Tex 25mer ssrna Binding Stoichiometry
|
|
- Amice Boone
- 5 years ago
- Views:
Transcription
1 Figure S. Determination of Tex:2nt ssrna binding stoichiometry using fluorescence polarization. Fluorescein labeled RNA was held at a constant concentration 2-fold above the K d. Tex protein was titrated in at increasing concentration. An inflection point representing the molar ratio where the binding sites have become saturated occurs at equimolar concentrations of Tex and 2nt ssrna indicating a : binding stoichiometry. The assay was performed in mm Tris 7., mm NaCl, % glycerol and measured using a Tecan fluorimeter. 2 Tex 2mer ssrna Binding Stoichiometry 9 mp (arbitrary units) [Tex]/[RNA] (mm)
2 Figure S2. Tex does not appear to have nuclease activity. WT Tex was assayed in a time course experiment in parallel with RNase T, Micrococcal Nuclease, and the Tex YqgF domain active site mutant E33A/D42A. In the assay, the Tex proteins were at a molar concentration x that of Micrococcal Nuclease. Substrate used in this assay is a radio-labeled 3 nt single-stranded RNA and the assay was performed in mm Tris 7., mm NaCl, % glycerol, 3mM MgCl2, mm CaCl2 at 37 C. Reactions were quenched by the addition of an equal volume of phenol/chloroform ph 6.6 and 2mM EDTA. Samples were spun down and the aqueous phase extracted and mixed with 2x formamide loading dye. Samples were run on a 2% acrylamide (9:)/7M Urea denaturing gel in TBE buffer and the gel was scanned using a TYPHOON imaging system (GE Healthsciences). Time (min) No Protein RNase T Micrococcal Nuclease WT Tex E33A/D42A Tex
3 Figure S3. Predicted sites of sequence insertion for Spt6, with respect to the Tex structure. Front (A) and back (B) stereo views of the Tex structure. Highlighted regions (purple) indicate sites where additional sequence exists in Spt6 when aligned with Tex sequences. All highlighted regions lie on the surface of the Tex structure and appear to be able to accommodate additional sequence without disrupting the core structural scaffold. A B
4 Figure S4. Amino acid sequence alignment of Tex (P. aeruginosa) and Spt6 (S. cerevisiae). Observed Tex secondary structure is indicated above the Tex sequence. Highlighted regions indicate identical (red) and similar (yellow) residues. Sequence alignment was performed using ClustalW. Figure was created using ESPript Spt6-Full_Length-S._cerevisiae M D Y K D D D D K T R E E T G D S K L V P R D E E E I V N D N D E T K A P S E E E E G E D V F D S S E E D E D I D E D E D E A R K V Q E G F Spt6-Full_Length-S._cerevisiae 7 I V N D D D E N E D P G T S I S K K R R K H K R R E R E E D D R L S E D D L D L L M E N A G V E R T K A S S S S G K F K R L K R V G D E G N Spt6-Full_Length-S._cerevisiae 4 A A E S E S D N V A A S R Q D S T S K L E D F F S E D E E E E E S G L R N G R N N E Y G R D E E D H E N R N R T A D K G G I L D E L D D F I Spt6-Full_Length-S._cerevisiae 2 E D D E F S D E D D E T R Q R R I Q E K K L L R E Q S I K Q P T Q I T G L S S D K I D E M Y D I F G D G H D Y D W A L E I E N E E L E N G N H M D S I N T R I A E E L S A L P S Spt6-Full_Length-S._cerevisiae 28 D N N E A E E E E I D E E T G A I K S T K K K I S L Q D I Y D L E D L K K N L M T E G D M K I R K T D I P E R Y Q E L R A G I T D Y G N M S consensus> M.... T. I. E.... L H2 H3 H G R V Q P Q Q V A A A V A L L D E G S T V P F I A R Y R K E V T G S L Spt6-Full_Length-S._cerevisiae 3 S E D Q E L E R N W I A E K I S V D K N F D A N Y D L T. E F K E A I G N A I K F I T K E N L E V P F I Y A Y R R N Y I S S R E K D G F L L consensus> A E... V P F I.. Y R. #... S L H H6 H7 3 D D T Q L R M L E E R L R Y L R E L E E R R G A I L A S I E E Q G..... K L T P E L A R D I K L A D T K T R L E D L Y L P Y K Q K R.. Spt6-Full_Length-S._cerevisiae 42 T E D D L W D I V S L D I E F H S L V N K K D Y V Q R F Y A E L H I D D P I V T E Y F K N Q N T A S I A E L N S L Q D I Y D Y L E F K Y A N consensus>7. #. # L L. #....!..... E # L # D. Y..... K H8 H9 H R T K G Q I A L E A G L G A L A D A L F D D P. T L V P E S E A A R F V D A E K G F A D V K..... Spt6-Full_Length-S._cerevisiae 49 E I N E M F I N H T G K T G K K H L K N S S Y E K F K A S P L Y Q A V S D I G I S A E D V G E N I S S Q H Q I H P P V D H P S S K P V E V I consensus> # L #......! K H H2 β A V L E G A K Y I L M E R F A E D A T L L D K L R V F M K N E A T L T A R V V P.... G K E Q E G A Spt6-Full_Length-S._cerevisiae 6 E S I L N A N S G D L Q V F T S N T K L A I D T V Q K Y Y S L E L S K N T K I R E K V R S D F S K Y Y L A D V V L T A K G K K E I Q K G S L consensus> # #.... # K. R # β2 H3 β3. H4 28 K F S D Y F E H D E P L K S A P S H R A L A I F R G R N E G V L S A S L K V G. E E A P G T L H P. C E V M IA E R F G L S N Q G R A A D K Spt6-Full_Length-S._cerevisiae 63 Y E D I K Y A I N R T P M H F R R D P D V F L K M V E A E S L N L L S V K L H M S S. Q A Q Y I E H L F Q I AL E T T N T S D I A I E W N N consensus> %.. # E..... S. K E.... S #..... # H β4 276 W L A E V V R W T W K V K L Y T H L E T D L F G E L R D G A E D E A I S V F A R N L H D L L L A A P A G P R A T L G L Spt6-Full_Length-S._cerevisiae 699 F R K L A F N Q A M D K. I F Q D I S Q E V K D N L T K N C Q K L V A K T V R H K F M T K L D Q A P F I P N V R D P K I P K I L S L T C G Q consensus> %..... #... # L.... # L.. A P.. P T. G
5 β β6 H6 β7 33 D P G L R T G V K V A V V D A T G K L L D T A T V Y P H A P K N Q.... W D Q T L A V L A A L C A K H Q V E L I A I G N G T A Spt6-Full_Length-S._cerevisiae 768 G R F G A D A I I A V Y V N R K G D F I R D Y K I V D N P F... D K T N P E K F E D T L D N I I Q S C Q P N A I G I N G P N P K T Q K F Y consensus> !.... V #.. G ! #..... L Q. #. I. I H7 β8 H8 H9 H2 H2 39 S R E T D K L A G E L I K K Y P G M K L T K I M V S E A G A S V Y S A S E L A A K E F P E L D V S L R G A V S I A R R L Q D P L A E L V K I Spt6-Full_Length-S._cerevisiae 83 K R L Q E V L H K K Q I V D S R G H T I P I I Y V E D E V A I R Y Q N S E R A A Q E F P N K P P L V K Y C I A L A R Y M H S P L L E Y A N L consensus>7. R.. #. L.... I.... G..... I. V. #.. A.. Y.. S E. A A. E F P # !.. A R. $.. P L. E H22 H23 β9 H24 H2 46 E P... K S I G V G Q Y Q H D V S Q L K L A R S L D A V V E D C V N A V G V D V N T A S..... A A L L A R I S G L N S T L A Q N I V A Spt6-Full_Length-S._cerevisiae 9 T S E E V R S L S I H P H Q N L L S S E Q L S W A L E T A F V D I V N L V S V E V N K A T D N N Y Y A S A L K Y I S G F G K R K A I D F L Q consensus> S..!... Q... S... L... L #.... D. V N. V. V # V N. A A.. L.. I S G..... A. # H26 H27 β H28 H29 27 H R D A. N G A F R T R D E L K K V S R L G E K T F E Q A A G F L R V M N G D N P L D A S A V H P E T Y P L V Q R I AA Spt6-Full_Length-S._cerevisiae 97 S L Q R L N E P L L A R Q Q L I T H N I L H K T I F M N S A G F L Y I S W N E K R Q K Y E D L E H D Q L D S T R I H P E D Y H L A T K V AA consensus>7.. #.. N..... R # # L..... L.... F. #. A G F L.! #. L D...! H P E. Y. L...! A A H H3 H32 H33 86 D T E R D I R S L I G D.. S A F L K R L D P K K F T D E T F G L P T V T D I L K E L D K P Spt6-Full_Length-S._cerevisiae 4 D A L E Y D P D T I A E K E E Q G T M S E F I E L L R E D P D R R A K L E S L N L E S Y A E E L E K N T G L R K L N N L N T I V L E L L D G consensus>7 D A. L.. L #... %. # E L..... I.. E L H34 β β β3 H3 63 G R D P R P E F K T A E F Q E G V E S L K D L K P G M V L E G V V T N V T N F G..... A F V D I G V H Q D G L V H I S A L S E K F V K D Spt6-Full_Length-S._cerevisiae F E E L R N D F H P L Q G D E I F Q S L T G E S E K T F F K G S I I P V R V E R F W H N D I I C T T N S E V E C V V N A Q R H A G A Q L R R consensus>7.. #. R. # F... #. # E.. # S L G.!.. V #.. V H36. β4 β 69 P Y. E V V K A G D I V K V K V M E V D I P R N R V G L S M R M S D T P G E K V E G Q R G G R P T G S. G Q P R Q E R G A P R G Q S A P P A Spt6-Full_Length-S._cerevisiae 8 P A N E I Y E I G K T Y P A K V I Y I D Y A N I T A E V S L L D H D V K Q Q Y V P. I S Y S K D P S I W D L K Q E L E D A E E E R K L M M A consensus>7 P.. E!... G..... K V..! D S $... D... #. V #... A A N N A M A A L F A N A K Q L K K K Spt6-Full_Length-S._cerevisiae 24 E A R A K R T H R V I N H P Y Y F P F N G R Q A E D Y L R S K E R G E F V I R Q S S R G D D H L V I T W K L D K D L F Q H I D I Q E L E K E consensus>7 # Spt6-Full_Length-S._cerevisiae 324 N P L A L G K V L I V D N Q K Y N D L D Q I I V E Y L Q N K V R L L N E M T S S E K F K S G T K K D V V K F I E D Y S R V N P N K S V Y Y F Spt6-Full_Length-S._cerevisiae 394 S L N H D N P G W F Y L M F K I N A N S K L Y T W N V K L T N T G Y F L V N Y N Y P S V I Q L C N G F K T L L K S N S S K N R M N N Y R consensus> References. Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G., Gibson T.J. (994). CLUSTAL W: improving the sensitivity of progressivemultiple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, Gouet, P., Courcelle, E., Stuart, D. I. & Metoz, F. (999). ESPript: multiple sequence alignments in PostScript. Bioinformatics, 3-38.
According to the manufacture s direction (Pierce), RNA and DNA
Supplementary method Electrophoretic Mobility-shift assay (EMSA) According to the manufacture s direction (Pierce), RNA and DNA oligonuleotides were firstly labeled by biotin. TAVb (1pM) was incubated
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.
More informationSupplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a
Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a series of tmfret-pairs comprised of single cysteine mutants
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1: The HpUreI crystal used for collection of native diffraction data. The crystal belongs to spacegroup P4 2 2 1 2 and has an approximate maximal dimension of 0.25 mm. Supplementary
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationA conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.
Supplemental Material for A conserved P-loop anchor limits the structural dynamics that mediate nucleotide dissociation in EF-Tu. Evan Mercier 1,2, Dylan Girodat 1, and Hans-Joachim Wieden 1 * 1 Alberta
More informationData Sheet. Azide Cy5 RNA T7 Transcription Kit
Cat. No. Size 1. Description PP-501-Cy5 10 reactions à 40 µl For in vitro use only Quality guaranteed for 12 months Store all components at -20 C. Avoid freeze and thaw cycles. DBCO-Sulfo-Cy5 must be stored
More informationFunctional Genomics Research Stream
Functional Genomics Research Stream http://fc09.deviantart.net/fs70/i/2010/214/2/f/dna_heart_by_micche.jpg http://www.ryersondesigns.com/skanndelus/dnaheart.jpg Research Meeting: February 14, 2012 Nucleic
More informationInDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9
Lecture 5 Alignment I. Introduction. For sequence data, the process of generating an alignment establishes positional homologies; that is, alignment provides the identification of homologous phylogenetic
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationPhenol-Chloroform reagents. Selection guide. OH ; MW : High quality reagents for use in nucleic acid purification.
Phenol-Chloroform reagents Extraction with phenol and phenol/chloroform mixtures is a universal method for purification of DNA and RNA. Proteins and restriction enzymes are removed by phenol and chloroform
More informationMarcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando, Susana M. Cerritelli, Robert J. Crouch, and Wei Yang
Molecular Cell, Volume 28 Supplemental Data Structure of Human RNase H1 Complexed with an RNA/DNA Hybrid: Insight into HIV Reverse Transcription Marcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando,
More informationSupplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
More informationSUPPLEMENTARY INFORMATION. Pistol Ribozyme Adopts a Pseudoknot Fold. Facilitating Site-specific In-line Cleavage
UPPLEMENTAY INFMATIN Pistol ibozyme Adopts a Pseudoknot Fold Facilitating ite-specific In-line Cleavage Aiming en 1,2,4, Nikola Vušurović 3,4, Jennifer Gebetsberger 3, Pu Gao 2, Michael Juen 3, Christoph
More informationAnalysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase
SUPPLEMENTARY INFORMATION Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase Louise C Briggs, Geoff S Baldwin, Non Miyata, Hisao Kondo, Xiaodong Zhang, Paul S
More informationStructural insights into energy regulation of light-harvesting complex from spinach CP29
SUPPLEMENTARY INFORMATION Structural insights into energy regulation of light-harvesting complex from spinach CP29 Xiaowei Pan 1, Mei Li 1, Tao Wan 1,2, Longfei Wang 1,2, Chenjun Jia 1,2, Zhiqiang Hou
More informationSupplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27
Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27 A40 non-canonical pair stacked over the A41 (G1-C26) three-base
More informationSupporting Information
Supporting Information Mullins et al. 10.1073/pnas.0906781106 SI Text Detection of Calcium Binding by 45 Ca 2 Overlay. The 45 CaCl 2 (1 mci, 37 MBq) was obtained from NEN. The general method of 45 Ca 2
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Time-resolved FRET (trfret) to probe for changes in the Box A/A stem upon complex assembly U3 MINI was folded and the decay of Fl fluorescence was measured at 20 ºC (see
More informationFigure 2. Amino acid sequence alignment of L-carbamoylases. A BLAST search was conducted with BsLcar sequence, using the UNIREF100 sequence cluster
Figure 1. A) Simulated MIT MAP at 1.2 σ contours (blue), generated by shaking the coordinates using PDBSET from the CCP4 program suite [1], removing cacodylate molecule from the model, and refining 5 cycles
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
More informationSupporting Information for: Kinetic Mechanisms Governing Stable Ribonucleotide Incorporation in Individual DNA Polymerase Complexes
Supporting Information for: Kinetic Mechanisms Governing Stable Ribonucleotide Incorporation in Individual DNA Polymerase Complexes Joseph M. Dahl, Hongyun Wang, José M. Lázaro, Margarita Salas, and Kate
More informationFull-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
More informationEST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
More informationThe structure of the deubiquitinase USP15 reveals a misaligned catalytic triad and an open ubiquitin-binding channel
SUPPORTING INFORMATION The structure of the deubiquitinase USP15 reveals a misaligned catalytic triad and an open ubiquitin-binding channel Stephanie J. Ward, Hayley E. Gratton, Peni Indrayudha #, Camille
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10458 Active Site Remodeling in the Bifunctional Fructose-1,6- bisphosphate aldolase/phosphatase Juan Du, Rafael F. Say, Wei Lü, Georg Fuchs & Oliver Einsle SUPPLEMENTARY FIGURES Figure
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationSupporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationSequence Analysis '17- lecture 8. Multiple sequence alignment
Sequence Analysis '17- lecture 8 Multiple sequence alignment Ex5 explanation How many random database search scores have e-values 10? (Answer: 10!) Why? e-value of x = m*p(s x), where m is the database
More informationSimulative and experimental characterization of a ph-dependent
Simulative and experimental characterization of a ph-dependent clamp-like DNA triple-helix nanoswitch Federico Iacovelli, # Andrea Idili, # Alessandro Benincasa, Davide Mariottini, Alessio Ottaviani, Mattia
More informationSupporting information for
Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of
More informationfor Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet
SUPPLEMENTARY INFORMATION TO Structural basis for enzymatic excision of N -methyladenine and N 3 -methylcytosine from DNA Ingar Leiros,5, Marivi P. Nabong 2,3,5, Kristin Grøsvik 3, Jeanette Ringvoll 2,
More informationProtocol for 2D-E. Protein Extraction
Protocol for 2D-E Protein Extraction Reagent 1 inside the ReadyPrep TM Sequential Extraction kit (in powder form) 50ml of deionized water is used to dissolve all the Reagent 1. The solution is known as
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationStructure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27
Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase
More informationDSC Characterization of the Structure/Function Relationship for Proteins
DSC Characterization of the Structure/Function Relationship for Proteins Differential Scanning Calorimetry (DSC) DSC is recognized as Gold Std technique for measuring molecular thermal stability and structure
More informationSUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state
SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry
More informationDepartment of Chemistry IIT Kharagpur. Biochemical Techniques Laboratory (CY49006)
Department of Chemistry IIT Kharagpur Biochemical Techniques Laboratory (CY49006) Name of the Experiments 1 Agarose Electrophoresis of Food Dyes 2 Protein Structure Analysis 3 Protein Denaturation Studies
More informationSupporting Text Z = 2Γ 2+ + Γ + Γ [1]
Supporting Text RNA folding experiments are typically carried out in a solution containing a mixture of monovalent and divalent ions, usually MgCl 2 and NaCl or KCl. All three species of ions, Mg, M +
More informationEffects of Gap Open and Gap Extension Penalties
Brigham Young University BYU ScholarsArchive All Faculty Publications 200-10-01 Effects of Gap Open and Gap Extension Penalties Hyrum Carroll hyrumcarroll@gmail.com Mark J. Clement clement@cs.byu.edu See
More informationReconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo
Supporting Information Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo Heini Ijäs, Iiris Hakaste, Boxuan Shen, Mauri A. Kostiainen, and Veikko Linko* Biohybrid
More informationMalachite Green Phosphate Detection Kit Catalog Number: DY996
Malachite Green Phosphate Detection Kit Catalog Number: DY996 This Malachite Green Phosphate Detection Kit employs a simple, sensitive, reproducible, and non-radioactive method for measuring inorganic
More informationSupplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes
Supplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes Joseph M. Dahl 1, Ai H. Mai 1, Gerald M. Cherf 1, Nahid N. Jetha 4, Daniel R. Garalde 3, Andre Marziali
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationSDS-polyacrylamide gel electrophoresis
SDS-polyacrylamide gel electrophoresis Protein Isolation and Purification Protein purification is a series of processes intended to isolate one or a few proteins from a complex mixture, usually cells,
More informationExquisite Sequence Selectivity with Small Conditional RNAs
Supplementary Information Exquisite Sequence Selectivity with Small Conditional RNAs Jonathan B. Sternberg and Niles A. Pierce,, Division of Biology & Biological Engineering, Division of Engineering &
More informationGenomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationA profile-based protein sequence alignment algorithm for a domain clustering database
A profile-based protein sequence alignment algorithm for a domain clustering database Lin Xu,2 Fa Zhang and Zhiyong Liu 3, Key Laboratory of Computer System and architecture, the Institute of Computing
More informationBasics on bioinforma-cs Lecture 7. Nunzio D Agostino
Basics on bioinforma-cs Lecture 7 Nunzio D Agostino nunzio.dagostino@entecra.it; nunzio.dagostino@gmail.com Multiple alignments One sequence plays coy a pair of homologous sequence whisper many aligned
More informationAn Efficient Algorithm for Protein-Protein Interaction Network Analysis to Discover Overlapping Functional Modules
An Efficient Algorithm for Protein-Protein Interaction Network Analysis to Discover Overlapping Functional Modules Ying Liu 1 Department of Computer Science, Mathematics and Science, College of Professional
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationMeet Our Uncle: 12 Stability Applications on One Platform
Tech Note Meet Our Uncle: 12 Stability Applications on One Platform Uncle is an all-in-one stability platform that enables twelve different applications with one instrument. Fluorescence, static light
More information2 Dean C. Adams and Gavin J. P. Naylor the best three-dimensional ordination of the structure space is found through an eigen-decomposition (correspon
A Comparison of Methods for Assessing the Structural Similarity of Proteins Dean C. Adams and Gavin J. P. Naylor? Dept. Zoology and Genetics, Iowa State University, Ames, IA 50011, U.S.A. 1 Introduction
More informationSupplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element
Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element as determined in a previous study 1. The log K value
More informationFrom Gen. Chem.: 1. WHAT is an ACID? 2. WHAT is a BASE?
Expt. 1: Biological Buffers Goals: 1. Learn how to use the Henderson-Hasselbach (H-H) eqn. 2. Learn how to prepare buffers. 3. Learn something about physical properties of biological buffers which are
More informationSupplementary Figure 2. Negative stain EM reconstructions. 4
Supplementary Information for: EM Structure of human APC/C Cdh1 -EMI1 reveals multimodal mechanism E3 ligase shutdown Item Page Supplementary Figure 1. Analytical Ultracentrifugation of EMI1 DLZT. 2 Supplementary
More informationControlling the Catalytic Functions of DNAzymes within Constitutional. Dynamic Networks of DNA Nanostructures
Supporting Information Controlling the Catalytic Functions of DNAzymes within Constitutional Dynamic Networks of DNA Nanostructures Shan Wang,, Liang Yue,, Zohar Shpilt, Alessandro Cecconello, Jason S.
More informationProgrammed ph-driven Reversible Association and Dissociation of Inter-Connected. Circular DNA Dimer Nanostructures
Supporting information Programmed ph-driven Reversible Association and Dissociation of Inter-Connected Circular DNA Dimer Nanostructures Yuwei Hu, Jiangtao Ren, Chun-Hua Lu, and Itamar Willner* Institute
More informationA New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers
Electronic Supplementary Information A New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers Abulfazl Fakhari M. and Steven E. Rokita Contribution from the Department
More informationQubit RNA IQ Assay Kits
USER GUIDE Qubit RNA IQ s Catalog No. Q33221, Q33222 Pub. No. MAN0017405 Rev. B.0 Product information The Qubit RNA IQ provides a fast, simple method to check whether an RNA sample has degraded using the
More informationSUPPLEMENTARY INFORMATION. doi: /nature07461
Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of
More informationSupplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
More informationLocus specific chromatin purification protocol (optimized for Hela S3 telomeres).
Locus specific chromatin purification protocol (optimized for Hela S3 telomeres). 1. Preparation of chromatin sample that is suitable for hybridization: -From suspension cells in spinner flasks (20 liters
More informationUnit 1: Chemistry - Guided Notes
Scientific Method Notes: Unit 1: Chemistry - Guided Notes 1 Common Elements in Biology: Atoms are made up of: 1. 2. 3. In order to be stable, an atom of an element needs a full valence shell of electrons.
More informationPrevious Class. Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements. Today
Previous Class Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements Today Spectrophotometry Spectrofluorimetry Radioactive Procedures ph dependency Spectrophotometry
More informationFluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller
Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller Fluorescence, Light, Absorption, Jablonski Diagram, and Beer-Law First stab at a definition: What is fluorescence?
More informationPresentation Microcalorimetry for Life Science Research
Presentation Microcalorimetry for Life Science Research MicroCalorimetry The Universal Detector Heat is either generated or absorbed in every chemical process Capable of thermal measurements over a wide
More informationGeneral context Anchor-based method Evaluation Discussion. CoCoGen meeting. Accuracy of the anchor-based strategy for genome alignment.
CoCoGen meeting Accuracy of the anchor-based strategy for genome alignment Raluca Uricaru LIRMM, CNRS Université de Montpellier 2 3 octobre 2008 1 / 31 Summary 1 General context 2 Global alignment : anchor-based
More informationStructural Mechanism for the Fidelity Modulation of DNA Polymerase λ. 128 Academia Road Sec. 2, Nankang, Taipei, 115, Taiwan
SUPPORTING INFORMATION Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ Mu-Sen Liu, 1,3 Hsin-Yue Tsai, 1,# Xiao-Xia Liu, 1,# Meng-Chiao Ho, 1,3 Wen-Jin Wu, 1,* and Ming-Daw Tsai 1,2,3,*
More informationSupplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes
Supplementary Information The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes Xuesong Shi, a Lin Huang, b David M. J. Lilley, b Pehr B. Harbury a,c and Daniel Herschlag
More informationSubstrate and Cation Binding Mechanism of Glutamate Transporter Homologs Jensen, Sonja
University of Groningen Substrate and Cation Binding Mechanism of Glutamate Transporter Homologs Jensen, Sonja IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you
More informationRNA Labeling Kit. User Manual
RNA Labeling Kit User Manual RNA Labeling Kit The RNA Labeling Kit contains reagents to perform 10 transcription reactions (50 µl each) and 12 independent labeling reactions. Introduction and product description:
More informationCopy into Note Packet and Return to Teacher
Copy into Note Packet and Return to Teacher Section 1: Nature of Matter Objectives: Differentiate between atoms and elements. Analyze how compounds are formed. Distinguish between covalent bonds, hydrogen
More informationSupplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Supplementary Information Structural basis for precursor protein-directed ribosomal peptide macrocyclization Kunhua Li 1,3, Heather L. Condurso 1,3, Gengnan Li 1, Yousong Ding 2 and Steven D. Bruner 1*
More informationSupporting Information
Supporting Information Verification of specific G-quadruplex structure by using a novel cyanine dye supramolecular assembly: I. Recognizing mixed G-quadruplex in human telomeres Qianfan Yang, Junfeng Xiang,
More informationBCHS 6229 Protein Structure and Function. Lecture 3 (October 18, 2011) Protein Folding: Forces, Mechanisms & Characterization
BCHS 6229 Protein Structure and Function Lecture 3 (October 18, 2011) Protein Folding: Forces, Mechanisms & Characterization 1 The folding problem One of the greatest unsolved problems of Science The folding
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1)
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) 1) Which of the following statements about the atom A) It has 12 neutrons in its nucleus. B) It
More informationStructure and function of Hip, an attenuator of the Hsp70 chaperone cycle
Supplementary to Manuscript NSMB-A30333A Structure and function of Hip, an attenuator of the Hsp70 chaperone cycle Zhuo Li, F. Ulrich Hartl and Andreas Bracher Supplementary Information Table of contents
More informationRNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1
Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1 1) Which compound in Figure 2.1 is an ester? 1) A) a b c d e Answer: D 2) A scientist
More informationMagnesium-dependent folding of self-splicing RNA: Exploring the link between cooperativity, thermodynamics, and kinetics
Proc. Natl. Acad. Sci. USA Vol. 96, pp. 6149 6154, May 1999 Biochemistry Magnesium-dependent folding of self-splicing RNA: Exploring the link between cooperativity, thermodynamics, and kinetics JIE PAN*,
More informationInstantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route
Supporting Information Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route Xu Zhang,, Mark R. Servos and Juewen Liu *
More informationUNIT 1: BIOCHEMISTRY
UNIT 1: BIOCHEMISTRY UNIT 1: Biochemistry Chapter 6.1: Chemistry of Life I. Atoms, Ions, and Molecules A. Living things consist of atoms of different elements 1. An atom is the smallest basic unit of matter
More informationSUPPLEMENTARY INFORMATION
DOI: 0.038/NCHEM.795 Oligomerization transforms human APOBEC3G from an efficient enzyme to a slowly dissociating nucleic acid -binding protein Kathy R. Chaurasiya, Micah J. McCauley, Wei Wang, Dominic
More informationSupplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change
Supplementary Information Overlap between folding and functional energy landscapes for adenylate kinase conformational change by Ulrika Olsson & Magnus Wolf-Watz Contents: 1. Supplementary Note 2. Supplementary
More informationStructure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps
Cell Reports Supplemental Information Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps Chih-Chia Su, Jani Reddy Bolla, Nitin Kumar, Abhijith Radhakrishnan,
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationIsothermal Titration Calorimetry in Drug Discovery. Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 2017
Isothermal Titration Calorimetry in Drug Discovery Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 217 Introduction Introduction to ITC Strengths / weaknesses & what is required
More informationSmall RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
More informationSome Problems from Enzyme Families
Some Problems from Enzyme Families Greg Butler Department of Computer Science Concordia University, Montreal www.cs.concordia.ca/~faculty/gregb gregb@cs.concordia.ca Abstract I will discuss some problems
More information1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.
Organic Chemistry Assignment Score. Name Sec.. Date. Working by yourself or in a group, answer the following questions about the Organic Chemistry material. This assignment is worth 35 points with the
More informationSupporting Information. Molecular Engineering of Acoustic Protein Nanostructures
Supporting Information Molecular Engineering of Acoustic Protein Nanostructures Authors: Anupama Lakshmanan, Arash Farhadi, Suchita P. Nety, Audrey Lee-Gosselin, Raymond W. Bourdeau, David Maresca and
More informationCross talk between the 173/294 interaction and the cleavage site in RNase P RNA mediated cleavage
Published online October 11, 2004 5418 5429 Nucleic Acids Research, 2004, Vol. 32, No. 18 doi:10.1093/nar/gkh883 Cross talk between the 173/294 interaction and the cleavage site in RNase P RNA mediated
More informationZ -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader
08 Jan 15 Page 1 of 18 Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader The BMG LABTECH CLARIOstar Microplate Readers were tested for compatibility with the Life Technologies Z -LYTE Assay
More information