SUPPLEMENTARY INFORMATION

Supplementary Figures

Supplementary Figures Supplementary Figure 1. Purification of yeast CKM. (a) Silver-stained SDS-PAGE analysis of CKM purified through a TAP-tag engineered into the Cdk8 C-terminus. (b) Kinase activity

Supplementary Figure S1

Slntary Figur S riginal iag vrlay of th slton of nuclar tin aggrgat on to of th original iag uclar sgntation branching of slton and filtring Whol cll sgntation Sltonization of candidat rgions () lctron

Supplemental Table 1: Strains used in this study

Supplemental Table : Strains used in this study Name Parent Genotype Reference GA-8 MATa, ade-; can-; his3-,5; trp-; ura3-; leu-3, W33-A GA-3 GA-8 his3-,5::gfp-laci-his3, NUP49::GFP-NUP49-URA3 [] GA-46

Glc7/Protein Phosphatase 1 Regulatory Subunits Can Oppose the Ipl1/Aurora Protein Kinase by Redistributing Glc7

MOLECULAR AND CELLULAR BIOLOGY, Apr. 2006, p. 2648 2660 Vol. 26, No. 7 0270-7306/06/$08.00 0 doi:10.1128/mcb.26.7.2648 2660.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved.

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work

SUPPLEMENTARY INFORMATION Table S1. List of strains Strains Genotype Source B. subtilis PY79 Prototrophic derivative of B. subtilis 168 (60) RL1070 spovid::kan (12) HS176 cotz phs2 (cotz-gfp spc) (22)

Supplementary information Supplementary figures

Supplementary information Supplementary figures Supplementary Figure 1. Quantitation by FCS of GFP-tagged proteasomes in supernatant of cell extract (a) In vitro assay for evaluation of the hydrodynamic

Waithe et al Supplementary Figures

Waithe et al Supplementary Figures Supplementary Figure 1 Expression and properties of WT and W391A mutant YFP- Ca V 2.2. A Immunoblot using Ca V 2.2 Ab for untransfected cells (UT, lane 1), YFP-Ca V 2.2

Table of plasmids and yeast strains and their relation to the laboratory database

209 Appendix Table of plasmids and yeast strains and their relation to the laboratory database All plasmids (maintained in bacteria) and yeast strains described in this thesis are listed in the following

A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces cerevisiae.

Genetics: Published Articles Ahead of Print, published on July 30, 2012 as 10.1534/genetics.112.143818 A redundant function for the N-terminal tail of Ndc80 in kinetochore-microtubule interaction in Saccharomyces

Heptad-Specific Phosphorylation of RNA Polymerase II CTD

olecular Cell Supplemental Information Heptad-Specific Phosphorylation of RNA Polymerase II CTD Roland Schüller, Ignasi Forné, Tobias Straub, Amelie Schreieck, Yves Texier, Nilay Shah, Tim-ichael Decker,

2. Yeast two-hybrid system

2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates

Flow Switch Diaphragm Type Flow Switch IFW5 10 N Diaphragm type flow switch. Thread type. Model Body size Set flow rate

Flo Sitch Diaphragm Typ Flo Sitch IFW5 Sris [Option] Th flo sitch, IFW sris is usd for dtction and confirmation of th flo as a rlaying dvic for th gnral atr applications in som various uipmnt such as cooling

SPBPB10D8.04c memb SPBPB10D8.05c memb SPBPB10D8.06c memb SPBPB10D8.07c memb

doi:.8/nature76 Table S : Summary of loci showing small RNA clusters and me in different genetic backgrounds Heterochromatin domains Subtelomeric regions Location Genomic Small RNAs Me Chr Start End features

Ptc1, a Type 2C Ser/Thr Phosphatase, Inactivates the HOG Pathway by Dephosphorylating the Mitogen-Activated Protein Kinase Hog1

MOLECULAR AND CELLULAR BIOLOGY, Jan. 2001, p. 51 60 Vol. 21, No. 1 0270-7306/01/$04.00 0 DOI: 10.1128/MCB.21.1.51 60.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Ptc1, a

Supplementary Materials for

advances.sciencemag.org/cgi/content/full/4/5/eaar2740/dc1 Supplementary Materials for The fission yeast Stn1-Ten1 complex limits telomerase activity via its SUMO-interacting motif and promotes telomeres

Unfired pressure vessels- Part 3: Design

Unfird prssur vssls- Part 3: Dsign Analysis prformd by: Analysis prformd by: Analysis vrsion: According to procdur: Calculation cas: Unfird prssur vssls EDMS Rfrnc: EF EN 13445-3 V1 Introduction: This

Give the letter that represents an atom (6) (b) Atoms of A and D combine to form a compound containing covalent bonds.

1 Th diagram shows th lctronic configurations of six diffrnt atoms. A B C D E F (a) You may us th Priodic Tabl on pag 2 to hlp you answr this qustion. Answr ach part by writing on of th lttrs A, B, C,

The geneticist s questions

The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does

Supporting Information

Supporting Information Mullins et al. 10.1073/pnas.0906781106 SI Text Detection of Calcium Binding by 45 Ca 2 Overlay. The 45 CaCl 2 (1 mci, 37 MBq) was obtained from NEN. The general method of 45 Ca 2

Ross E Curtis 1,2, Seyoung Kim 2, John L Woolford Jr 3, Wenjie Xu 3 and Eric P Xing 4*

Curtis et al. BMC Genomics 2013, 14:196 RESEARCH ARTICLE Open Access Structured association analysis leads to insight into Saccharomyces cerevisiae gene regulation by finding multiple contributing eqtl

Involvement of Specific COPI Subunits in Protein Sorting from the Late Endosome to the Vacuole in Yeast

MOLECULAR AND CELLULAR BIOLOGY, Jan. 2007, p. 526 540 Vol. 27, No. 2 0270-7306/07/$08.00 0 doi:10.1128/mcb.00577-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Involvement of

Optimization of Immunoblot Protocol for Use with a Yeast Strain Containing the CDC7 Gene Tagged with myc

OPTIMIZATION OF IMMUNOBLOT PROTOCOL 121 Optimization of Immunoblot Protocol for Use with a Yeast Strain Containing the CDC7 Gene Tagged with myc Jacqueline Bjornton and John Wheeler Faculty Sponsor: Anne

Supplemental Information. Expanded Coverage of the 26S Proteasome. Conformational Landscape Reveals. Mechanisms of Peptidase Gating

Cell Reports, Volume 24 Supplemental Information Expanded Coverage of the 26S Proteasome Conformational Landscape Reveals Mechanisms of Peptidase Gating Markus R. Eisele, Randi G. Reed, Till Rudack, Andreas

Rho1 binding site PtdIns(4,5)P2 binding site Both sites

localization Mutation site DMSO LatB WT F77A I115A I131A K134A Rho1 binding site PtdIns(4,5)P2 binding site Both sites E186A E199A N201A R84A-E186A-E199A L131A-K136A-E186A L131A-E186A-E199A K136A-E186A-E199A

GENETICS. Supporting Information

GENETICS Supporting Information http://www.genetics.org/cgi/content/full/genetics.110.117655/dc1 Trivalent Arsenic Inhibits the Functions of Chaperonin Complex XuewenPan,StefanieReissman,NickR.Douglas,ZhiweiHuang,DanielS.Yuan,

Functional Characterization of the N Terminus of Sir3p

MOLECULAR AND CELLULAR BIOLOGY, Oct. 1998, p. 6110 6120 Vol. 18, No. 10 0270-7306/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Functional Characterization of the

Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring

Current Biology Supplemental Information Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Caroline Laplante, Julien Berro, Erdem Karatekin,

Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures

Nature Methods Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures Yannick Doyon, Thuy D Vo, Matthew C Mendel, Shon G Greenberg, Jianbin Wang, Danny F Xia, Jeffrey

** LCA LCN PCA

% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number

JMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue

Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion

ME 321 Kinematics and Dynamics of Machines S. Lambert Winter 2002

3.4 Forc Analysis of Linkas An undrstandin of forc analysis of linkas is rquird to: Dtrmin th raction forcs on pins, tc. as a consqunc of a spcifid motion (don t undrstimat th sinificanc of dynamic or

Regulation of Cell Polarity through Phosphorylation of Bni4 by Pho85 G1 Cyclin-dependent Kinases in Saccharomyces cerevisiae

Molecular Biology of the Cell Vol. 20, 3239 3250, July 15, 2009 Regulation of Cell Polarity through Phosphorylation of Bni4 by Pho85 G1 Cyclin-dependent Kinases in Saccharomyces cerevisiae Jian Zou,* Helena

Role of tyrosine kinases and the tyrosine phosphatase SptP in the interaction of Salmonella with host cells

Cellular Microbiology (2001) 3(12), 795±810 Role of tyrosine kinases and the tyrosine phosphatase SptP in the interaction of Salmonella with host cells Sumati Murli, Robert O. Watson and Jorge E. GalaÂn*

the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)

Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic

TNFα 18hr. Control. CHX 18hr. TNFα+ CHX 18hr. TNFα: 18 18hr (KDa) PARP. Cleaved. Cleaved. Cleaved. Caspase3. Pellino3 shrna. Control shrna.

Survival ( %) a. TNFα 18hr b. Control sirna Pellino3 sirna TNFα: 18 18hr c. Control shrna Pellino3 shrna Caspase3 Actin Control d. Control shrna Pellino3 shrna *** 100 80 60 CHX 18hr 40 TNFα+ CHX 18hr

2. Laser physics - basics

. Lasr physics - basics Spontanous and stimulatd procsss Einstin A and B cofficints Rat quation analysis Gain saturation What is a lasr? LASER: Light Amplification by Stimulatd Emission of Radiation "light"

Developmental Role and Regulation of cortex, a Meiosis-Specific Anaphase-Promoting Complex/Cyclosome Activator

Developmental Role and Regulation of cortex, a Meiosis-Specific Anaphase-Promoting Complex/Cyclosome Activator Jillian A. Pesin 1,2, Terry L. Orr-Weaver 1,2* 1 Department of Biology, Massachusetts Institute

Arf1p Provides an Unexpected Link between COPI Vesicles and mrna in Saccharomyces cerevisiae D

Molecular Biology of the Cell Vol. 15, 5021 5037, November 2004 Arf1p Provides an Unexpected Link between COPI Vesicles and mrna in Saccharomyces cerevisiae D Mark Trautwein,* Jörn Dengjel, Markus Schirle,

Analysis and modelling of protein interaction networks

Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment Karin Stibius Jensen Analysis and modelling of protein interaction networks - A study of the two-hybrid experiment

Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing

Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent

Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition

Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut

Research Paper 497. Address: Departments of Physiology and Biochemistry & Biophysics, University of California, San Francisco, California 94143, USA.

Research Paper 497 The Polo-related kinase activates and is destroyed by the mitotic cyclin destruction machinery in S. cerevisiae Julia F. Charles, Sue. Jaspersen, Rachel. Tinker-Kulberg, ena Hwang, Alex

ACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC

SUPPLEMENTAL TABLE S1. Promoter and riboswitch sequences used in this study. Predicted transcriptional start sites are bolded and underlined. Riboswitch sequences were obtained from Topp et al., Appl Environ

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex

Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin

7.06 Cell Biology EXAM #3 KEY

7.06 Cell Biology EXAM #3 KEY May 2, 2006 This is an OPEN BOOK exam, and you are allowed access to books, a calculator, and notes BUT NOT computers or any other types of electronic devices. Please write

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental material Erlemann et al., http://www.jcb.org/cgi/content/full/jcb.201111123/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Test for functionality of yegfp-tagged -TuSC proteins

3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed

3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed replication Initiation of Replication http://www.orst.edu/instruction/bb492/figletters/figh3.gif

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.

Ypt31/32 GTPases and their novel F-Box effector protein Rcy1 regulate protein recycling

1 Ypt31/32 GTPases and their novel F-Box effector protein Rcy1 regulate protein recycling Shu Hui Chen 1, Shan Chen 1, Andrei A Tokarev, Fengli Liu, Gregory Jedd and Nava Segev 2 Department of Biological

Supplementary Materials for

www.sciencemag.org/cgi/content/full/336/6082/732/dc1 Supplementary Materials for Meiosis-Specific Noncoding RNA Mediates Robust Pairing of Homologous Chromosomes in Meiosis Da-Qiao Ding, Kasumi Okamasa,

Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis

Molecular Biology of the Cell Vol. 19, 4968 4979, November 2008 Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis Hsiao-Chi Lo,* Lihong Wan,* Adam

Direct Interactions between the Paf1 Complex and a Cleavage and Polyadenylation Factor Are Revealed by Dissociation of Paf1 from RNA Polymerase II

EUKARYOTIC CELL, July 2008, p. 1158 1167 Vol. 7, No. 7 1535-9778/08/$08.00 0 doi:10.1128/ec.00434-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Direct Interactions between

Role of Ptc2 Type 2C Ser/Thr Phosphatase in Yeast High-Osmolarity Glycerol Pathway Inactivation

EUKARYOTIC CELL, Dec. 2002, p. 1032 1040 Vol. 1, No. 6 1535-9778/02/$04.00 0 DOI: 10.1128/EC.1.6.1032 1040.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Role of Ptc2 Type

IDENTIFICATION OF YEAST DEUBIQUITINATING ENZYME (DUB) SUBSTRATES

MQP-BIO-DSA-2179 IDENTIFICATION OF YEAST DEUBIQUITINATING ENZYME (DUB) SUBSTRATES A Major Qualifying Project Report Submitted to the Faculty of the WORCESTER POLYTECHNIC INSTITUTE in partial fulfillment

DOI: 10.1038/ncb2819 Gαi3 / Actin / Acetylated Tubulin Gαi3 / Actin / Acetylated Tubulin a a Gαi3 a Actin Gαi3 WT Gαi3 WT Gαi3 WT b b Gαi3 b Actin Gαi3 KO Gαi3 KO Gαi3 KO # # Figure S1 Loss of protein

Heterozygous BMN lines

Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30

Nuclear congression is driven by cytoplasmic microtubule plus end interactions in S. cerevisiae

JCB: ARTICLE Nuclear congression is driven by cytoplasmic microtubule plus end interactions in S. cerevisiae Jeffrey N. Molk, E.D. Salmon, and Kerry Bloom Department of Biology, University of North Carolina,

Physics Chapter 3 Homework

hysics 106 - Chaptr Homwork 1. Which procss is usd in ractors for producing nutrons? am on nuclar raction for nutron production that can b usd in acclrators. (10 pts) 5U + n fission products + n 7Li(p,n),

FSC-W FSC-H CD4 CD62-L

Supplementary Fig. 1 a SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H CD4 CD62-L b SSC-A FSC-A FSC-W FSC-A FSC-A 7-AAD FSC-A CD4 IL-9 CD4 c SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H 7-AAD KI67 Annexin-V 7-AAD d I L -5

4.2 Design of Sections for Flexure

4. Dsign of Sctions for Flxur This sction covrs th following topics Prliminary Dsign Final Dsign for Typ 1 Mmbrs Spcial Cas Calculation of Momnt Dmand For simply supportd prstrssd bams, th maximum momnt

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?

Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was

Using graphs to relate expression data and protein-protein interaction data

Using graphs to relate expression data and protein-protein interaction data R. Gentleman and D. Scholtens October 31, 2017 Introduction In Ge et al. (2001) the authors consider an interesting question.

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,

SUPPLEMENTARY INFORMATION

DOI:.38/ncb97 P ( μm, hours) 1 2 4 P DMSO Figure S1 unningham et al. E 97 65 27 MFN1 GFP-Parkin Opa1 ctin GPDH HEK293 GFP-Parkin 19 115 97 65 27 Mitochondrial Fraction SH-SY5Y GFP-Parkin Mito DMSO Mito

7.06 Problem Set #4, Spring 2005

7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain

CELL CYCLE RESPONSE STRESS AVGPCC. YER179W DMC1 meiosis-specific protein unclear

ORFNAME LOCUS DESCRIPTION DATE HUBS: ESSENTIAL k AVGPCC STRESS RESPONSE CELL CYCLE PHEROMONE TREATMENT UNFOLDED PROTEIN RESPONSE YER179W DMC1 meiosis-specific protein 9-0.132-0.228-0.003-0.05 0.138 0.00

Ebs1p, a Negative Regulator of Gene Expression Controlled by the Upf Proteins in the Yeast Saccharomyces cerevisiae

EUKARYOTIC CELL, Feb. 2006, p. 301 312 Vol. 5, No. 2 1535-9778/06/$08.00 0 doi:10.1128/ec.5.2.301 312.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Ebs1p, a Negative Regulator

Spo5/Mug12, a Putative Meiosis-Specific RNA-Binding Protein, Is Essential for Meiotic Progression and Forms Mei2 Dot-Like Nuclear Foci

EUKARYOTIC CELL, Aug. 2006, p. 1301 1313 Vol. 5, No. 8 1535-9778/06/$08.00 0 doi:10.1128/ec.00099-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Spo5/Mug12, a Putative Meiosis-Specific

0 +1e Radionuclides - can spontaneously emit particles and radiation which can be expressed by a nuclear equation.

Radioactivity Radionuclids - can spontanously mit particls and radiation which can b xprssd by a nuclar quation. Spontanous Emission: Mass and charg ar consrvd. 4 2α -β Alpha mission Bta mission 238 92U

Molecules and Covalent Bond

Molculs and ovalnt ond Qustion Papr 1 Lvl IGSE Subjct hmistry (0620/0971) Exam oard ambridg Intrnational Examinations (IE) Topic toms, lmnts and compounds Sub-Topic Molculs and covalnt bonds ooklt Qustion

Eukaryotic Translation Initiation Factor 3 (eif3) and eif2 Can Promote mrna Binding to 40S Subunits Independently of eif4g in Yeast

MOLECULAR AND CELLULAR BIOLOGY, Feb. 2006, p. 1355 1372 Vol. 26, No. 4 0270-7306/06/$08.00 0 doi:10.1128/mcb.26.4.1355 1372.2006 Eukaryotic Translation Initiation Factor 3 (eif3) and eif2 Can Promote mrna

Phosphorylation of Bem2p and Bem3p may contribute to local activation of Cdc42p at bud emergence

The EMBO Journal (27) 26, 451 4513 & 27 European Molecular Biology Organization All Rights Reserved 261-4189/7 www.embojournal.org Phosphorylation of Bem2p and Bem3p may contribute to local activation

Sequential and Distinct Roles of the Cadherin Domain-containing Protein Axl2p in

Sequential and Distinct Roles of the Cadherin Domain-containing Protein Axl2p in Cell Polarization in Yeast Cell Cycle Xiang-Dong Gao *, Lauren M. Sperber *, Steven A. Kane *, Zongtian Tong *, Amy Hin

SUPPLEMENTARY INFORMATION

reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

During meiosis, two consecutive nuclear divisions

JCB: Article Cdc55 coordinates spindle assembly and chromosome disjunction during meiosis Farid Bizzari and Adele L. Marston Wellcome Trust Centre for Cell Biology, School of Biological Sciences, University

The Rsr1/Bud1 GTPase interacts with itself and the Cdc42 GTPase during bud-site selection and polarity establishment in budding yeast

The Rsr1/Bud1 GTPase interacts with itself and the Cdc42 GTPase during bud-site selection and polarity establishment in budding yeast Pil Jung Kang *, Laure Béven * =, Seethalakshmi Hariharan and Hay-Oak

SUPPLEMENTARY INFORMATION

doi:10.1038/natur09970 a b c Sm d d E3.5 Sm 5/PAX7 Supplmntary Figur 1 a, Schms dscribing how dorsal and transvrsal viws o somits shown throughout th manuscript wr acquird at th conocal microscop. a b,

MA 262, Spring 2018, Final exam Version 01 (Green)

MA 262, Spring 218, Final xam Vrsion 1 (Grn) INSTRUCTIONS 1. Switch off your phon upon ntring th xam room. 2. Do not opn th xam booklt until you ar instructd to do so. 3. Bfor you opn th booklt, fill in

Intramolecular interactions control Vms1 translocation to damaged mitochondria

MBoC ARTICLE Intramolecular interactions control Vms1 translocation to damaged mitochondria Jin-Mi Heo a, *, Jason R. Nielson a, Noah Dephoure b, Steven P. Gygi b, and Jared Rutter a a Department of Biochemistry,

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

Pipe flow friction, small vs. big pipes

Friction actor (t/0 t o pip) Friction small vs larg pips J. Chaurtt May 016 It is an intrsting act that riction is highr in small pips than largr pips or th sam vlocity o low and th sam lngth. Friction

Transcrip)on Regula)on And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P MaFhias & RG Clerc

Transcrip)on Regula)on And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P MaFhias & RG Clerc P. MaFhias, March 26th, 2014 Co- ac&vators / co- repressors Cell- specific / factor- specific

Introduction to the Ribosome Overview of protein synthesis on the ribosome Prof. Anders Liljas

Introduction to the Ribosome Molecular Biophysics Lund University 1 A B C D E F G H I J Genome Protein aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa10 aa9 aa8 aa11 aa12 aa13 a a 14 How is a polypeptide synthesized? 2

Post-termination ribosome interactions with the 5 UTR modulate yeast mrna stability

The EMBO Journal Vol.18 No.11 pp.3139 3152, 1999 Post-termination ribosome interactions with the 5 UTR modulate yeast mrna stability Cristina Vilela 1,2, Carmen Velasco Ramirez 1, Bodo Linz 1, Claudina

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,

Supplementary material

Supplementary material Phosphorylation of the mitochondrial autophagy receptor Nix enhances its interaction with LC3 proteins Vladimir V. Rogov 1,*, Hironori Suzuki 2,3,*, Mija Marinković 4, Verena Lang

26-Sep-16. Nuclear energy production. Nuclear energy production. Nuclear energy production. Nuclear energy production

Aim: valuat nrgy-gnration rat pr unit mass. Sun: (chck L /M, human ) nrgy-gnration rat producd from fusion of two nucli a + A: nrgy rlasd pr raction raction rat pr unit volum (includs cross sction and

Budding Yeast Greatwall and Endosulfines Control Activity and Spatial Regulation of PP2A Cdc55 for Timely Mitotic Progression

Budding Yeast Greatwall and Endosulfines Control Activity and Spatial Regulation of PP2A Cdc55 for Timely Mitotic Progression Maria Angeles Juanes 1., Rita Khoueiry 1., Thomas Kupka 2, Anna Castro 1, Ingrid

The activities of eukaryotic replication origins in chromatin

Biochimica et Biophysica Acta 1677 (2004) 142 157 Review The activities of eukaryotic replication origins in chromatin Michael Weinreich a, *, Madeleine A. Palacios DeBeer b, Catherine A. Fox b, * a Laboratory

Voltage, Current, Power, Series Resistance, Parallel Resistance, and Diodes

Lctur 1. oltag, Currnt, Powr, Sris sistanc, Paralll sistanc, and Diods Whn you start to dal with lctronics thr ar thr main concpts to start with: Nam Symbol Unit oltag volt Currnt ampr Powr W watt oltag

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation

Thermodynamic model of NF-kB-dependent promoter operation

Thrmodynamic modl of NF-kB-dpndnt promotr opration Introduction W dvlopd a modl of NF-kB -dpndnt transcriptional activation that combins a purposly simpl pictur of promotr opration with strong xprimntal

Philina S. Lee* and Alan D. Grossman* Department of Biology, Building , Massachusetts Institute of Technology, Cambridge, MA 02139, USA.

Blackwell Publishing LtdOxford, UKMMIMolecular Microbiology9-382X; Journal compilation 26 Blackwell Publishing Ltd? 266483869Original ArticleChromosome partitioning in B. subtilisp. S. Lee and A. D. Grossman

Deubiquitination Step in the Endocytic Pathway of Yeast Plasma Membrane Proteins: Crucial Role of Doa4p Ubiquitin Isopeptidase

MOLECULAR AND CELLULAR BIOLOGY, July 2001, p. 4482 4494 Vol. 21, No. 14 0270-7306/01/$04.00 0 DOI: 10.1128/MCB.21.14.4482 4494.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved.

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb2362 Figure S1 CYLD and CASPASE 8 genes are co-regulated. Analysis of gene expression across 79 tissues was carried out as described previously [Ref: PMID: 18636086]. Briefly, microarray

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.

Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty

Identification of Topological Network Modules in Perturbed Protein Interaction Networks. Supplementary Figure S1: Relative abundance of INO80 subunits

Supplementary Information For: Identification of Topological Network Modules in Perturbed Protein Interaction Networks Mihaela E. Sardiu 1#, Joshua M. Gilmore 1#, Brad Groppe 2, Laurence Florens 1, and

2SA2029 / 2SA1774EB / 2SA1774 / 2SA1576UB / 2SA1576A / 2SA1037AK. Outline. Base UMT3. Base. Package size (mm) Taping code

2S2029 / 2S1774B / 2S1774 / 2S1576UB / 2S1576 / 2S1037K PNP 50m -50V Gnral Purpos Transistors Datasht Outlin Paramtr V CO I C Valu 50V 150m VMT3 MT3F Collctor Bas Bas mittr mittr Collctor Faturs 1) Gnral

SUPPLEMENTARY INFORMATION

GP2 Type I-piliated bacteria FAE M cell M cell pocket idc T cell mdc Generation of antigenspecific T cells Induction of antigen-specific mucosal immune response Supplementary Figure 1 Schematic diagram

Lecture 10: Cyclins, cyclin kinases and cell division

Chem*3560 Lecture 10: Cyclins, cyclin kinases and cell division The eukaryotic cell cycle Actively growing mammalian cells divide roughly every 24 hours, and follow a precise sequence of events know as