Measuring quaternary structure similarity using global versus local measures.
|
|
- Leo Anderson
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Measuring quaternary structure similarity using global versus local measures. (a) Structural similarity of two protein complexes can be inferred from a global superposition, which yields a global score, as was done in this work. (b) Structural similarity can also be assessed at the level of pairwise interfaces 1-14, but such information would have to be integrated to infer a global similarity measure when complexes contain multiple interfaces. For example, in the case of a tetramer with four interfaces, four similarity measures will be obtained and this number would increase further when comparing complexes with more subunits.
2 Supplementary Figure 2 Heuristic employed for superposing protein complexes. The names of the chains in a PDB files are arbitrary. For example, considering the two tetramers depicted, chains may be labeled clockwise in one PDB file but counter-clockwise in another. Thus, although two structures can be similar structurally, differences in chain order can yield a false negative result when structures are being compared. To circumvent this problem, we must infer chainchain correspondences among the structures being compared. This was achieved using a seed superposition of the two structures, which is based on chains from the first QS maximizing the TM-score with the second QS. If the QSs are similar, this seed superposition naturally places structurally equivalent chains in proximity, which made their identification possible by analysis of the aligned coordinates. We then used this mapping to re-write the coordinate files in matching chain order, and recalculated a global superposition of the complete QSs using the re-ordered coordinates. The latter provided us with the final TM-score.
3 Supplementary Figure 3 Procedure used to infer the biological significance of QSs. Each symmetry group is considered iteratively. Within each group, each QS is used to search for structural homologs. If a homologue is found, both QSs are annotated to be correct. Once all the QSs of a symmetry group have b een processed, each QS is used again to search for proteins identical in sequence but having different QSs. If found, we considered such QSs to be likely nonbiological and annotated them as such.
4 Supplementary Figure 4 Information flow involved in QSalign.
5 Supplementary Figure 5 Integrating pairwise interface information to infer biological relevance of quaternary structures. QSbio needs to compare QSs from PDB with predictions from PISA, EPPIC, and QSalign/anti-QSalign. Comparing QSs between PDB and PISA is achieved with the full QS superimposition approach described above (Figure S2). However, to compare QSs between PDB and EPPIC, we must employ a different strategy because EPPIC provides pairwise interface information (as opposed to assembly information). We therefore mapped pairwise information from EPPIC onto QSs from PDB using the following approach. First, each QS from PDB was decomposed into pairs of chains, using all pairs burying >90 Å 2. Each pair was subsequently matched to an interface group from EPPIC by structural superposition. Each interface group in EPPIC is classified as being either biological (green) or non-biological (magenta). In the case where all subunits of the QS could be linked by biological contacts, the QS was deemed to match EPPIC (example 1) and otherwise it was inferred as non-matching (example 2).
6 Supplementary Figure 6 Protein interfaces are plastic. (a) We compared interfaces of structurally similar protein complexes. We examined whether interface properties of one complex were predictive of the same property in its homologues, given different levels of sequence identity between them. (b) We first compared the interaction propensity of interfaces. Higher values indicate interfaces with a high fraction of residues normally enriched at interfaces while lower values correspond to interfaces chemically close to solvent-exposed surfaces. (c) We then compared the hydrophobicity of interface pairs, defined as the ratio of non-polar residues to the total number of interface residues. (d) Finally, we compared evolutionary conservation of interface residues relative to surface residues. Values below 1 correspond to complexes where the interface is more conserved than the surface. The right-most plot summarizes the squared correlation coefficient (R 2 ) for each property considered, calculated for pairs of proteins binned by shared sequence identity: < 30%, 30-45%, 45-60%, 60-75% and 75-90%. All properties show very low correlation values for pairs sharing less than 30% identity, showing that despite being structurally similar, interfaces can differ dramatically in their chemistry and evolutionary properties. One thousand random data points were sampled for each plot to ease visualization.
7 Supplementary Figure 7 Annotating monomers with anti-qsalign. We annotated monomers based on the enrichment of monomeric homologs over oligomeric ones. This enrichment is used to derive probabilities by the formulae above. Proteins sharing at least 30% and at most 90% sequence identity and having an overlap of 60% or more were considered as homologs.
8 Source Data Prediction details of PISA, EPPIC, QSalign/anti-QSalign and QSbio on the different datasets. (separate Excel file). Supplementary Table 1 Number of structures used in the different benchmark datasets. For benchmarks based on PiQSi annotations, methods had to predict whether a PDB structure is correct ( ) or not ( ). For benchmarks using the cgs dataset, we used two different approaches: (i) In Fig 3a, when benchmarking the prediction of monomers, the positive set consisted of 144 true monomers and the negative set contained 137 true dimers + 50 true oligomers. (ii) In Fig. 2d, a positive was counted when the prediction matched the number of subunits from cgs and a negative when it did not. The differences in the number of structures (137 vs 105, and 50 vs 57) have two origins. One is that the number of subunit information from EPPIC oligomers was not always reliable, so these structures were only used to benchmark anti-qsalign (green) where this information was not critical. A second is that only structures annotated by QSalign/anti-QSalign were used and their number differed (QSalign annotated 57 oligomers from the cgs benchmark, while anti-qsalign annotated only 50). Monomers Dimers Oligomers (>=3 subunits) Figure PiQSi Fig. 2d Fig. 3b cgs 144 n/a n/a n/a Fig. 3a, Fig. 2d Supplementary Table 2 Number of structures annotated by QSalign. The total number of redundant (R) and non-redundant structures (NR, filtered at 90% sequence identity) and annotated by each method is given. Note that QSalign also annotates monomers that should normally exist as oligomers (numbers in grey), but these are not counted when calculating the coverage. Monomers Dimer and Oligomers Total Total in PDB Coverage QSalign (R) 6,429 35,947-51,626 (ns>1) 70% QSalign (NR) 1,087 9,668-16,643 (ns>1) 58% anti-qsalign (R) anti-qsalign (NR) 46, ,872 (ns=1) 80% 8, ,292 (ns=1) 71% Combined (R) 46,877 35,947 82, ,096 75% Combined (NR) 8,687 9,668 18,355 28,848 64% 1
9 Supplementary Note Description of the QSalign, QSinfer and QSpropagate routines with pseudo-code. QSalign(PDB1): Define SUB1 = number of subunits in PDB1 Retrieve list PDB2 of potential structure matches using the following criteria: - Annotated as homo-oligomer in 3DComplex - Number of subunits = SUB1 - Structures should be homologous, as defined by any of these three conditions:(sequence identity > 0.3 & alignment overlap > 0.8) or (matching SCOP domain architecture) or (matching Pfam domain architecture) Execute KPAX between PDB1 and all retrieved structures PDB2 For PDB2_j in PDB2: Parse coordinates produced by KPAX (such that PDB2_j coordinates are now transformed to be superposed onto PDB1). Record the number of overlapping Cα between pairs of chains from PDB2_j and PDB1 Define matching chain-pairs as those with the bi-directional best scores Re-write PDB2_j with chain order matching that of PDB1. If a chain was not matched, its order is random. Executes KPAX again between PDB1 and all re-written PDB2 structures Record properties of the structural alignment into a MySQL table. Function QSinfer: Retrieve list L1 of "symmetry type (SYM) - number of subunits (SUB)" pairs, sorted in decreasing order by number of subunits For pairs (SYMi, SUBi) in L1: Retrieve list L2 of structure pairs PDB1, PDB2 that meet the following criteria, sorted by increasing sequence identity. - Symmetry == SYMi - Number of subunits == SUBi - Sequence identity < 80% - QS alignment with TM-Score > Overlap of sequence alignment > 0.65 Note: PDB2_i can be from PISA but is sorted after the match with the PDB structure if it exists For pairs (PDB1_i, PDB2_i) in L2: if PDB1_i is not already annotated: Mark PDB1_i as likely correct "Interface geometry is similar to that of PDB2_i" Mark PDB1_i as annotated if PDB2_i is not already annotated: if PDB2_i is from PDB: Mark PDB2_i as likely correct "Interface geometry is similar to that of PDB1_i" elsif PDB2_i is generated by PISA: Mark PDB2_i as likely incorrect "Interface geometry is similar to that of PDB2_i but was detected based on PISA and does not appear in the PDB assembly" Mark PDB2_i as annotated Call: QSpropagate(SYMi, SUBi) Function QSpropagate(SYMi, SUBi): Retrieve List L3 of structure pairs PDB1, PDB2 that meet the following criteria: - PDB1 is annotated as likely correct - PDB1 symmetry == SYMi - PDB1 number of subunits == SUBi - PDB2 is not yet annotated - Sequence identity between PDB1 and PDB2 > 95% For pairs (PDB1_j, PDB2_j) in L3: 2
10 Define #PDB1_j and #PDB2_j as numbers of subunits in PDB1_j and PDB2_j respectively Case 1: #PDB1_j < #PDB2_j if #PDB2_j is consistent with PDB2_j symmetry: Mark PDB2_j as ambiguous "Sequence is/are identical to PDB1_j (which is supposedly correct) but the structure is different, and it might form a higher-order oligomer" else: Mark PDB2_j as likely erroneous "Sequence is/are identical to PDB1_j (which is supposedly correct) but the structure is different, and the stoichiometry appears inconsistent with the composition and/or symmetry" Case 2: #PDB1_j > #PDB2_j Mark PDB2_j as likely erroneous "Sequence is/are identical to PDB1_j (which is supposedly correct) suggesting that interface(s) is/are missing" Case 3: #PDB1_j == #PDB2_j Mark PDB2_j as likely erroneous "Sequence is/are identical to PDB1_j (which is supposedly correct) but the structure appears to be different. This might reflect that a wrong interface was inferred in its reconstruction, but might also be caused by a large conformational change" 1 Winter, C., Henschel, A., Kim, W. K. & Schroeder, M. SCOPPI: a structural classification of proteinprotein interfaces. Nucleic acids research 34, D (2006). 2 Stein, A., Ceol, A. & Aloy, P. 3did: identification and classification of domain-based interactions of known three-dimensional structure. Nucleic acids research 39, D , doi: /nar/gkq962 (2011). 3 Aloy, P., Ceulemans, H., Stark, A. & Russell, R. B. The relationship between sequence and interaction divergence in proteins. J Mol Biol 332, (2003). 4 Shoemaker, B. A. et al. IBIS (Inferred Biomolecular Interaction Server) reports, predicts and integrates multiple types of conserved interactions for proteins. Nucleic acids research 40, D , doi: /nar/gkr997 (2012). 5 Bordner, A. J. & Gorin, A. A. Comprehensive inventory of protein complexes in the Protein Data Bank from consistent classification of interfaces. BMC Bioinformatics 9, 234, doi: / (2008). 6 Xu, Q. et al. Statistical analysis of interface similarity in crystals of homologous proteins. J Mol Biol 381, , doi: /j.jmb (2008). 7 Tsuchiya, Y., Kinoshita, K., Ito, N. & Nakamura, H. PreBI: prediction of biological interfaces of proteins in crystals. Nucleic acids research 34, W , doi: /nar/gkl267 (2006). 8 Xu, Q. & Dunbrack, R. L., Jr. The protein common interface database (ProtCID)--a comprehensive database of interactions of homologous proteins in multiple crystal forms. Nucleic acids research 39, D , doi: /nar/gkq1059 (2011). 9 Ponstingl, H., Henrick, K. & Thornton, J. M. Discriminating between homodimeric and monomeric proteins in the crystalline state. Proteins 41, (2000). 10 Faure, G., Andreani, J. & Guerois, R. InterEvol database: exploring the structure and evolution of protein complex interfaces. Nucleic acids research 40, D , doi: /nar/gkr845 (2012). 11 Davis, F. P. & Sali, A. PIBASE: a comprehensive database of structurally defined protein interfaces. Bioinformatics (Oxford, England) 21, (2005). 12 Gong, S. et al. PSIbase: a database of Protein Structural Interactome map (PSIMAP). Bioinformatics (Oxford, England) 21, (2005). 13 Lo, Y. S., Chen, Y. C. & Yang, J. M. 3D-interologs: an evolution database of physical protein- protein interactions across multiple genomes. BMC genomics 11 Suppl 3, S7, doi: / s3-s7 (2010). 14 Baskaran, K., Duarte, J. M., Biyani, N., Bliven, S. & Capitani, G. A PDB-wide, evolution-based assessment of protein-protein interfaces. BMC Struct Biol 14, 22, doi: /s (2014). 3
Statistical Analysis of Interface Similarity in Crystals of Homologous Proteins
doi:10.1016/j.jmb.2008.06.002 J. Mol. Biol. (2008) 381, 487 507 Available online at www.sciencedirect.com Statistical Analysis of Interface Similarity in Crystals of Homologous Proteins Qifang Xu 1,2,
More informationWeek 10: Homology Modelling (II) - HHpred
Week 10: Homology Modelling (II) - HHpred Course: Tools for Structural Biology Fabian Glaser BKU - Technion 1 2 Identify and align related structures by sequence methods is not an easy task All comparative
More informationCMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison
CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture
More informationPDBe TUTORIAL. PDBePISA (Protein Interfaces, Surfaces and Assemblies)
PDBe TUTORIAL PDBePISA (Protein Interfaces, Surfaces and Assemblies) http://pdbe.org/pisa/ This tutorial introduces the PDBePISA (PISA for short) service, which is a webbased interactive tool offered by
More informationAnalyzing six types of protein-protein interfaces. Yanay Ofran and Burkhard Rost
Analyzing six types of protein-protein interfaces Yanay Ofran and Burkhard Rost Goal of the paper To check 1. If there is significant difference in amino acid composition in various interfaces of protein-protein
More informationSupplementary text for the section Interactions conserved across species: can one select the conserved interactions?
1 Supporting Information: What Evidence is There for the Homology of Protein-Protein Interactions? Anna C. F. Lewis, Nick S. Jones, Mason A. Porter, Charlotte M. Deane Supplementary text for the section
More informationCS612 - Algorithms in Bioinformatics
Fall 2017 Databases and Protein Structure Representation October 2, 2017 Molecular Biology as Information Science > 12, 000 genomes sequenced, mostly bacterial (2013) > 5x10 6 unique sequences available
More informationProcheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.
Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond
More informationMapping Monomeric Threading to Protein Protein Structure Prediction
pubs.acs.org/jcim Mapping Monomeric Threading to Protein Protein Structure Prediction Aysam Guerler, Brandon Govindarajoo, and Yang Zhang* Department of Computational Medicine and Bioinformatics, University
More informationDetection of Protein Binding Sites II
Detection of Protein Binding Sites II Goal: Given a protein structure, predict where a ligand might bind Thomas Funkhouser Princeton University CS597A, Fall 2007 1hld Geometric, chemical, evolutionary
More informationSUPPLEMENTARY INFORMATION
Supplementary information S1 (box). Supplementary Methods description. Prokaryotic Genome Database Archaeal and bacterial genome sequences were downloaded from the NCBI FTP site (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/)
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/309/5742/1868/dc1 Supporting Online Material for Toward High-Resolution de Novo Structure Prediction for Small Proteins Philip Bradley, Kira M. S. Misura, David Baker*
More informationSUPPLEMENTARY INFORMATION
Supplementary information S3 (box) Methods Methods Genome weighting The currently available collection of archaeal and bacterial genomes has a highly biased distribution of isolates across taxa. For example,
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationThe true oligomerization state of a protein is often difficult to
Identification of protein oligomerization states by analysis of interface conservation Adrian H. Elcock* and J. Andrew McCammon *Department of Biochemistry, University of Iowa, Iowa City, IA 52242-1109;
More informationHomology and Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Enhanced Recognition of Transmembrane Protein Domains with Prediction-based Structural Profiles Baoqiang Cao, Aleksey Porollo, Rafal Adamczak, Mark Jarrell and Jaroslaw Meller Contact:
More informationEugene Krissinel. European Bioinformatics Institute, Genome Campus, Hinxton.
PISA... or a story about perceptions, expectations, naivety, macromolecular complexes and their complexity in bioinformatics and crystallography Eugene Krissinel Macromolecular, Genome Campus, Hinxton
More informationSUPPLEMENTARY INFORMATION
SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed
More informationPGA: A Program for Genome Annotation by Comparative Analysis of. Maximum Likelihood Phylogenies of Genes and Species
PGA: A Program for Genome Annotation by Comparative Analysis of Maximum Likelihood Phylogenies of Genes and Species Paulo Bandiera-Paiva 1 and Marcelo R.S. Briones 2 1 Departmento de Informática em Saúde
More informationAlgorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/15/07 CAP5510 1 EM Algorithm Goal: Find θ, Z that maximize Pr
More informationIntroduction to Comparative Protein Modeling. Chapter 4 Part I
Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature
More informationWe used the PSI-BLAST program (http://www.ncbi.nlm.nih.gov/blast/) to search the
SUPPLEMENTARY METHODS - in silico protein analysis We used the PSI-BLAST program (http://www.ncbi.nlm.nih.gov/blast/) to search the Protein Data Bank (PDB, http://www.rcsb.org/pdb/) and the NCBI non-redundant
More informationCISC 636 Computational Biology & Bioinformatics (Fall 2016)
CISC 636 Computational Biology & Bioinformatics (Fall 2016) Predicting Protein-Protein Interactions CISC636, F16, Lec22, Liao 1 Background Proteins do not function as isolated entities. Protein-Protein
More informationHomology Modeling. Roberto Lins EPFL - summer semester 2005
Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton,
More informationStatistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics
Statistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics Jianlin Cheng, PhD Department of Computer Science University of Missouri, Columbia
More informationProtein Structure Prediction, Engineering & Design CHEM 430
Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment
More information1. Protein Data Bank (PDB) 1. Protein Data Bank (PDB)
Protein structure databases; visualization; and classifications 1. Introduction to Protein Data Bank (PDB) 2. Free graphic software for 3D structure visualization 3. Hierarchical classification of protein
More informationRNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex
Molecular Cell, Volume 39 Supplemental Information RNA Polymerase I Contains a TFIIFRelated DNABinding Subcomplex Sebastian R. Geiger, Kristina Lorenzen, Amelie Schreieck, Patrizia Hanecker, Dirk Kostrewa,
More informationNature Structural and Molecular Biology: doi: /nsmb.2938
Supplementary Figure 1 Characterization of designed leucine-rich-repeat proteins. (a) Water-mediate hydrogen-bond network is frequently visible in the convex region of LRR crystal structures. Examples
More informationHomology. and. Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline WHAT IS HOMOLOGY? HOW TO GATHER KNOWN PROTEIN INFORMATION? HOW TO ANNOTATE PROTEIN DOMAINS? EXAMPLES AND EXERCISES Homology
More information09/06/25. Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Non-uniform distribution of folds. Scheme of protein structure predicition
Sequence identity Structural similarity Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Fold recognition Sommersemester 2009 Peter Güntert Structural similarity X Sequence identity Non-uniform
More informationHomology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB
Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded
More informationPredicting the Binding Patterns of Hub Proteins: A Study Using Yeast Protein Interaction Networks
: A Study Using Yeast Protein Interaction Networks Carson M. Andorf 1, Vasant Honavar 1,2, Taner Z. Sen 2,3,4 * 1 Department of Computer Science, Iowa State University, Ames, Iowa, United States of America,
More informationMotif Prediction in Amino Acid Interaction Networks
Motif Prediction in Amino Acid Interaction Networks Omar GACI and Stefan BALEV Abstract In this paper we represent a protein as a graph where the vertices are amino acids and the edges are interactions
More informationA profile-based protein sequence alignment algorithm for a domain clustering database
A profile-based protein sequence alignment algorithm for a domain clustering database Lin Xu,2 Fa Zhang and Zhiyong Liu 3, Key Laboratory of Computer System and architecture, the Institute of Computing
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationHuman and Server CAPRI Protein Docking Prediction Using LZerD with Combined Scoring Functions. Daisuke Kihara
Human and Server CAPRI Protein Docking Prediction Using LZerD with Combined Scoring Functions Daisuke Kihara Department of Biological Sciences Department of Computer Science Purdue University, Indiana,
More informationInsights into Protein Protein Interfaces using a Bayesian Network Prediction Method
doi:10.1016/j.jmb.2006.07.028 J. Mol. Biol. (2006) 362, 365 386 Insights into Protein Protein Interfaces using a Bayesian Network Prediction Method James R. Bradford 1, Chris J. Needham 2, Andrew J. Bulpitt
More informationProtein Structure: Data Bases and Classification Ingo Ruczinski
Protein Structure: Data Bases and Classification Ingo Ruczinski Department of Biostatistics, Johns Hopkins University Reference Bourne and Weissig Structural Bioinformatics Wiley, 2003 More References
More informationTemplate Free Protein Structure Modeling Jianlin Cheng, PhD
Template Free Protein Structure Modeling Jianlin Cheng, PhD Associate Professor Computer Science Department Informatics Institute University of Missouri, Columbia 2013 Protein Energy Landscape & Free Sampling
More informationProtein quality assessment
Protein quality assessment Speaker: Renzhi Cao Advisor: Dr. Jianlin Cheng Major: Computer Science May 17 th, 2013 1 Outline Introduction Paper1 Paper2 Paper3 Discussion and research plan Acknowledgement
More informationBuilding a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor
Building a Homology Model of the Transmembrane Domain of the Human Glycine α-1 Receptor Presented by Stephanie Lee Research Mentor: Dr. Rob Coalson Glycine Alpha 1 Receptor (GlyRa1) Member of the superfamily
More informationStructure to Function. Molecular Bioinformatics, X3, 2006
Structure to Function Molecular Bioinformatics, X3, 2006 Structural GeNOMICS Structural Genomics project aims at determination of 3D structures of all proteins: - organize known proteins into families
More informationAnalysis and Prediction of Protein Structure (I)
Analysis and Prediction of Protein Structure (I) Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 2006 Free for academic use. Copyright @ Jianlin Cheng
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationIntroduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
More informationCSCE555 Bioinformatics. Protein Function Annotation
CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the
More informationProtein Structure Prediction
Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on
More informationSupplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).
Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted
More informationMathangi Thiagarajan Rice Genome Annotation Workshop May 23rd, 2007
-2 Transcript Alignment Assembly and Automated Gene Structure Improvements Using PASA-2 Mathangi Thiagarajan mathangi@jcvi.org Rice Genome Annotation Workshop May 23rd, 2007 About PASA PASA is an open
More informationOnline Protein Structure Analysis with the Bio3D WebApp
Online Protein Structure Analysis with the Bio3D WebApp Lars Skjærven, Shashank Jariwala & Barry J. Grant August 13, 2015 (updated November 17, 2016) Bio3D1 is an established R package for structural bioinformatics
More informationProtein Science (1997), 6: Cambridge University Press. Printed in the USA. Copyright 1997 The Protein Society
1 of 5 1/30/00 8:08 PM Protein Science (1997), 6: 246-248. Cambridge University Press. Printed in the USA. Copyright 1997 The Protein Society FOR THE RECORD LPFC: An Internet library of protein family
More informationDIA-Umpire: comprehensive computational framework for data independent acquisition proteomics
DIA-Umpire: comprehensive computational framework for data independent acquisition proteomics Chih-Chiang Tsou 1,2, Dmitry Avtonomov 2, Brett Larsen 3, Monika Tucholska 3, Hyungwon Choi 4 Anne-Claude Gingras
More informationThe typical end scenario for those who try to predict protein
A method for evaluating the structural quality of protein models by using higher-order pairs scoring Gregory E. Sims and Sung-Hou Kim Berkeley Structural Genomics Center, Lawrence Berkeley National Laboratory,
More informationCOMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University
COMP 598 Advanced Computational Biology Methods & Research Introduction Jérôme Waldispühl School of Computer Science McGill University General informations (1) Office hours: by appointment Office: TR3018
More informationNumber sequence representation of protein structures based on the second derivative of a folded tetrahedron sequence
Number sequence representation of protein structures based on the second derivative of a folded tetrahedron sequence Naoto Morikawa (nmorika@genocript.com) October 7, 2006. Abstract A protein is a sequence
More information1-D Predictions. Prediction of local features: Secondary structure & surface exposure
1-D Predictions Prediction of local features: Secondary structure & surface exposure 1 Learning Objectives After today s session you should be able to: Explain the meaning and usage of the following local
More informationSubfamily HMMS in Functional Genomics. D. Brown, N. Krishnamurthy, J.M. Dale, W. Christopher, and K. Sjölander
Subfamily HMMS in Functional Genomics D. Brown, N. Krishnamurthy, J.M. Dale, W. Christopher, and K. Sjölander Pacific Symposium on Biocomputing 10:322-333(2005) SUBFAMILY HMMS IN FUNCTIONAL GENOMICS DUNCAN
More informationTemplate Free Protein Structure Modeling Jianlin Cheng, PhD
Template Free Protein Structure Modeling Jianlin Cheng, PhD Professor Department of EECS Informatics Institute University of Missouri, Columbia 2018 Protein Energy Landscape & Free Sampling http://pubs.acs.org/subscribe/archive/mdd/v03/i09/html/willis.html
More informationIdentification of Representative Protein Sequence and Secondary Structure Prediction Using SVM Approach
Identification of Representative Protein Sequence and Secondary Structure Prediction Using SVM Approach Prof. Dr. M. A. Mottalib, Md. Rahat Hossain Department of Computer Science and Information Technology
More informationBayesian Models and Algorithms for Protein Beta-Sheet Prediction
0 Bayesian Models and Algorithms for Protein Beta-Sheet Prediction Zafer Aydin, Student Member, IEEE, Yucel Altunbasak, Senior Member, IEEE, and Hakan Erdogan, Member, IEEE Abstract Prediction of the three-dimensional
More informationUsing Phase for Pharmacophore Modelling. 5th European Life Science Bootcamp March, 2017
Using Phase for Pharmacophore Modelling 5th European Life Science Bootcamp March, 2017 Phase: Our Pharmacohore generation tool Significant improvements to Phase methods in 2016 New highly interactive interface
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationFrancisco Melo, Damien Devos, Eric Depiereux and Ernest Feytmans
From: ISMB-97 Proceedings. Copyright 1997, AAAI (www.aaai.org). All rights reserved. ANOLEA: A www Server to Assess Protein Structures Francisco Melo, Damien Devos, Eric Depiereux and Ernest Feytmans Facultés
More informationBioinformatics. Proteins II. - Pattern, Profile, & Structure Database Searching. Robert Latek, Ph.D. Bioinformatics, Biocomputing
Bioinformatics Proteins II. - Pattern, Profile, & Structure Database Searching Robert Latek, Ph.D. Bioinformatics, Biocomputing WIBR Bioinformatics Course, Whitehead Institute, 2002 1 Proteins I.-III.
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationStructure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits. AhpC and AhpF from Escherichia coli
Structure, mechanism and ensemble formation of the Alkylhydroperoxide Reductase subunits AhpC and AhpF from Escherichia coli Phat Vinh Dip 1,#, Neelagandan Kamariah 2,#, Malathy Sony Subramanian Manimekalai
More informationA New Similarity Measure among Protein Sequences
A New Similarity Measure among Protein Sequences Kuen-Pin Wu, Hsin-Nan Lin, Ting-Yi Sung and Wen-Lian Hsu * Institute of Information Science Academia Sinica, Taipei 115, Taiwan Abstract Protein sequence
More informationUsing Ensembles of Hidden Markov Models for Grand Challenges in Bioinformatics
Using Ensembles of Hidden Markov Models for Grand Challenges in Bioinformatics Tandy Warnow Founder Professor of Engineering The University of Illinois at Urbana-Champaign http://tandy.cs.illinois.edu
More informationPREDICTION OF PROTEIN BINDING SITES BY COMBINING SEVERAL METHODS
PREDICTION OF PROTEIN BINDING SITES BY COMBINING SEVERAL METHODS T. Z. SEN, A. KLOCZKOWSKI, R. L. JERNIGAN L.H. Baker Center for Bioinformatics and Biological Statistics, Iowa State University Ames, IA
More informationSupplemental Figure and Movie Legends Figure S1. Time course experiments on the thermal stability of apo AT cpn-α by native PAGE (related to Figure 2B). The samples were heated, respectively, to (A) 45
More informationProtein structure alignments
Protein structure alignments Proteins that fold in the same way, i.e. have the same fold are often homologs. Structure evolves slower than sequence Sequence is less conserved than structure If BLAST gives
More information2 Dean C. Adams and Gavin J. P. Naylor the best three-dimensional ordination of the structure space is found through an eigen-decomposition (correspon
A Comparison of Methods for Assessing the Structural Similarity of Proteins Dean C. Adams and Gavin J. P. Naylor? Dept. Zoology and Genetics, Iowa State University, Ames, IA 50011, U.S.A. 1 Introduction
More informationWataru Nemoto 1,2* and Hiroyuki Toh 1
Nemoto and Toh BMC Structural Biology 2012, 12:11 RESEARCH ARTICLE Open Access Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating
More informationProtein structure analysis. Risto Laakso 10th January 2005
Protein structure analysis Risto Laakso risto.laakso@hut.fi 10th January 2005 1 1 Summary Various methods of protein structure analysis were examined. Two proteins, 1HLB (Sea cucumber hemoglobin) and 1HLM
More informationSUPPLEMENTARY INFORMATION
www.nature.com/nature 1 Figure S1 Sequence alignment. a Structure based alignment of the plgic of E. chrysanthemi (ELIC), the acetylcholine binding protein from the snail Lymnea stagnalis (AchBP, PDB code
More informationSequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5
Sequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5 Why Look at More Than One Sequence? 1. Multiple Sequence Alignment shows patterns of conservation 2. What and how many
More informationHelpful resources for all X ray lectures Crystallization http://www.hamptonresearch.com under tech support: crystal growth 101 literature Spacegroup tables http://img.chem.ucl.ac.uk/sgp/mainmenu.htm Crystallography
More informationPredicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1: Data collection, phasing and refinement statistics ChbC/Ta 6 Br 12 Native ChbC Data collection Space group P4 3 2 1 2 P4 3 2 1 2 Cell dimensions a, c (Å) 132.75, 453.57 132.81, 452.95
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationIn-Depth Assessment of Local Sequence Alignment
2012 International Conference on Environment Science and Engieering IPCBEE vol.3 2(2012) (2012)IACSIT Press, Singapoore In-Depth Assessment of Local Sequence Alignment Atoosa Ghahremani and Mahmood A.
More informationEBI web resources II: Ensembl and InterPro. Yanbin Yin Spring 2013
EBI web resources II: Ensembl and InterPro Yanbin Yin Spring 2013 1 Outline Intro to genome annotation Protein family/domain databases InterPro, Pfam, Superfamily etc. Genome browser Ensembl Hands on Practice
More informationSequence Alignment: A General Overview. COMP Fall 2010 Luay Nakhleh, Rice University
Sequence Alignment: A General Overview COMP 571 - Fall 2010 Luay Nakhleh, Rice University Life through Evolution All living organisms are related to each other through evolution This means: any pair of
More information7.91 Amy Keating. Solving structures using X-ray crystallography & NMR spectroscopy
7.91 Amy Keating Solving structures using X-ray crystallography & NMR spectroscopy How are X-ray crystal structures determined? 1. Grow crystals - structure determination by X-ray crystallography relies
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinff18.html Proteins and Protein Structure
More informationProtein-protein Interaction Prediction using Desolvation Energies and Interface Properties
200 IEEE International Conference on Bioinformatics and Biomedicine Protein-protein Interaction Prediction using Desolvation Energies and Interface Properties Luis Rueda, Sridip Banerjee, Md. Mominul Aziz,
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the
More informationCan protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU
Can protein model accuracy be identified? Morten Nielsen, CBS, BioCentrum, DTU NO! Identification of Protein-model accuracy Why is it important? What is accuracy RMSD, fraction correct, Protein model correctness/quality
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationChristian Sigrist. November 14 Protein Bioinformatics: Sequence-Structure-Function 2018 Basel
Christian Sigrist General Definition on Conserved Regions Conserved regions in proteins can be classified into 5 different groups: Domains: specific combination of secondary structures organized into a
More informationComputational Analysis of the Fungal and Metazoan Groups of Heat Shock Proteins
Computational Analysis of the Fungal and Metazoan Groups of Heat Shock Proteins Introduction: Benjamin Cooper, The Pennsylvania State University Advisor: Dr. Hugh Nicolas, Biomedical Initiative, Carnegie
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Cryo-EM structure and model of the C. thermophilum 90S preribosome. a, Gold standard FSC curve showing the average resolution of the 90S preribosome masked and unmasked (left). FSC
More informationIntroduction to Bioinformatics Online Course: IBT
Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec1 Building a Multiple Sequence Alignment Learning Outcomes 1- Understanding Why multiple
More informationHomology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6
Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6 Hsuan-Liang Liu* and Chin-Wen Chen Department of Chemical Engineering and Graduate Institute
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 SUMOylation of proteins changes drastically upon heat shock, MG-132 treatment and PR-619 treatment. (a) Schematic overview of all SUMOylation proteins identified to be differentially
More information