF THE MAMMALIAN AND YEAST METAL-ION TRANSPORTERS DCT1 AND Smf1p
More informationGenetically Engineering Yeast to Understand Molecular Modes of Speciation
Genetically Engineering Yeast to Understand Molecular Modes of Speciation Mark Umbarger Biophysics 242 May 6, 2004 Abstract: An understanding of the molecular mechanisms of speciation (reproductive isolation)
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationA pentose bisphosphate pathway for nucleoside degradation in Archaea. Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto , Japan.
SUPPLEMENTARY INFORMATION A pentose bisphosphate pathway for nucleoside degradation in Archaea Riku Aono 1,, Takaaki Sato 1,, Tadayuki Imanaka, and Haruyuki Atomi 1, * 7 8 9 10 11 1 Department of Synthetic
More informationUNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of
More informationTransport between cytosol and nucleus
of 60 3 Gated trans Lectures 9-15 MBLG 2071 The n GATED TRANSPORT transport between cytoplasm and nucleus (bidirectional) controlled by the nuclear pore complex active transport for macro molecules e.g.
More informationFerric Reductases and Transporters that Contribute to Mitochondrial Iron Homeostasis
University of South Carolina Scholar Commons Theses and Dissertations 12-15-2014 Ferric Reductases and Transporters that Contribute to Mitochondrial Iron Homeostasis Anshika Jain University of South Carolina
More informationAP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
More informationLecture 10: Cyclins, cyclin kinases and cell division
Chem*3560 Lecture 10: Cyclins, cyclin kinases and cell division The eukaryotic cell cycle Actively growing mammalian cells divide roughly every 24 hours, and follow a precise sequence of events know as
More informationNORTHERN ILLINOIS UNIVERSITY. Screening of Chemical Libraries in Search of Inhibitors of Aflatoxin Biosynthesis. A Thesis Submitted to the
NORTHERN ILLINOIS UNIVERSITY Screening of Chemical Libraries in Search of Inhibitors of Aflatoxin Biosynthesis A Thesis Submitted to the University Honors Program In Partial Fulfillment of the Requirements
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More information