Tex 25mer ssrna Binding Stoichiometry

Size: px
Start display at page:

Download "Tex 25mer ssrna Binding Stoichiometry"

Transcription

1 Figure S. Determination of Tex:2nt ssrna binding stoichiometry using fluorescence polarization. Fluorescein labeled RNA was held at a constant concentration 2-fold above the K d. Tex protein was titrated in at increasing concentration. An inflection point representing the molar ratio where the binding sites have become saturated occurs at equimolar concentrations of Tex and 2nt ssrna indicating a : binding stoichiometry. The assay was performed in mm Tris 7., mm NaCl, % glycerol and measured using a Tecan fluorimeter. 2 Tex 2mer ssrna Binding Stoichiometry 9 mp (arbitrary units) [Tex]/[RNA] (mm)

2 Figure S2. Tex does not appear to have nuclease activity. WT Tex was assayed in a time course experiment in parallel with RNase T, Micrococcal Nuclease, and the Tex YqgF domain active site mutant E33A/D42A. In the assay, the Tex proteins were at a molar concentration x that of Micrococcal Nuclease. Substrate used in this assay is a radio-labeled 3 nt single-stranded RNA and the assay was performed in mm Tris 7., mm NaCl, % glycerol, 3mM MgCl2, mm CaCl2 at 37 C. Reactions were quenched by the addition of an equal volume of phenol/chloroform ph 6.6 and 2mM EDTA. Samples were spun down and the aqueous phase extracted and mixed with 2x formamide loading dye. Samples were run on a 2% acrylamide (9:)/7M Urea denaturing gel in TBE buffer and the gel was scanned using a TYPHOON imaging system (GE Healthsciences). Time (min) No Protein RNase T Micrococcal Nuclease WT Tex E33A/D42A Tex

3 Figure S3. Predicted sites of sequence insertion for Spt6, with respect to the Tex structure. Front (A) and back (B) stereo views of the Tex structure. Highlighted regions (purple) indicate sites where additional sequence exists in Spt6 when aligned with Tex sequences. All highlighted regions lie on the surface of the Tex structure and appear to be able to accommodate additional sequence without disrupting the core structural scaffold. A B

4 Figure S4. Amino acid sequence alignment of Tex (P. aeruginosa) and Spt6 (S. cerevisiae). Observed Tex secondary structure is indicated above the Tex sequence. Highlighted regions indicate identical (red) and similar (yellow) residues. Sequence alignment was performed using ClustalW. Figure was created using ESPript Spt6-Full_Length-S._cerevisiae M D Y K D D D D K T R E E T G D S K L V P R D E E E I V N D N D E T K A P S E E E E G E D V F D S S E E D E D I D E D E D E A R K V Q E G F Spt6-Full_Length-S._cerevisiae 7 I V N D D D E N E D P G T S I S K K R R K H K R R E R E E D D R L S E D D L D L L M E N A G V E R T K A S S S S G K F K R L K R V G D E G N Spt6-Full_Length-S._cerevisiae 4 A A E S E S D N V A A S R Q D S T S K L E D F F S E D E E E E E S G L R N G R N N E Y G R D E E D H E N R N R T A D K G G I L D E L D D F I Spt6-Full_Length-S._cerevisiae 2 E D D E F S D E D D E T R Q R R I Q E K K L L R E Q S I K Q P T Q I T G L S S D K I D E M Y D I F G D G H D Y D W A L E I E N E E L E N G N H M D S I N T R I A E E L S A L P S Spt6-Full_Length-S._cerevisiae 28 D N N E A E E E E I D E E T G A I K S T K K K I S L Q D I Y D L E D L K K N L M T E G D M K I R K T D I P E R Y Q E L R A G I T D Y G N M S consensus> M.... T. I. E.... L H2 H3 H G R V Q P Q Q V A A A V A L L D E G S T V P F I A R Y R K E V T G S L Spt6-Full_Length-S._cerevisiae 3 S E D Q E L E R N W I A E K I S V D K N F D A N Y D L T. E F K E A I G N A I K F I T K E N L E V P F I Y A Y R R N Y I S S R E K D G F L L consensus> A E... V P F I.. Y R. #... S L H H6 H7 3 D D T Q L R M L E E R L R Y L R E L E E R R G A I L A S I E E Q G..... K L T P E L A R D I K L A D T K T R L E D L Y L P Y K Q K R.. Spt6-Full_Length-S._cerevisiae 42 T E D D L W D I V S L D I E F H S L V N K K D Y V Q R F Y A E L H I D D P I V T E Y F K N Q N T A S I A E L N S L Q D I Y D Y L E F K Y A N consensus>7. #. # L L. #....!..... E # L # D. Y..... K H8 H9 H R T K G Q I A L E A G L G A L A D A L F D D P. T L V P E S E A A R F V D A E K G F A D V K..... Spt6-Full_Length-S._cerevisiae 49 E I N E M F I N H T G K T G K K H L K N S S Y E K F K A S P L Y Q A V S D I G I S A E D V G E N I S S Q H Q I H P P V D H P S S K P V E V I consensus> # L #......! K H H2 β A V L E G A K Y I L M E R F A E D A T L L D K L R V F M K N E A T L T A R V V P.... G K E Q E G A Spt6-Full_Length-S._cerevisiae 6 E S I L N A N S G D L Q V F T S N T K L A I D T V Q K Y Y S L E L S K N T K I R E K V R S D F S K Y Y L A D V V L T A K G K K E I Q K G S L consensus> # #.... # K. R # β2 H3 β3. H4 28 K F S D Y F E H D E P L K S A P S H R A L A I F R G R N E G V L S A S L K V G. E E A P G T L H P. C E V M IA E R F G L S N Q G R A A D K Spt6-Full_Length-S._cerevisiae 63 Y E D I K Y A I N R T P M H F R R D P D V F L K M V E A E S L N L L S V K L H M S S. Q A Q Y I E H L F Q I AL E T T N T S D I A I E W N N consensus> %.. # E..... S. K E.... S #..... # H β4 276 W L A E V V R W T W K V K L Y T H L E T D L F G E L R D G A E D E A I S V F A R N L H D L L L A A P A G P R A T L G L Spt6-Full_Length-S._cerevisiae 699 F R K L A F N Q A M D K. I F Q D I S Q E V K D N L T K N C Q K L V A K T V R H K F M T K L D Q A P F I P N V R D P K I P K I L S L T C G Q consensus> %..... #... # L.... # L.. A P.. P T. G

5 β β6 H6 β7 33 D P G L R T G V K V A V V D A T G K L L D T A T V Y P H A P K N Q.... W D Q T L A V L A A L C A K H Q V E L I A I G N G T A Spt6-Full_Length-S._cerevisiae 768 G R F G A D A I I A V Y V N R K G D F I R D Y K I V D N P F... D K T N P E K F E D T L D N I I Q S C Q P N A I G I N G P N P K T Q K F Y consensus> !.... V #.. G ! #..... L Q. #. I. I H7 β8 H8 H9 H2 H2 39 S R E T D K L A G E L I K K Y P G M K L T K I M V S E A G A S V Y S A S E L A A K E F P E L D V S L R G A V S I A R R L Q D P L A E L V K I Spt6-Full_Length-S._cerevisiae 83 K R L Q E V L H K K Q I V D S R G H T I P I I Y V E D E V A I R Y Q N S E R A A Q E F P N K P P L V K Y C I A L A R Y M H S P L L E Y A N L consensus>7. R.. #. L.... I.... G..... I. V. #.. A.. Y.. S E. A A. E F P # !.. A R. $.. P L. E H22 H23 β9 H24 H2 46 E P... K S I G V G Q Y Q H D V S Q L K L A R S L D A V V E D C V N A V G V D V N T A S..... A A L L A R I S G L N S T L A Q N I V A Spt6-Full_Length-S._cerevisiae 9 T S E E V R S L S I H P H Q N L L S S E Q L S W A L E T A F V D I V N L V S V E V N K A T D N N Y Y A S A L K Y I S G F G K R K A I D F L Q consensus> S..!... Q... S... L... L #.... D. V N. V. V # V N. A A.. L.. I S G..... A. # H26 H27 β H28 H29 27 H R D A. N G A F R T R D E L K K V S R L G E K T F E Q A A G F L R V M N G D N P L D A S A V H P E T Y P L V Q R I AA Spt6-Full_Length-S._cerevisiae 97 S L Q R L N E P L L A R Q Q L I T H N I L H K T I F M N S A G F L Y I S W N E K R Q K Y E D L E H D Q L D S T R I H P E D Y H L A T K V AA consensus>7.. #.. N..... R # # L..... L.... F. #. A G F L.! #. L D...! H P E. Y. L...! A A H H3 H32 H33 86 D T E R D I R S L I G D.. S A F L K R L D P K K F T D E T F G L P T V T D I L K E L D K P Spt6-Full_Length-S._cerevisiae 4 D A L E Y D P D T I A E K E E Q G T M S E F I E L L R E D P D R R A K L E S L N L E S Y A E E L E K N T G L R K L N N L N T I V L E L L D G consensus>7 D A. L.. L #... %. # E L..... I.. E L H34 β β β3 H3 63 G R D P R P E F K T A E F Q E G V E S L K D L K P G M V L E G V V T N V T N F G..... A F V D I G V H Q D G L V H I S A L S E K F V K D Spt6-Full_Length-S._cerevisiae F E E L R N D F H P L Q G D E I F Q S L T G E S E K T F F K G S I I P V R V E R F W H N D I I C T T N S E V E C V V N A Q R H A G A Q L R R consensus>7.. #. R. # F... #. # E.. # S L G.!.. V #.. V H36. β4 β 69 P Y. E V V K A G D I V K V K V M E V D I P R N R V G L S M R M S D T P G E K V E G Q R G G R P T G S. G Q P R Q E R G A P R G Q S A P P A Spt6-Full_Length-S._cerevisiae 8 P A N E I Y E I G K T Y P A K V I Y I D Y A N I T A E V S L L D H D V K Q Q Y V P. I S Y S K D P S I W D L K Q E L E D A E E E R K L M M A consensus>7 P.. E!... G..... K V..! D S $... D... #. V #... A A N N A M A A L F A N A K Q L K K K Spt6-Full_Length-S._cerevisiae 24 E A R A K R T H R V I N H P Y Y F P F N G R Q A E D Y L R S K E R G E F V I R Q S S R G D D H L V I T W K L D K D L F Q H I D I Q E L E K E consensus>7 # Spt6-Full_Length-S._cerevisiae 324 N P L A L G K V L I V D N Q K Y N D L D Q I I V E Y L Q N K V R L L N E M T S S E K F K S G T K K D V V K F I E D Y S R V N P N K S V Y Y F Spt6-Full_Length-S._cerevisiae 394 S L N H D N P G W F Y L M F K I N A N S K L Y T W N V K L T N T G Y F L V N Y N Y P S V I Q L C N G F K T L L K S N S S K N R M N N Y R consensus> References. Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G., Gibson T.J. (994). CLUSTAL W: improving the sensitivity of progressivemultiple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, Gouet, P., Courcelle, E., Stuart, D. I. & Metoz, F. (999). ESPript: multiple sequence alignments in PostScript. Bioinformatics, 3-38.

According to the manufacture s direction (Pierce), RNA and DNA

According to the manufacture s direction (Pierce), RNA and DNA Supplementary method Electrophoretic Mobility-shift assay (EMSA) According to the manufacture s direction (Pierce), RNA and DNA oligonuleotides were firstly labeled by biotin. TAVb (1pM) was incubated

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.

More information

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1: The HpUreI crystal used for collection of native diffraction data. The crystal belongs to spacegroup P4 2 2 1 2 and has an approximate maximal dimension of 0.25 mm. Supplementary

More information

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin

More information

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu. Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta

More information

Data Sheet. Azide Cy5 RNA T7 Transcription Kit

Data Sheet. Azide Cy5 RNA T7 Transcription Kit Cat. No. Size 1. Description PP-501-Cy5 10 reactions à 40 µl For in vitro use only Quality guaranteed for 12 months Store all components at -20 C. Avoid freeze and thaw cycles. DBCO-Sulfo-Cy5 must be stored

More information

Functional Genomics Research Stream

Functional Genomics Research Stream Functional Genomics Research Stream http://fc09.deviantart.net/fs70/i/2010/214/2/f/dna_heart_by_micche.jpg http://www.ryersondesigns.com/skanndelus/dnaheart.jpg Research Meeting: February 14, 2012 Nucleic

More information

InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9

InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9 Lecture 5 Alignment I. Introduction. For sequence data, the process of generating an alignment establishes positional homologies; that is, alignment provides the identification of homologous phylogenetic

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.

More information

Phenol-Chloroform reagents. Selection guide. OH ; MW : High quality reagents for use in nucleic acid purification.

Phenol-Chloroform reagents. Selection guide. OH ; MW : High quality reagents for use in nucleic acid purification. Phenol-Chloroform reagents Extraction with phenol and phenol/chloroform mixtures is a universal method for purification of DNA and RNA. Proteins and restriction enzymes are removed by phenol and chloroform

More information

Marcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando, Susana M. Cerritelli, Robert J. Crouch, and Wei Yang

Marcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando, Susana M. Cerritelli, Robert J. Crouch, and Wei Yang Molecular Cell, Volume 28 Supplemental Data Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription Marcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando,

More information

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,

More information

SUPPLEMENTARY INFORMATION. Pistol Ribozyme Adopts a Pseudoknot Fold. Facilitating Site-specific In-line Cleavage

SUPPLEMENTARY INFORMATION. Pistol Ribozyme Adopts a Pseudoknot Fold. Facilitating Site-specific In-line Cleavage UPPLEMENTAY INFMATIN Pistol ibozyme Adopts a Pseudoknot Fold Facilitating ite-specific In-line Cleavage Aiming en 1,2,4, Nikola Vušurović 3,4, Jennifer Gebetsberger 3, Pu Gao 2, Michael Juen 3, Christoph

More information

Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase

Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase SUPPLEMENTARY INFORMATION Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase Louise C Briggs, Geoff S Baldwin, Non Miyata, Hisao Kondo, Xiaodong Zhang, Paul S

More information

Structural insights into energy regulation of light-harvesting complex from spinach CP29

Structural insights into energy regulation of light-harvesting complex from spinach CP29 SUPPLEMENTARY INFORMATION Structural insights into energy regulation of light-harvesting complex from spinach CP29 Xiaowei Pan 1, Mei Li 1, Tao Wan 1,2, Longfei Wang 1,2, Chenjun Jia 1,2, Zhiqiang Hou

More information

Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27

Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27 Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27 A40 non-canonical pair stacked over the A41 (G1-C26) three-base

More information

Supporting Information

Supporting Information Supporting Information Mullins et al. 10.1073/pnas.0906781106 SI Text Detection of Calcium Binding by 45 Ca 2 Overlay. The 45 CaCl 2 (1 mci, 37 MBq) was obtained from NEN. The general method of 45 Ca 2

More information

Supplemental Materials and Methods

Supplemental Materials and Methods Supplemental Materials and Methods Time-resolved FRET (trfret) to probe for changes in the Box A/A stem upon complex assembly U3 MINI was folded and the decay of Fl fluorescence was measured at 20 ºC (see

More information

Figure 2. Amino acid sequence alignment of L-carbamoylases. A BLAST search was conducted with BsLcar sequence, using the UNIREF100 sequence cluster

Figure 2. Amino acid sequence alignment of L-carbamoylases. A BLAST search was conducted with BsLcar sequence, using the UNIREF100 sequence cluster Figure 1. A) Simulated MIT MAP at 1.2 σ contours (blue), generated by shaking the coordinates using PDBSET from the CCP4 program suite [1], removing cacodylate molecule from the model, and refining 5 cycles

More information

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps

More information

Supporting Information for: Kinetic Mechanisms Governing Stable Ribonucleotide Incorporation in Individual DNA Polymerase Complexes

Supporting Information for: Kinetic Mechanisms Governing Stable Ribonucleotide Incorporation in Individual DNA Polymerase Complexes Supporting Information for: Kinetic Mechanisms Governing Stable Ribonucleotide Incorporation in Individual DNA Polymerase Complexes Joseph M. Dahl, Hongyun Wang, José M. Lázaro, Margarita Salas, and Kate

More information

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166), Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

More information

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7. hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:

More information

The structure of the deubiquitinase USP15 reveals a misaligned catalytic triad and an open ubiquitin-binding channel

The structure of the deubiquitinase USP15 reveals a misaligned catalytic triad and an open ubiquitin-binding channel SUPPORTING INFORMATION The structure of the deubiquitinase USP15 reveals a misaligned catalytic triad and an open ubiquitin-binding channel Stephanie J. Ward, Hayley E. Gratton, Peni Indrayudha #, Camille

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary

More information

Supporting Information

Supporting Information Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

More information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

More information

Sequence Analysis '17- lecture 8. Multiple sequence alignment

Sequence Analysis '17- lecture 8. Multiple sequence alignment Sequence Analysis '17- lecture 8 Multiple sequence alignment Ex5 explanation How many random database search scores have e-values 10? (Answer: 10!) Why? e-value of x = m*p(s x), where m is the database

More information

Simulative and experimental characterization of a ph-dependent

Simulative and experimental characterization of a ph-dependent Simulative and experimental characterization of a ph-dependent clamp-like DNA triple-helix nanoswitch Federico Iacovelli, # Andrea Idili, # Alessandro Benincasa, Davide Mariottini, Alessio Ottaviani, Mattia

More information

Supporting information for

Supporting information for Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of

More information

for Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet

for Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet SUPPLEMENTARY INFORMATION TO Structural basis for enzymatic excision of N -methyladenine and N 3 -methylcytosine from DNA Ingar Leiros,5, Marivi P. Nabong 2,3,5, Kristin Grøsvik 3, Jeanette Ringvoll 2,

More information

Protocol for 2D-E. Protein Extraction

Protocol for 2D-E. Protein Extraction Protocol for 2D-E Protein Extraction Reagent 1 inside the ReadyPrep TM Sequential Extraction kit (in powder form) 50ml of deionized water is used to dissolve all the Reagent 1. The solution is known as

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27 Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

More information

DSC Characterization of the Structure/Function Relationship for Proteins

DSC Characterization of the Structure/Function Relationship for Proteins DSC Characterization of the Structure/Function Relationship for Proteins Differential Scanning Calorimetry (DSC) DSC is recognized as Gold Std technique for measuring molecular thermal stability and structure

More information

SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state

SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry

More information

Department of Chemistry IIT Kharagpur. Biochemical Techniques Laboratory (CY49006)

Department of Chemistry IIT Kharagpur. Biochemical Techniques Laboratory (CY49006) Department of Chemistry IIT Kharagpur Biochemical Techniques Laboratory (CY49006) Name of the Experiments 1 Agarose Electrophoresis of Food Dyes 2 Protein Structure Analysis 3 Protein Denaturation Studies

More information

Supporting Text Z = 2Γ 2+ + Γ + Γ [1]

Supporting Text Z = 2Γ 2+ + Γ + Γ [1] Supporting Text RNA folding experiments are typically carried out in a solution containing a mixture of monovalent and divalent ions, usually MgCl 2 and NaCl or KCl. All three species of ions, Mg, M +

More information

Effects of Gap Open and Gap Extension Penalties

Effects of Gap Open and Gap Extension Penalties Brigham Young University BYU ScholarsArchive All Faculty Publications 200-10-01 Effects of Gap Open and Gap Extension Penalties Hyrum Carroll hyrumcarroll@gmail.com Mark J. Clement clement@cs.byu.edu See

More information

Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo

Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo Supporting Information Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo Heini Ijäs, Iiris Hakaste, Boxuan Shen, Mauri A. Kostiainen, and Veikko Linko* Biohybrid

More information

Malachite Green Phosphate Detection Kit Catalog Number: DY996

Malachite Green Phosphate Detection Kit Catalog Number: DY996 Malachite Green Phosphate Detection Kit Catalog Number: DY996 This Malachite Green Phosphate Detection Kit employs a simple, sensitive, reproducible, and non-radioactive method for measuring inorganic

More information

Supplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes

Supplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes Supplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes Joseph M. Dahl 1, Ai H. Mai 1, Gerald M. Cherf 1, Nahid N. Jetha 4, Daniel R. Garalde 3, Andre Marziali

More information

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted

More information

SDS-polyacrylamide gel electrophoresis

SDS-polyacrylamide gel electrophoresis SDS-polyacrylamide gel electrophoresis Protein Isolation and Purification Protein purification is a series of processes intended to isolate one or a few proteins from a complex mixture, usually cells,

More information

Exquisite Sequence Selectivity with Small Conditional RNAs

Exquisite Sequence Selectivity with Small Conditional RNAs Supplementary Information Exquisite Sequence Selectivity with Small Conditional RNAs Jonathan B. Sternberg and Niles A. Pierce,, Division of Biology & Biological Engineering, Division of Engineering &

More information

Genomics and bioinformatics summary. Finding genes -- computer searches

Genomics and bioinformatics summary. Finding genes -- computer searches Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

A profile-based protein sequence alignment algorithm for a domain clustering database

A profile-based protein sequence alignment algorithm for a domain clustering database A profile-based protein sequence alignment algorithm for a domain clustering database Lin Xu,2 Fa Zhang and Zhiyong Liu 3, Key Laboratory of Computer System and architecture, the Institute of Computing

More information

Basics on bioinforma-cs Lecture 7. Nunzio D Agostino

Basics on bioinforma-cs Lecture 7. Nunzio D Agostino Basics on bioinforma-cs Lecture 7 Nunzio D Agostino nunzio.dagostino@entecra.it; nunzio.dagostino@gmail.com Multiple alignments One sequence plays coy a pair of homologous sequence whisper many aligned

More information

An Efficient Algorithm for Protein-Protein Interaction Network Analysis to Discover Overlapping Functional Modules

An Efficient Algorithm for Protein-Protein Interaction Network Analysis to Discover Overlapping Functional Modules An Efficient Algorithm for Protein-Protein Interaction Network Analysis to Discover Overlapping Functional Modules Ying Liu 1 Department of Computer Science, Mathematics and Science, College of Professional

More information

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

Meet Our Uncle: 12 Stability Applications on One Platform

Meet Our Uncle: 12 Stability Applications on One Platform Tech Note Meet Our Uncle: 12 Stability Applications on One Platform Uncle is an all-in-one stability platform that enables twelve different applications with one instrument. Fluorescence, static light

More information

2 Dean C. Adams and Gavin J. P. Naylor the best three-dimensional ordination of the structure space is found through an eigen-decomposition (correspon

2 Dean C. Adams and Gavin J. P. Naylor the best three-dimensional ordination of the structure space is found through an eigen-decomposition (correspon A Comparison of Methods for Assessing the Structural Similarity of Proteins Dean C. Adams and Gavin J. P. Naylor? Dept. Zoology and Genetics, Iowa State University, Ames, IA 50011, U.S.A. 1 Introduction

More information

Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element

Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element as determined in a previous study 1. The log K value

More information

From Gen. Chem.: 1. WHAT is an ACID? 2. WHAT is a BASE?

From Gen. Chem.: 1. WHAT is an ACID? 2. WHAT is a BASE? Expt. 1: Biological Buffers Goals: 1. Learn how to use the Henderson-Hasselbach (H-H) eqn. 2. Learn how to prepare buffers. 3. Learn something about physical properties of biological buffers which are

More information

Supplementary Figure 2. Negative stain EM reconstructions. 4

Supplementary Figure 2. Negative stain EM reconstructions. 4 Supplementary Information for: EM Structure of human APC/C Cdh1 -EMI1 reveals multimodal mechanism E3 ligase shutdown Item Page Supplementary Figure 1. Analytical Ultracentrifugation of EMI1 DLZT. 2 Supplementary

More information

Controlling the Catalytic Functions of DNAzymes within Constitutional. Dynamic Networks of DNA Nanostructures

Controlling the Catalytic Functions of DNAzymes within Constitutional. Dynamic Networks of DNA Nanostructures Supporting Information Controlling the Catalytic Functions of DNAzymes within Constitutional Dynamic Networks of DNA Nanostructures Shan Wang,, Liang Yue,, Zohar Shpilt, Alessandro Cecconello, Jason S.

More information

Programmed ph-driven Reversible Association and Dissociation of Inter-Connected. Circular DNA Dimer Nanostructures

Programmed ph-driven Reversible Association and Dissociation of Inter-Connected. Circular DNA Dimer Nanostructures Supporting information Programmed ph-driven Reversible Association and Dissociation of Inter-Connected Circular DNA Dimer Nanostructures Yuwei Hu, Jiangtao Ren, Chun-Hua Lu, and Itamar Willner* Institute

More information

A New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers

A New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers Electronic Supplementary Information A New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers Abulfazl Fakhari M. and Steven E. Rokita Contribution from the Department

More information

Qubit RNA IQ Assay Kits

Qubit RNA IQ Assay Kits USER GUIDE Qubit RNA IQ s Catalog No. Q33221, Q33222 Pub. No. MAN0017405 Rev. B.0 Product information The Qubit RNA IQ provides a fast, simple method to check whether an RNA sample has degraded using the

More information

SUPPLEMENTARY INFORMATION. doi: /nature07461

SUPPLEMENTARY INFORMATION. doi: /nature07461 Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

More information

Supplemental data for

Supplemental data for Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan

More information

Locus specific chromatin purification protocol (optimized for Hela S3 telomeres).

Locus specific chromatin purification protocol (optimized for Hela S3 telomeres). Locus specific chromatin purification protocol (optimized for Hela S3 telomeres). 1. Preparation of chromatin sample that is suitable for hybridization: -From suspension cells in spinner flasks (20 liters

More information

Unit 1: Chemistry - Guided Notes

Unit 1: Chemistry - Guided Notes Scientific Method Notes: Unit 1: Chemistry - Guided Notes 1 Common Elements in Biology: Atoms are made up of: 1. 2. 3. In order to be stable, an atom of an element needs a full valence shell of electrons.

More information

Previous Class. Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements. Today

Previous Class. Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements. Today Previous Class Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements Today Spectrophotometry Spectrofluorimetry Radioactive Procedures ph dependency Spectrophotometry

More information

Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller

Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller Fluorescence, Light, Absorption, Jablonski Diagram, and Beer-Law First stab at a definition: What is fluorescence?

More information

Presentation Microcalorimetry for Life Science Research

Presentation Microcalorimetry for Life Science Research Presentation Microcalorimetry for Life Science Research MicroCalorimetry The Universal Detector Heat is either generated or absorbed in every chemical process Capable of thermal measurements over a wide

More information

General context Anchor-based method Evaluation Discussion. CoCoGen meeting. Accuracy of the anchor-based strategy for genome alignment.

General context Anchor-based method Evaluation Discussion. CoCoGen meeting. Accuracy of the anchor-based strategy for genome alignment. CoCoGen meeting Accuracy of the anchor-based strategy for genome alignment Raluca Uricaru LIRMM, CNRS Université de Montpellier 2 3 octobre 2008 1 / 31 Summary 1 General context 2 Global alignment : anchor-based

More information

Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ. 128 Academia Road Sec. 2, Nankang, Taipei, 115, Taiwan

Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ. 128 Academia Road Sec. 2, Nankang, Taipei, 115, Taiwan SUPPORTING INFORMATION Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ Mu-Sen Liu, 1,3 Hsin-Yue Tsai, 1,# Xiao-Xia Liu, 1,# Meng-Chiao Ho, 1,3 Wen-Jin Wu, 1,* and Ming-Daw Tsai 1,2,3,*

More information

Supplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes

Supplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes Supplementary Information The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes Xuesong Shi, a Lin Huang, b David M. J. Lilley, b Pehr B. Harbury a,c and Daniel Herschlag

More information

Substrate and Cation Binding Mechanism of Glutamate Transporter Homologs Jensen, Sonja

Substrate and Cation Binding Mechanism of Glutamate Transporter Homologs Jensen, Sonja University of Groningen Substrate and Cation Binding Mechanism of Glutamate Transporter Homologs Jensen, Sonja IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you

More information

RNA Labeling Kit. User Manual

RNA Labeling Kit. User Manual RNA Labeling Kit User Manual RNA Labeling Kit The RNA Labeling Kit contains reagents to perform 10 transcription reactions (50 µl each) and 12 independent labeling reactions. Introduction and product description:

More information

Copy into Note Packet and Return to Teacher

Copy into Note Packet and Return to Teacher Copy into Note Packet and Return to Teacher Section 1: Nature of Matter Objectives: Differentiate between atoms and elements. Analyze how compounds are formed. Distinguish between covalent bonds, hydrogen

More information

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*

More information

Supporting Information

Supporting Information Supporting Information Verification of specific G-quadruplex structure by using a novel cyanine dye supramolecular assembly: I. Recognizing mixed G-quadruplex in human telomeres Qianfan Yang, Junfeng Xiang,

More information

BCHS 6229 Protein Structure and Function. Lecture 3 (October 18, 2011) Protein Folding: Forces, Mechanisms & Characterization

BCHS 6229 Protein Structure and Function. Lecture 3 (October 18, 2011) Protein Folding: Forces, Mechanisms & Characterization BCHS 6229 Protein Structure and Function Lecture 3 (October 18, 2011) Protein Folding: Forces, Mechanisms & Characterization 1 The folding problem One of the greatest unsolved problems of Science The folding

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1)

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) 1) Which of the following statements about the atom A) It has 12 neutrons in its nucleus. B) It

More information

Structure and function of Hip, an attenuator of the Hsp70 chaperone cycle

Structure and function of Hip, an attenuator of the Hsp70 chaperone cycle Supplementary to Manuscript NSMB-A30333A Structure and function of Hip, an attenuator of the Hsp70 chaperone cycle Zhuo Li, F. Ulrich Hartl and Andreas Bracher Supplementary Information Table of contents

More information

RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex

RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1 Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1 1) Which compound in Figure 2.1 is an ester? 1) A) a b c d e Answer: D 2) A scientist

More information

Magnesium-dependent folding of self-splicing RNA: Exploring the link between cooperativity, thermodynamics, and kinetics

Magnesium-dependent folding of self-splicing RNA: Exploring the link between cooperativity, thermodynamics, and kinetics Proc. Natl. Acad. Sci. USA Vol. 96, pp. 6149 6154, May 1999 Biochemistry Magnesium-dependent folding of self-splicing RNA: Exploring the link between cooperativity, thermodynamics, and kinetics JIE PAN*,

More information

Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route

Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route Supporting Information Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route Xu Zhang,, Mark R. Servos and Juewen Liu *

More information

UNIT 1: BIOCHEMISTRY

UNIT 1: BIOCHEMISTRY UNIT 1: BIOCHEMISTRY UNIT 1: Biochemistry Chapter 6.1: Chemistry of Life I. Atoms, Ions, and Molecules A. Living things consist of atoms of different elements 1. An atom is the smallest basic unit of matter

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 0.038/NCHEM.795 Oligomerization transforms human APOBEC3G from an efficient enzyme to a slowly dissociating nucleic acid -binding protein Kathy R. Chaurasiya, Micah J. McCauley, Wei Wang, Dominic

More information

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary

More information

Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps

Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Isothermal Titration Calorimetry in Drug Discovery. Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 2017

Isothermal Titration Calorimetry in Drug Discovery. Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 2017 Isothermal Titration Calorimetry in Drug Discovery Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 217 Introduction Introduction to ITC Strengths / weaknesses & what is required

More information

Small RNA in rice genome

Small RNA in rice genome Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and

More information

Some Problems from Enzyme Families

Some Problems from Enzyme Families Some Problems from Enzyme Families Greg Butler Department of Computer Science Concordia University, Montreal www.cs.concordia.ca/~faculty/gregb gregb@cs.concordia.ca Abstract I will discuss some problems

More information

1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.

1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization. Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the

More information

Supporting Information. Molecular Engineering of Acoustic Protein Nanostructures

Supporting Information. Molecular Engineering of Acoustic Protein Nanostructures Supporting Information Molecular Engineering of Acoustic Protein Nanostructures Authors: Anupama Lakshmanan, Arash Farhadi, Suchita P. Nety, Audrey Lee-Gosselin, Raymond W. Bourdeau, David Maresca and

More information

Cross talk between the 173/294 interaction and the cleavage site in RNase P RNA mediated cleavage

Cross talk between the 173/294 interaction and the cleavage site in RNase P RNA mediated cleavage Published online October 11, 2004 5418 5429 Nucleic Acids Research, 2004, Vol. 32, No. 18 doi:10.1093/nar/gkh883 Cross talk between the 173/294 interaction and the cleavage site in RNase P RNA mediated

More information

Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader

Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader 08 Jan 15 Page 1 of 18 Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader The BMG LABTECH CLARIOstar Microplate Readers were tested for compatibility with the Life Technologies Z -LYTE Assay

More information