SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 DOI: /NCHEM.1290 Metal-directed, chemically tunable assembly of one-, two- and threedimensional crystalline protein arrays ,3 Jeffrey D. Brodin 1, X. I. Ambroggio 2, Chunyan Tang 1, Kristin N. Parent 1, Timothy S. Baker 1,3 and F. Akif Tezcan 1 1 Department of Chemistry and Biochemistry, University of California, San Diego, La Jolla, CA Rosetta Design Group LLC, Fairfax, VA Division of Biological Sciences, University of California, San Diego, La Jolla, CA Computational interface redesign. RIDC3 was designed starting from the Zn 4 :MBPC1 4 platform as previously described 1, with the following modifications. During rotamer optimizations, the standard Lennard Jones van der Waals repulsive term of RosettaDesign did not include any non-canonical Dunbrack rotamers; and the final design was selected from redesigns of multiple models generated through symmetric rigid body perturbations of the monomers of the MBPC1 crystal structures in a procedure described in detail below. Building off of previously reported design methodologies 2, 3, we sought to expand the search space for the redesigns and compensate for explicit energy-based modeling of rotational, translational, and backbone degrees of freedom by generating multiple starting models through plausible rigid body rotation trajectories and selecting the redesigns with the most favorable properties. For the rigid body rotations, two monomers of MBPC1 making up the desired C2- dimer geometry (initial dimer geometry was based on the symmetric halves of Zn 4 :MBPC1 4 ) were rotated symmetrically inwards or outwards from each other around the Zn-Zn axis. In the first stage, starting models were generated from rotations of one degree increments from 10 degrees inwards to 10 degrees outwards using PDBCUR 4 and the interface residues of the models were redesigned using RosettaDesign as described above. In the second stage, redesigns were performed for models generated by 0.1 degree increment rotations throughout the rotation NATURE CHEMISTRY 1

2 range (2-4 degrees inwards) which resulted in first stage redesigns with computed energies below zero and SASApack 5 values below 0.8. The effect of each individual amino acid substitution of the redesign, with the lowest SASApack value, on the predicted ΔΔG of binding, total energy, and SASApack score was evaluated, and those substitutions which did not significantly affect the scores were reverted to the starting amino acids. Through this design procedure, 10 surface mutations (K27E/D28K/T31E/R34L/L38A/Q41L/H59R/D66A/V69M/ L76A) to MBPC1 were predicted for the construct we named RIDC3. Docking of the crystallographic model into the reconstructed RIDC3 nanotube volume. Docking of dimers of C2-dimers into the reconstructed density map and production of figures was performed using Chimera 6. The dimer of C2-dimers was chosen as a model for docking studies because it was observed in both Type-1 and Type-2 crystal structures and is formed by pairwise, Zn1-mediated interactions that are firmly anchored on rigid helices and should therefore be less flexible than Zn2 and Zn3-mediated interactions, which involve loops. In addition to the orientation depicted in Figure 5, where there is a two-fold screw axis along the length of the subunit, an arrangement with all tetramers facing the same end of the tube was also tested. In this model, every other tetramer exhibited a relatively poor fit, verifying the alternating arrangement of tetrameric subunits. Supplementary References 1. Salgado, E. N., Ambroggio, X. I., Brodin, J. D., Lewis, R. A., Kuhlman, B. & Tezcan, F. A. Metal-Templated Design of Protein Interfaces. Proc. Natl. Acad. Sci.USA 107, (2010). 2. Kortemme, T., Joachimiak, L. A., Bullock, A. N., Schuler, A. D., Stoddard, B. L. & Baker, D. Computational redesign of protein-protein interaction specificity. Nat. Str. Mol. Biol. 11, (2004). NATURE CHEMISTRY 2

3 3. Joachimiak, L. A., Kortemme, T., Stoddard, B. L. & Baker, D. Computational Design of a New Hydrogen Bond Network and at Least a 300-fold Specificity Switch at a Protein- Protein Interface. J. Mol. Biol. 361, (2006). 4. Winn, M. D. et al. Overview of the CCP4 suite and current developments. Acta. Cryst. D. 67, (2011). 5. Leaver-Fay, A., Butterfoss, G. L., Snoeyink, J. & Kuhlman, B. Maintaining solvent accessible surface area under rotamer substitution for protein design. J. Comp. Chem. 28, (2007). 6. Ferrin, T. E., Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M. & Meng, E. C. UCSF chimera - A visualization system for exploratory research and analysis. J. Comput. Chem. 25, (2004). NATURE CHEMISTRY 3

4 Supplementary Tables Supplementary Table S1. Crystallization, X-ray data collection and refinement information and statistics for the PEG-precipitated (Type 1) and Zn-directed (Type 2) RIDC3 crystals. * denotes highest resolution shell. Crystallization Conditions Precipitant Solution Type 1 Crystals (PEG-Precipitated) 20 % PEG 3350, 2.1 mm ZnCl 2, 0.2 M CaCl 2, and 100 mm Bis-Tris (ph 6.5) [RIDC3] (mm) V prot :V precipitant (µl) 2:1 2:1 Data Collection Location SSRL BL 7-1 SSRL BL 9-2 Unit Cell Dimensions (Å) α=β=γ=90 Space Group P C2 Resolution (Å) X-ray wavelength (Å) Number unique reflections Redundancy Completeness (%)* 99.0 (99.8) 94.3 (92.8) <I/σI>* 7.7 (2.2) 4.7 (1.5) R symm (%)* 7.0 (34.9) 10.8 (48.9) R work /R free (%) 19.0/ /28.6 B-factors (Å 2 ) Protein Ligands/ions Water R.m.s. deviations Bond lengths (Å) Bond angles ( ) Ramachandran plot (%) Most favored Allowed Generously allowed Disallowed Type 2 Crystals (Zn-directed) 8 mm ZnCl 2 and 200 mm Bis- Tris (ph 6.0) α=γ=90, β=112.6 NATURE CHEMISTRY 4

5 Supplementary Table S2. Cryo-EM data collection and image reconstruction statistics. Cyclic symmetry (Cn) 9 Pixel size (Å) Objective lens defocus range (µm) Total number of micrographs recorded 139 Total number of boxed helices 229 Number of tubes used in the reconstruction 5 Number of segments 1780 Segment length (pixels) 200 Shift between segments (pixels) 4 Padded segment size (pixels) 350 Range of initial ΔΖ (Å) Refined value of ΔΖ (Å) 25.8 Range of initial Δφ (º) Refined value of Δφ (º) 5.3 Smallest diameter (Å) 520 Largest diameter (Å) 635 NATURE CHEMISTRY 5

6 Supplementary Figures Supplementary Figure S1. The derivation of the C2-dimer geometry from the Zn 4 :MBPC1 4 architecture. MBPC1 is a derivative of cytochrome cb 562, decorated with two metal-chelating motifs (H59/H63 and H73/H77) on its surface. Upon equimolar Zn 2+ addition, MBPC1 assembles into a D 2 symmetric tetramer, Zn 4 :MBPC1 4, which is held together by four equivalent Zn ions coordinated to H73/H77 from one monomer, H63 from a second, and D74 from a fourth. Because of its D 2 symmetry, Zn 4 :MBPC1 4 contains three C 2 symmetric interfaces (i1, i2, i3), of which only i1, i2 are shown above. This means that Zn 4 :MBPC1 4 can be halved in three different orientations to obtains three alternative sets of C 2 symmetric dimers. The particular C2-dimer geometry that constitutes the focus of this study (and is stabilized by surface mutations to produce RIDC3) is obtained by halving Zn 4 :MBPC1 4 along i2, which yields two equivalent, three-coordinate Zn coordination sites formed by H73/H77 from one monomer and H63 from the second. The coordination vectors originating from these coordination sites are depicted as red and blue arrows. NATURE CHEMISTRY 6

7 Supplementary Figure S2. Sedimentation coefficient distributions for RIDC3 as determined by analytical ultracentrifugation. Samples were prepared at 5 µm (light blue) or 600 µm (blue) RIDC3 in the presence of equimolar Zn or 600 µm (red) RIDC3 in the presence of 5 mm EDTA. We attribute the tetrameric species populated at 600 µm RIDC µm Zn to the Zn1-linked dimer of C2-dimers observed in both the PEG-precipitated (Fig.1) and Zn-directed (Fig.4) crystals. NATURE CHEMISTRY 7

8 Supplementary Figure S3. Superposition of Rosetta-predicted (magenta) and crystallographically-determined (grey) Zn2:RIDC32 (C2-dimer) structures. NATURE CHEMISTRY 8

9 Supplementary Figure S4. Time course of Zn-directed RIDC3 self-assembly monitored by TEM. For sample preparation, 3 µl aliquots of a solution containing 100 µm RIDC3 and 300 µm Zn at ph=5.5 were pipetted onto carbon-coated Cu grids and stained with uranyl acetate. These images reveal mostly small, disordered aggregates until Day 2, after which large crystals (shown with arrows) begin to appear. NATURE CHEMISTRY 9

10 Supplementary Figure S5. Width distributions of negatively stained RIDC3 nanotubes. a, Solutions containing 450 µm RIDC3 and 4.5 mm Zn were deposited on carbon-coated Cu grids and stained with uranyl acetate. After imaging at a nominal magnification of 25,000x, 125 independent width measurements were taken manually using Image J, binned into 4 nm ranges and the frequency of each range was plotted. b, A solution of 100 µm RIDC 3 and 300 µm Zn was imaged and analyzed identically to (a). NATURE CHEMISTRY 10

11 Supplementary Figure S6. Zn-induced RIDC3 self-assembly in solution characterized by light microscopy and TEM after negative staining. For all images, [RIDC3]=450 µm and ph=5.5. At a 1:1 Zn:protein ratio (first column), only macroscopic crystals are observed and were characterized by light microscopy with (top) and without (bottom) polarizers. For all other cases, the top and the middle rows show low and the high magnification TEM images, respectively, with the Fourier transforms of the latter given in the bottom row. The overlapping lattice axes in the tubular structures are illustrated as black and red arrows. NATURE CHEMISTRY 11

12 Supplementary Figure S7. Light micrographs of Zn-directed, 3D RIDC3 crystalline arrays used for X-ray diffraction studies. NATURE CHEMISTRY 12

13 Supplementary Figure S8. Superposition of Zn1-linked dimers of C2-dimers onto a 2D projection map of negatively-stained, monolayered RIDC3 sheets obtained at ph 8.5. The opposing rows composed of two-fold symmetrical, bilobed densities can be well modeled with Zn1-linked dimers of c2-dimers (Zn4:RIDC34) present both in Type 1 (PEGprecipitated) and Type 2 (Zn-directed) crystals. NATURE CHEMISTRY 13

14 Supplementary Figure S9. Cross-section normal to the RIDC3 nanotube axis. A planar section through the reconstructed volume of an RIDC3 nanotube was generated using Chimera and shows 36 discrete densities, each consistent with a C2-dimer. Two pairs of C2-dimers compose a single subunit in the helical reconstruction. NATURE CHEMISTRY 14

15 Supplementary Figure S10. Comparison of metal-linked interfaces in nanotubes and 2D sheets from the X-ray crystallographic structure. Comparison of Zn2 (a) and Zn3 (b) interfaces in nanotubes (top, colored in cyan and magenta) with those in 2D sheets (bottom, colored in shades of grey), highlighting the curvature of RIDC3 nanotubes and the resulting changes in intersubunit distances based on D21 residues. NATURE CHEMISTRY 15

16 Supplementary Figure S11. Comparison of the crystallographically observed Zn2 interface (gray backbone; orange coordination sphere; see Fig. 3b) with that based on docking into the reconstructed nanotubes (cyan). Two dimers of Zn1-linked c2-dimers from each structural model were aligned using Pymol (RMSD = 1.63 Å over 848 Ca s) and show little change in their Zn2 coordination modes. NATURE CHEMISTRY 16

17 Supplementary Figure S12. Comparison of the crystallographically observed Zn3 interface (gray backbone, red coordination sphere; see Fig. 3b) with that based on docking into the reconstructed nanotubes (cyan and magenta). Two Zn3-linked C2-dimers (cyan or magenta) were docked into the reconstructed density map, yielding a ridge comparable to that seen in the Type 2 crystal structure. Because of the asymmetry introduced by bending the lattice into a tube, the ridges pointing towards the outside (left) and inside (right) of the tube are different, as indicated by a structural alignment using Pymol (RMSD = 4.28 Å and 3.7 Å over 424 C! s for the exterior and interior ridges, respectively). The bending and twisting necessary for the curving of the 2D sheet into a tube result in a displacement of the residues involved in the primary coordination sphere (bottom left) and generation of a new potential metal binding site (bottom right). NATURE CHEMISTRY 17

18 Supplementary Figure S13. Time course for the maturation of rhodamine-c21ridc3 crystals at ph 8.5. a, TEM images of negatively stained samples at the indicated time points show the presence of crystalline arrays at Day 3 (arrows) and an increase in the number and relative proportion of arrays versus aggregate by day 10. b, The emergence of a CD signal from samples containing 50 µm rhodamine- C21 RIDC3 and 500 µm Zn coincides with the presence of crystalline arrays as determined by TEM. c, The UV-visible absorbance spectrum of the same sample shows a blue-shifted band immediately after the addition of Zn and a time-dependent increase in turbidity. NATURE CHEMISTRY 18

19 Supplementary Figure S14. Alternative views of vitrified, unstained RIDC3 nanotubes obtained at ph=5.5. The samples shown are frozen on Quantifoil grids rather than lacey carbon grids (which were used for image reconstruction) for a clearer view of collections of RIDC3 nanotubes. The grid circle shown in (a) is 2 µm in diameter. NATURE CHEMISTRY 19

20 Supplementary Figure S15. Diffraction pattern of RIDC3 nanotubes. The incoherently averaged power spectrum from all images used in the reconstruction (left) compared with the Fourier transform of a 2D projection of the final reconstruction (right) shows matching layer line positions (see red circles at 1/48 Å -1 and 1/55 Å -1 ), providing evidence that the reconstruction is correct. The increase in resolution obtained during the reconstruction is apparent from a comparison of the high-resolution diffraction limits (arrows) of 2D projections before and after image reconstruction. NATURE CHEMISTRY 20

Designing Metal-Templated de novo Protein Complexes

Designing Metal-Templated de novo Protein Complexes Designing Metal-Templated de novo Protein Complexes Xavier (Javi) I. Ambroggio RosettaCon, August 4 th 2010 More Parlor Tricks with Metals Interact dammit. What is metal-templating? 1. Starting material:

More information

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)

Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer

More information

Cryo-EM data collection, refinement and validation statistics

Cryo-EM data collection, refinement and validation statistics 1 Table S1 Cryo-EM data collection, refinement and validation statistics Data collection and processing CPSF-160 WDR33 (EMDB-7114) (PDB 6BM0) CPSF-160 WDR33 (EMDB-7113) (PDB 6BLY) CPSF-160 WDR33 CPSF-30

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1: Amplitudes of three current levels. Level 0 (pa) Level 1 (pa) Level 2 (pa) TrkA- TrkH WT 200 K 0.01 ± 0.01 9.5 ± 0.01 18.7 ± 0.03 200 Na * 0.001 ± 0.01 3.9 ± 0.01 12.5 ± 0.03 200

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

More information

type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5,

type GroEL-GroES complex. Crystals were grown in buffer D (100 mm HEPES, ph 7.5, Supplementary Material Supplementary Materials and Methods Structure Determination of SR1-GroES-ADP AlF x SR1-GroES-ADP AlF x was purified as described in Materials and Methods for the wild type GroEL-GroES

More information

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Results DNA binding property of the SRA domain was examined by an electrophoresis mobility shift assay (EMSA) using synthesized 12-bp oligonucleotide duplexes containing unmodified, hemi-methylated,

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

Supplementary Figure 1. Biochemical and sequence alignment analyses the

Supplementary Figure 1. Biochemical and sequence alignment analyses the Supplementary Figure 1. Biochemical and sequence alignment analyses the interaction of OPTN and TBK1. (a) Analytical gel filtration chromatography analysis of the interaction between TBK1 CTD and OPTN(1-119).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95

More information

Supplementary Information

Supplementary Information 1 Supplementary Information Figure S1 The V=0.5 Harker section of an anomalous difference Patterson map calculated using diffraction data from the NNQQNY crystal at 1.3 Å resolution. The position of the

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. The asymmetric unit in para-iodio-phenylalanine crystal. The 50% probability ellipsoid representation was prepared using the Mercury Software. Colors are as

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12045 Supplementary Table 1 Data collection and refinement statistics. Native Pt-SAD X-ray source SSRF BL17U SPring-8 BL41XU Wavelength (Å) 0.97947 1.07171 Space group P2 1 2 1 2 1 P2

More information

ParM filament images were extracted and from the electron micrographs and

ParM filament images were extracted and from the electron micrographs and Supplemental methods Outline of the EM reconstruction: ParM filament images were extracted and from the electron micrographs and straightened. The digitized images were corrected for the phase of the Contrast

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed

More information

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group

More information

A New Approach to EM of Helical Polymers Yields New Insights

A New Approach to EM of Helical Polymers Yields New Insights A New Approach to EM of Helical Polymers Yields New Insights Helical polymers are ubiquitous in biology Actin,, microtubules, intermediate filaments, thick filaments, viruses, bacteriophage,, flagella,

More information

Helpful resources for all X ray lectures Crystallization http://www.hamptonresearch.com under tech support: crystal growth 101 literature Spacegroup tables http://img.chem.ucl.ac.uk/sgp/mainmenu.htm Crystallography

More information

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein Acta Cryst. (2015). D71, 274-282, doi:10.1107/s1399004714025243 Supporting information Volume 71 (2015) Supporting information for article: Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08

More information

Nature Structural and Molecular Biology: doi: /nsmb.2938

Nature Structural and Molecular Biology: doi: /nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION In the format provided by the authors and unedited. DOI: 10.1038/NCHEM.2675 Real-time molecular scale observation of crystal formation Roy E. Schreiber, 1 Lothar Houben, 2 Sharon G. Wolf, 2 Gregory Leitus,

More information

SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state

SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state SUPPLEMENTARY FIGURES Structure of the cholera toxin secretion channel in its closed state Steve L. Reichow 1,3, Konstantin V. Korotkov 1,3, Wim G. J. Hol 1$ and Tamir Gonen 1,2$ 1, Department of Biochemistry

More information

Supporting Information

Supporting Information Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)

More information

Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples.

Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples. Supplementary Figure 1 Purification, SDS-PAGE and cryo-em characterization of the MCM hexamer and Cdt1 MCM heptamer samples. (a-b) SDS-PAGE analysis of the hexamer and heptamer samples. The eluted hexamer

More information

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2 Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

More information

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling. Chapter 4 Part I Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

More information

Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition

Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions. Implicated in Dimerization and Autoinhibition JBC Papers in Press. Published on November 1, 2000 as Manuscript M006502200 Crystal Structure of Fibroblast Growth Factor 9 (FGF9) Reveals Regions Implicated in Dimerization and Autoinhibition 1 Copyright

More information

Measuring quaternary structure similarity using global versus local measures.

Measuring quaternary structure similarity using global versus local measures. Supplementary Figure 1 Measuring quaternary structure similarity using global versus local measures. (a) Structural similarity of two protein complexes can be inferred from a global superposition, which

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1 Protein sequence alignment of Vibrionaceae with either a 40-residue insertion or a 44-residue insertion. Identical residues are indicated by red background.

More information

From x-ray crystallography to electron microscopy and back -- how best to exploit the continuum of structure-determination methods now available

From x-ray crystallography to electron microscopy and back -- how best to exploit the continuum of structure-determination methods now available From x-ray crystallography to electron microscopy and back -- how best to exploit the continuum of structure-determination methods now available Scripps EM course, November 14, 2007 What aspects of contemporary

More information

Three-dimensional structure of a viral genome-delivery portal vertex

Three-dimensional structure of a viral genome-delivery portal vertex Three-dimensional structure of a viral genome-delivery portal vertex Adam S. Olia 1, Peter E. Prevelige Jr. 2, John E. Johnson 3 and Gino Cingolani 4 1 Department of Biological Sciences, Purdue University,

More information

Supporting Information. Synthesis of Aspartame by Thermolysin : An X-ray Structural Study

Supporting Information. Synthesis of Aspartame by Thermolysin : An X-ray Structural Study Supporting Information Synthesis of Aspartame by Thermolysin : An X-ray Structural Study Gabriel Birrane, Balaji Bhyravbhatla, and Manuel A. Navia METHODS Crystallization. Thermolysin (TLN) from Calbiochem

More information

Crystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model.

Crystal lattice Real Space. Reflections Reciprocal Space. I. Solving Phases II. Model Building for CHEM 645. Purified Protein. Build model. I. Solving Phases II. Model Building for CHEM 645 Purified Protein Solve Phase Build model and refine Crystal lattice Real Space Reflections Reciprocal Space ρ (x, y, z) pronounced rho F hkl 2 I F (h,

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

Nature Structural & Molecular Biology: doi: /nsmb.3194

Nature Structural & Molecular Biology: doi: /nsmb.3194 Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-

More information

Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D

Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 218 Supplementary Material: Computational engineering of cellulase Cel9-68 functional

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Cryo-EM structure and model of the C. thermophilum 90S preribosome. a, Gold standard FSC curve showing the average resolution of the 90S preribosome masked and unmasked (left). FSC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11539 Supplementary Figure 1 Schematic representation of plant (A) and mammalian (B) P 2B -ATPase domain organization. Actuator (A-), nucleotide binding (N-),

More information

SUPPLEMENTARY INFORMATION. doi: /nature07461

SUPPLEMENTARY INFORMATION. doi: /nature07461 Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,

More information

Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences

Supplementary materials. Crystal structure of the carboxyltransferase domain. of acetyl coenzyme A carboxylase. Department of Biological Sciences Supplementary materials Crystal structure of the carboxyltransferase domain of acetyl coenzyme A carboxylase Hailong Zhang, Zhiru Yang, 1 Yang Shen, 1 Liang Tong Department of Biological Sciences Columbia

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11744 Supplementary Table 1. Crystallographic data collection and refinement statistics. Wild-type Se-Met-BcsA-B SmCl 3 -soaked EMTS-soaked Data collection Space

More information

A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and. Disfavors Mn Binding.

A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and. Disfavors Mn Binding. Supporting information for A Single Outer Sphere Mutation Stabilizes apo- Mn Superoxide Dismutase by 35 C and Disfavors Mn Binding. Anne-Frances Miller* and Ting Wang Department of Chemistry, University

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1: Stacking fault density is direction dependent: Illustration of the stacking fault multiplicity: lattice disorder is clearly direction specific, gradually zooming

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis Sergio de Cima, Luis M. Polo, Carmen Díez-Fernández, Ana I. Martínez, Javier

More information

Useful background reading

Useful background reading Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns

More information

Supplementary information for:

Supplementary information for: SUPPLEMETARY IFRMATI Supplementary information for: Structure of a β 1 -adrenergic G protein-coupled receptor Tony Warne, Maria J. Serrano-Vega, Jillian G. Baker#, Rouslan Moukhametzianov, Patricia C.

More information

Acta Cryst. (2017). D73, doi: /s

Acta Cryst. (2017). D73, doi: /s Acta Cryst. (2017). D73, doi:10.1107/s2059798317010932 Supporting information Volume 73 (2017) Supporting information for article: Designing better diffracting crystals of biotin carboxyl carrier protein

More information

Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat

Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Electronic Supplementary Information (ESI) for Chem. Commun. Unveiling the three- dimensional structure of the green pigment of nitrite- cured meat Jun Yi* and George B. Richter- Addo* Department of Chemistry

More information

Supplemental Figure and Movie Legends Figure S1. Time course experiments on the thermal stability of apo AT cpn-α by native PAGE (related to Figure 2B). The samples were heated, respectively, to (A) 45

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table S1 Kinetic Analyses of the AMSH-LP mutants AMSH-LP K M (μm) k cat x 10-3 (s -1 ) WT 71.8 ± 6.3 860 ± 65.4 T353A 76.8 ± 11.7 46.3 ± 3.7 F355A 58.9 ± 10.4 5.33 ± 0.30 proximal S358A 75.1

More information

Supplementary Information. Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate

Supplementary Information. Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate Supplementary Information Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate the Helical Oligomer Christopher A. Francy 1, 2, 3, Ryan W. Clinton 1, 2, 3, Chris Fröhlich 4, 5, Colleen

More information

IgE binds asymmetrically to its B cell receptor CD23

IgE binds asymmetrically to its B cell receptor CD23 Supplementary Information IgE binds asymmetrically to its B cell receptor CD23 Balvinder Dhaliwal 1*, Marie O. Y. Pang 2, Anthony H. Keeble 2,3, Louisa K. James 2,4, Hannah J. Gould 2, James M. McDonnell

More information

SI Text S1 Solution Scattering Data Collection and Analysis. SI references

SI Text S1 Solution Scattering Data Collection and Analysis. SI references SI Text S1 Solution Scattering Data Collection and Analysis. The X-ray photon energy was set to 8 kev. The PILATUS hybrid pixel array detector (RIGAKU) was positioned at a distance of 606 mm from the sample.

More information

Close agreement between the orientation dependence of hydrogen bonds observed in protein structures and quantum mechanical calculations

Close agreement between the orientation dependence of hydrogen bonds observed in protein structures and quantum mechanical calculations Close agreement between the orientation dependence of hydrogen bonds observed in protein structures and quantum mechanical calculations Alexandre V. Morozov, Tanja Kortemme, Kiril Tsemekhman, David Baker

More information

Bioinformatics. Macromolecular structure

Bioinformatics. Macromolecular structure Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain

More information

Hydrophobicity-Induced Prestaining for Protein Detection in Polyacrylamide

Hydrophobicity-Induced Prestaining for Protein Detection in Polyacrylamide Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Hydrophobicity-Induced Prestaining for Protein Detection in Polyacrylamide Gel Electrophoresis

More information

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its

More information

Protein Structure Prediction

Protein Structure Prediction Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on

More information

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins Chemistry & Biology, Volume 22 Supplemental Information Molecular Basis of Spectral Diversity in Near-Infrared Phytochrome-Based Fluorescent Proteins Daria M. Shcherbakova, Mikhail Baloban, Sergei Pletnev,

More information

Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor

Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Presented by Stephanie Lee Research Mentor: Dr. Rob Coalson Glycine Alpha 1 Receptor (GlyRa1) Member of the superfamily

More information

PROTEIN-PROTEIN DOCKING REFINEMENT USING RESTRAINT MOLECULAR DYNAMICS SIMULATIONS

PROTEIN-PROTEIN DOCKING REFINEMENT USING RESTRAINT MOLECULAR DYNAMICS SIMULATIONS TASKQUARTERLYvol.20,No4,2016,pp.353 360 PROTEIN-PROTEIN DOCKING REFINEMENT USING RESTRAINT MOLECULAR DYNAMICS SIMULATIONS MARTIN ZACHARIAS Physics Department T38, Technical University of Munich James-Franck-Str.

More information

Supplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes

Supplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes Supplementary Information The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes Xuesong Shi, a Lin Huang, b David M. J. Lilley, b Pehr B. Harbury a,c and Daniel Herschlag

More information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina

More information

Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved

Cks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic

More information

Summary of Experimental Protein Structure Determination. Key Elements

Summary of Experimental Protein Structure Determination. Key Elements Programme 8.00-8.20 Summary of last week s lecture and quiz 8.20-9.00 Structure validation 9.00-9.15 Break 9.15-11.00 Exercise: Structure validation tutorial 11.00-11.10 Break 11.10-11.40 Summary & discussion

More information

Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6

Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6 Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6 Hsuan-Liang Liu* and Chin-Wen Chen Department of Chemical Engineering and Graduate Institute

More information

X-ray Crystallography. Kalyan Das

X-ray Crystallography. Kalyan Das X-ray Crystallography Kalyan Das Electromagnetic Spectrum NMR 10 um - 10 mm 700 to 10 4 nm 400 to 700 nm 10 to 400 nm 10-1 to 10 nm 10-4 to 10-1 nm X-ray radiation was discovered by Roentgen in 1895. X-rays

More information

Supporting Information

Supporting Information Supporting Information Structural Basis of the Antiproliferative Activity of Largazole, a Depsipeptide Inhibitor of the Histone Deacetylases Kathryn E. Cole 1, Daniel P. Dowling 1,2, Matthew A. Boone 3,

More information

Raman spectroscopy study of rotated double-layer graphene: misorientation angle dependence of electronic structure

Raman spectroscopy study of rotated double-layer graphene: misorientation angle dependence of electronic structure Supplementary Material for Raman spectroscopy study of rotated double-layer graphene: misorientation angle dependence of electronic structure Kwanpyo Kim 1,2,3, Sinisa Coh 1,3, Liang Z. Tan 1,3, William

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are

More information

Supplementary information Silver (I) as DNA glue: Ag + - mediated guanine pairing revealed by removing Watson- Crick constraints

Supplementary information Silver (I) as DNA glue: Ag + - mediated guanine pairing revealed by removing Watson- Crick constraints Supplementary information Silver (I) as DNA glue: Ag + - mediated guanine pairing revealed by removing Watson- Crick constraints Steven M. Swasey [b], Leonardo Espinosa Leal [c], Olga Lopez- Acevedo [c],

More information

Macromolecular X-ray Crystallography

Macromolecular X-ray Crystallography Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection

More information

Impact of the crystallization condition on importin-β conformation

Impact of the crystallization condition on importin-β conformation Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah

More information

1. What is an ångstrom unit, and why is it used to describe molecular structures?

1. What is an ångstrom unit, and why is it used to describe molecular structures? 1. What is an ångstrom unit, and why is it used to describe molecular structures? The ångstrom unit is a unit of distance suitable for measuring atomic scale objects. 1 ångstrom (Å) = 1 10-10 m. The diameter

More information

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES

Protein Structure. W. M. Grogan, Ph.D. OBJECTIVES Protein Structure W. M. Grogan, Ph.D. OBJECTIVES 1. Describe the structure and characteristic properties of typical proteins. 2. List and describe the four levels of structure found in proteins. 3. Relate

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Scattering Lecture. February 24, 2014

Scattering Lecture. February 24, 2014 Scattering Lecture February 24, 2014 Structure Determination by Scattering Waves of radiation scattered by different objects interfere to give rise to an observable pattern! The wavelength needs to close

More information

Introduction The gramicidin A (ga) channel forms by head-to-head association of two monomers at their amino termini, one from each bilayer leaflet. Th

Introduction The gramicidin A (ga) channel forms by head-to-head association of two monomers at their amino termini, one from each bilayer leaflet. Th Abstract When conductive, gramicidin monomers are linked by six hydrogen bonds. To understand the details of dissociation and how the channel transits from a state with 6H bonds to ones with 4H bonds or

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11991 Supplementary Figure 1 - Refinement strategy for PIC intermediate assemblies by negative stain EM. The cryo-negative stain structure of free Pol II 1 (a) was used as initial reference

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1737 Supplementary Table 1 variant Description FSEC - 2B12 a FSEC - 6A1 a K d (leucine) c Leucine uptake e K (wild-type like) K (Y18F) K (TS) K (TSY) K288A mutant, lipid facing side chain

More information

Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein

Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein Supporting information Volume 71 (2015) Supporting information for article: Structure of the SPRY domain of human DDX1 helicase, a putative interaction platform within a DEAD-box protein Julian Kellner

More information

Supplementary Figures

Supplementary Figures 1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:

More information

Protein Structures: Experiments and Modeling. Patrice Koehl

Protein Structures: Experiments and Modeling. Patrice Koehl Protein Structures: Experiments and Modeling Patrice Koehl Structural Bioinformatics: Proteins Proteins: Sources of Structure Information Proteins: Homology Modeling Proteins: Ab initio prediction Proteins:

More information

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target. HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps

More information

Docking. GBCB 5874: Problem Solving in GBCB

Docking. GBCB 5874: Problem Solving in GBCB Docking Benzamidine Docking to Trypsin Relationship to Drug Design Ligand-based design QSAR Pharmacophore modeling Can be done without 3-D structure of protein Receptor/Structure-based design Molecular

More information

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent

Structural insights into Aspergillus fumigatus lectin specificity - AFL binding sites are functionally non-equivalent Acta Cryst. (2015). D71, doi:10.1107/s1399004714026595 Supporting information Volume 71 (2015) Supporting information for article: Structural insights into Aspergillus fumigatus lectin specificity - AFL

More information

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli

Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai

More information

Molecular dynamics simulations of anti-aggregation effect of ibuprofen. Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov

Molecular dynamics simulations of anti-aggregation effect of ibuprofen. Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov Biophysical Journal, Volume 98 Supporting Material Molecular dynamics simulations of anti-aggregation effect of ibuprofen Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov Supplemental

More information

Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA

Diphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten

More information

Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides

Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Destruction of Amyloid Fibrils by Graphene through Penetration and Extraction of Peptides Zaixing

More information