Can protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU

Size: px
Start display at page:

Download "Can protein model accuracy be. identified? NO! CBS, BioCentrum, Morten Nielsen, DTU"

Transcription

1 Can protein model accuracy be identified? Morten Nielsen, CBS, BioCentrum, DTU NO!

2 Identification of Protein-model accuracy Why is it important? What is accuracy RMSD, fraction correct, Protein model correctness/quality Procheck, Whatif, ProsaII, Verify3d Prediction of protein model accuracy ProQ server

3 Why is it so important Reliable fold recognition P-value, E-value, Z-score Tells you if you should believe in the fold!! Alignment (model construction) No obvious method to estimate reliability of alignment Number of gaps, length of gaps Amino acids in protein core and loops % id is too conservative Many low homology models are accurate, and some high homology model are wrong Correct fold, wrong alignment => Terrible model How to gain confidence in a protein model?

4 Model accuracy. Swiss-model models sharing 25-95% sequence identity with the submitted sequences (

5 What is protein model accuracy Model quality (correctness) Does the model look like a protein? Hydrophobic residues in core, hydrophilic on surface Backbone geometry (phi/psi angles, bond-length) Amino acid environment A correct model can be completely wrong Accuracy (if we know the answer) RMSD Fraction of correct modeled residues

6 Model accuracy Rmsd = sqrt(1/n S (d ij ) 2 ) Fraction correct = N c /N Nc = number correct Blue model Yellow structure d ij

7 Evaluation of model quality Check for proper protein stereochemistry ProCheck ( Ramachandran plot, bond-length, Whatif ( Packing quality Both web-servers Fitness of sequence to structure ProsaII ( Program runs on Linux and Unix Verify3D ( Web-server

8 Amino acid environment of different protein sequences different solved protein structures 600 different protein folds Typical amino acid environment Sequence space large Structure space small

9 CaNCCa y, f = -60 degrees b strand Dihedral angles y, f y, f = 180 degrees Peptide planes Peptide backbone geometry l l l l a helix From speedy.st-and.ac.uk/.../lectures/ 3014/lecture/dars1.htm

10 Ramachandran plot B. Beta strand A. Right handed helix L. Left handed helix Color coding White. Disallowed Red. Most favorable Yellow. Allowed region Glycine triangles A B L

11 Wrong structure 1RIP Ribosomal protein. NMR structure in PDB database 17- Aug, 1993

12 Procheck. Bond length

13

14 What-if. Fine packing Quality Statistical description of local chemical environment in high quality protein structures Superimpose tryptophans and find average local environment. Same for other amino acids Full atom model G. Vriend and C. Sander, 1992

15 Example. Casp Model T0133 T0133 Casp5 target Modeled by X3M (Lund, O., 2002) RMSD=7.3

16 Casp Model - Fine packing quality ---Residue----- State AllAll BB-BB BB-SC SC-BB SC-SC ILE ( 33 ) SER ( 34 ) ALA ( 296 ) GLU ( 297 ) HIS ( 298 ) ============================================================ All contacts : Average = Z-score = BB-BB contacts : Average = Z-score = BB-SC contacts : Average = Z-score = SC-BB contacts : Average = Z-score = SC-SC contacts : Average = Z-score = ============================================================ Average protein values ("Z-score for all contacts") can be read as follows: -5.0 Guaranteed wrong structure. Bad structure or poor model -3.0 Probably bad structure or unrefined model. Doubtful structure or model -2.0 Structure OK or good model. Good structures 0.0 Good structures. 2.0 Good structures. Unusually Good structures 4.0 Probably a strange model of a perfect helix Bad model

17 T0133 structure - Fine packing quality ---Residue----- State AllAll BB-BB BB-SC SC-BB SC-SC ILE ( 33 ) A SER ( 34 ) A ALA ( 296 ) A GLU ( 297 ) A HIS ( 298 ) A ============================================================ All contacts : Average = Z-score = BB-BB contacts : Average = Z-score = BB-SC contacts : Average = Z-score = 0.90 SC-BB contacts : Average = Z-score = SC-SC contacts : Average = Z-score = 0.02 ============================================================ Average protein values ("Z-score for all contacts") can be read as follows: -5.0 Guaranteed wrong structure. Bad structure or poor model -3.0 Probably bad structure or unrefined model. Doubtful structure or model -2.0 Structure OK or good model. Good structures 0.0 Good structures. 2.0 Good structures. Unusually Good structures 4.0 Probably a strange model of a perfect helix Good model

18 ProsaII (Potential of Mean Force) Likelihood of amino acid packing Exposure potential for D Method developed by Manfred Sippl., 1993 Works for Ca-models For high quality protein structure estimate nearest neighbor counts for all aa E = -log(p(n a)/p(n)) Hydrophobic residues tend to have many neighbors (buried) Hydrophilic residues tend to have fewer N (exposed) Sippl, J.M. (1990) J. Mol. Biol. 213, (1990).

19 ProsaII (Potential of Mean Force) Likelihood of amino acid packing Pair potential for D, E. s=3 E = - log(p(r abs)/p(r s)) s a b r Sippl, J.M. (1990) J. Mol. Biol. 213, (1990).

20 Verify 3D (Eisenberg et al. 1997) Closely related to ProsaII exposure potential. How well does aa fit its local environment (hydrophobic/hydrophilic) T0133 Casp5 target Modeled by X3M (Lund, O., 2002) RMSD=7.3 Red: Crystal structure, Blue: Model

21 Sequence has poor match to structure Model T0133. Verify 3D

22 ProQ. Prediction of Model accuracy Neural network to identify correct protein models. B. Wallner and Arne Elofsson, Input, a pdb structure/model Output, accuracy measure LGscore Maxsub score

23 ProQ Input to neural net Atom-atom contacts C, N, O How often is C in contact with N? Residue-residue contacts How ofter is E in contact with D? Solvent accessibility surface Average exposure of L s Secondary structure prediction How consistent is prediction with model?

24 Casp model T0113

25 Structure 1RIP

26 LifeBench data Models 220 targets Modeled by Pcons Incorrect model Lgscore <1.5 Maxsub < 0.1

27 Conclusions Correct protein models cannot reliably be identified!! Protein fold on the other hand can! Many methods from the protein crystallography world are useful to identify wrong models Bad models can pass all filters ProQ is a first attempt of an accurary prediction server Can integrate information from many sources Future will show if this approach can provide reliable prediction of model accuracy

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB

Homology Modeling (Comparative Structure Modeling) GBCB 5874: Problem Solving in GBCB Homology Modeling (Comparative Structure Modeling) Aims of Structural Genomics High-throughput 3D structure determination and analysis To determine or predict the 3D structures of all the proteins encoded

More information

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target.

HOMOLOGY MODELING. The sequence alignment and template structure are then used to produce a structural model of the target. HOMOLOGY MODELING Homology modeling, also known as comparative modeling of protein refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental

More information

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Introduction to Comparative Protein Modeling. Chapter 4 Part I Introduction to Comparative Protein Modeling Chapter 4 Part I 1 Information on Proteins Each modeling study depends on the quality of the known experimental data. Basis of the model Search in the literature

More information

Protein Structure Prediction

Protein Structure Prediction Page 1 Protein Structure Prediction Russ B. Altman BMI 214 CS 274 Protein Folding is different from structure prediction --Folding is concerned with the process of taking the 3D shape, usually based on

More information

Protein Structures: Experiments and Modeling. Patrice Koehl

Protein Structures: Experiments and Modeling. Patrice Koehl Protein Structures: Experiments and Modeling Patrice Koehl Structural Bioinformatics: Proteins Proteins: Sources of Structure Information Proteins: Homology Modeling Proteins: Ab initio prediction Proteins:

More information

Identification of correct regions in protein models using structural, alignment, and consensus information

Identification of correct regions in protein models using structural, alignment, and consensus information Identification of correct regions in protein models using structural, alignment, and consensus information BJO RN WALLNER AND ARNE ELOFSSON Stockholm Bioinformatics Center, Stockholm University, SE-106

More information

Modeling for 3D structure prediction

Modeling for 3D structure prediction Modeling for 3D structure prediction What is a predicted structure? A structure that is constructed using as the sole source of information data obtained from computer based data-mining. However, mixing

More information

Neural Networks for Protein Structure Prediction Brown, JMB CS 466 Saurabh Sinha

Neural Networks for Protein Structure Prediction Brown, JMB CS 466 Saurabh Sinha Neural Networks for Protein Structure Prediction Brown, JMB 1999 CS 466 Saurabh Sinha Outline Goal is to predict secondary structure of a protein from its sequence Artificial Neural Network used for this

More information

Protein Modeling. Generating, Evaluating and Refining Protein Homology Models

Protein Modeling. Generating, Evaluating and Refining Protein Homology Models Protein Modeling Generating, Evaluating and Refining Protein Homology Models Troy Wymore and Kristen Messinger Biomedical Initiatives Group Pittsburgh Supercomputing Center Homology Modeling of Proteins

More information

Basics of protein structure

Basics of protein structure Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu

More information

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION

THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure

More information

Building 3D models of proteins

Building 3D models of proteins Building 3D models of proteins Why make a structural model for your protein? The structure can provide clues to the function through structural similarity with other proteins With a structure it is easier

More information

Steps in protein modelling. Structure prediction, fold recognition and homology modelling. Basic principles of protein structure

Steps in protein modelling. Structure prediction, fold recognition and homology modelling. Basic principles of protein structure Structure prediction, fold recognition and homology modelling Marjolein Thunnissen Lund September 2012 Steps in protein modelling 3-D structure known Comparative Modelling Sequence of interest Similarity

More information

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics.

Procheck output. Bond angles (Procheck) Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics. Structure verification and validation Bond lengths (Procheck) Introduction to Bioinformatics Iosif Vaisman Email: ivaisman@gmu.edu ----------------------------------------------------------------- Bond

More information

Physiochemical Properties of Residues

Physiochemical Properties of Residues Physiochemical Properties of Residues Various Sources C N Cα R Slide 1 Conformational Propensities Conformational Propensity is the frequency in which a residue adopts a given conformation (in a polypeptide)

More information

Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues

Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues Programme 8.00-8.20 Last week s quiz results + Summary 8.20-9.00 Fold recognition 9.00-9.15 Break 9.15-11.20 Exercise: Modelling remote homologues 11.20-11.40 Summary & discussion 11.40-12.00 Quiz 1 Feedback

More information

Protein Structure Prediction, Engineering & Design CHEM 430

Protein Structure Prediction, Engineering & Design CHEM 430 Protein Structure Prediction, Engineering & Design CHEM 430 Eero Saarinen The free energy surface of a protein Protein Structure Prediction & Design Full Protein Structure from Sequence - High Alignment

More information

Analysis and Prediction of Protein Structure (I)

Analysis and Prediction of Protein Structure (I) Analysis and Prediction of Protein Structure (I) Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 2006 Free for academic use. Copyright @ Jianlin Cheng

More information

114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009

114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009 114 Grundlagen der Bioinformatik, SS 09, D. Huson, July 6, 2009 9 Protein tertiary structure Sources for this chapter, which are all recommended reading: D.W. Mount. Bioinformatics: Sequences and Genome

More information

Molecular Modeling Lecture 7. Homology modeling insertions/deletions manual realignment

Molecular Modeling Lecture 7. Homology modeling insertions/deletions manual realignment Molecular Modeling 2018-- Lecture 7 Homology modeling insertions/deletions manual realignment Homology modeling also called comparative modeling Sequences that have similar sequence have similar structure.

More information

Homology Modeling I. Growth of the Protein Data Bank PDB. Basel, September 30, EMBnet course: Introduction to Protein Structure Bioinformatics

Homology Modeling I. Growth of the Protein Data Bank PDB. Basel, September 30, EMBnet course: Introduction to Protein Structure Bioinformatics Swiss Institute of Bioinformatics EMBnet course: Introduction to Protein Structure Bioinformatics Homology Modeling I Basel, September 30, 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute

More information

Protein structure analysis. Risto Laakso 10th January 2005

Protein structure analysis. Risto Laakso 10th January 2005 Protein structure analysis Risto Laakso risto.laakso@hut.fi 10th January 2005 1 1 Summary Various methods of protein structure analysis were examined. Two proteins, 1HLB (Sea cucumber hemoglobin) and 1HLM

More information

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748

Giri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748 CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/15/07 CAP5510 1 EM Algorithm Goal: Find θ, Z that maximize Pr

More information

Statistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics

Statistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics Statistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics Jianlin Cheng, PhD Department of Computer Science University of Missouri, Columbia

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Tertiary Structure Prediction CMPS 6630: Introduction to Computational Biology and Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the

More information

CMPS 3110: Bioinformatics. Tertiary Structure Prediction

CMPS 3110: Bioinformatics. Tertiary Structure Prediction CMPS 3110: Bioinformatics Tertiary Structure Prediction Tertiary Structure Prediction Why Should Tertiary Structure Prediction Be Possible? Molecules obey the laws of physics! Conformation space is finite

More information

Useful background reading

Useful background reading Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns

More information

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE

Examples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

Protein Modeling Methods. Knowledge. Protein Modeling Methods. Fold Recognition. Knowledge-based methods. Introduction to Bioinformatics

Protein Modeling Methods. Knowledge. Protein Modeling Methods. Fold Recognition. Knowledge-based methods. Introduction to Bioinformatics Protein Modeling Methods Introduction to Bioinformatics Iosif Vaisman Ab initio methods Energy-based methods Knowledge-based methods Email: ivaisman@gmu.edu Protein Modeling Methods Ab initio methods:

More information

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted

More information

CAP 5510 Lecture 3 Protein Structures

CAP 5510 Lecture 3 Protein Structures CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity

More information

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison

CMPS 6630: Introduction to Computational Biology and Bioinformatics. Structure Comparison CMPS 6630: Introduction to Computational Biology and Bioinformatics Structure Comparison Protein Structure Comparison Motivation Understand sequence and structure variability Understand Domain architecture

More information

Sequence analysis and comparison

Sequence analysis and comparison The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species

More information

Protein Structure Prediction and Display

Protein Structure Prediction and Display Protein Structure Prediction and Display Goal Take primary structure (sequence) and, using rules derived from known structures, predict the secondary structure that is most likely to be adopted by each

More information

Summary of Experimental Protein Structure Determination. Key Elements

Summary of Experimental Protein Structure Determination. Key Elements Programme 8.00-8.20 Summary of last week s lecture and quiz 8.20-9.00 Structure validation 9.00-9.15 Break 9.15-11.00 Exercise: Structure validation tutorial 11.00-11.10 Break 11.10-11.40 Summary & discussion

More information

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche

Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its

More information

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27 Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

More information

7.91 Amy Keating. Solving structures using X-ray crystallography & NMR spectroscopy

7.91 Amy Keating. Solving structures using X-ray crystallography & NMR spectroscopy 7.91 Amy Keating Solving structures using X-ray crystallography & NMR spectroscopy How are X-ray crystal structures determined? 1. Grow crystals - structure determination by X-ray crystallography relies

More information

Protein structure (and biomolecular structure more generally) CS/CME/BioE/Biophys/BMI 279 Sept. 28 and Oct. 3, 2017 Ron Dror

Protein structure (and biomolecular structure more generally) CS/CME/BioE/Biophys/BMI 279 Sept. 28 and Oct. 3, 2017 Ron Dror Protein structure (and biomolecular structure more generally) CS/CME/BioE/Biophys/BMI 279 Sept. 28 and Oct. 3, 2017 Ron Dror Please interrupt if you have questions, and especially if you re confused! Assignment

More information

Molecular Modeling. Prediction of Protein 3D Structure from Sequence. Vimalkumar Velayudhan. May 21, 2007

Molecular Modeling. Prediction of Protein 3D Structure from Sequence. Vimalkumar Velayudhan. May 21, 2007 Molecular Modeling Prediction of Protein 3D Structure from Sequence Vimalkumar Velayudhan Jain Institute of Vocational and Advanced Studies May 21, 2007 Vimalkumar Velayudhan Molecular Modeling 1/23 Outline

More information

Protein structure. Protein structure. Amino acid residue. Cell communication channel. Bioinformatics Methods

Protein structure. Protein structure. Amino acid residue. Cell communication channel. Bioinformatics Methods Cell communication channel Bioinformatics Methods Iosif Vaisman Email: ivaisman@gmu.edu SEQUENCE STRUCTURE DNA Sequence Protein Sequence Protein Structure Protein structure ATGAAATTTGGAAACTTCCTTCTCACTTATCAGCCACCT...

More information

Protein Structure Determination

Protein Structure Determination Protein Structure Determination Given a protein sequence, determine its 3D structure 1 MIKLGIVMDP IANINIKKDS SFAMLLEAQR RGYELHYMEM GDLYLINGEA 51 RAHTRTLNVK QNYEEWFSFV GEQDLPLADL DVILMRKDPP FDTEFIYATY 101

More information

Packing of Secondary Structures

Packing of Secondary Structures 7.88 Lecture Notes - 4 7.24/7.88J/5.48J The Protein Folding and Human Disease Professor Gossard Retrieving, Viewing Protein Structures from the Protein Data Base Helix helix packing Packing of Secondary

More information

CS612 - Algorithms in Bioinformatics

CS612 - Algorithms in Bioinformatics Fall 2017 Protein Structure Detection Methods October 30, 2017 Comparative Modeling Comparative modeling is modeling of the unknown based on comparison to what is known In the context of modeling or computing

More information

Protein Structures. 11/19/2002 Lecture 24 1

Protein Structures. 11/19/2002 Lecture 24 1 Protein Structures 11/19/2002 Lecture 24 1 All 3 figures are cartoons of an amino acid residue. 11/19/2002 Lecture 24 2 Peptide bonds in chains of residues 11/19/2002 Lecture 24 3 Angles φ and ψ in the

More information

SCOP. all-β class. all-α class, 3 different folds. T4 endonuclease V. 4-helical cytokines. Globin-like

SCOP. all-β class. all-α class, 3 different folds. T4 endonuclease V. 4-helical cytokines. Globin-like SCOP all-β class 4-helical cytokines T4 endonuclease V all-α class, 3 different folds Globin-like TIM-barrel fold α/β class Profilin-like fold α+β class http://scop.mrc-lmb.cam.ac.uk/scop CATH Class, Architecture,

More information

Protein structures and comparisons ndrew Torda Bioinformatik, Mai 2008

Protein structures and comparisons ndrew Torda Bioinformatik, Mai 2008 Protein structures and comparisons ndrew Torda 67.937 Bioinformatik, Mai 2008 Ultimate aim how to find out the most about a protein what you can get from sequence and structure information On the way..

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

Template Based Protein Structure Modeling Jianlin Cheng, PhD

Template Based Protein Structure Modeling Jianlin Cheng, PhD Template Based Protein Structure Modeling Jianlin Cheng, PhD Professor Department of EECS Informatics Institute University of Missouri, Columbia 2018 Sequence, Structure and Function AGCWY Cell Protein

More information

1-D Predictions. Prediction of local features: Secondary structure & surface exposure

1-D Predictions. Prediction of local features: Secondary structure & surface exposure 1-D Predictions Prediction of local features: Secondary structure & surface exposure 1 Learning Objectives After today s session you should be able to: Explain the meaning and usage of the following local

More information

Week 10: Homology Modelling (II) - HHpred

Week 10: Homology Modelling (II) - HHpred Week 10: Homology Modelling (II) - HHpred Course: Tools for Structural Biology Fabian Glaser BKU - Technion 1 2 Identify and align related structures by sequence methods is not an easy task All comparative

More information

Protein Secondary Structure Prediction

Protein Secondary Structure Prediction Protein Secondary Structure Prediction Doug Brutlag & Scott C. Schmidler Overview Goals and problem definition Existing approaches Classic methods Recent successful approaches Evaluating prediction algorithms

More information

IT og Sundhed 2010/11

IT og Sundhed 2010/11 IT og Sundhed 2010/11 Sequence based predictors. Secondary structure and surface accessibility Bent Petersen 13 January 2011 1 NetSurfP Real Value Solvent Accessibility predictions with amino acid associated

More information

Copyright Mark Brandt, Ph.D A third method, cryogenic electron microscopy has seen increasing use over the past few years.

Copyright Mark Brandt, Ph.D A third method, cryogenic electron microscopy has seen increasing use over the past few years. Structure Determination and Sequence Analysis The vast majority of the experimentally determined three-dimensional protein structures have been solved by one of two methods: X-ray diffraction and Nuclear

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinff18.html Proteins and Protein Structure

More information

Protein structure alignments

Protein structure alignments Protein structure alignments Proteins that fold in the same way, i.e. have the same fold are often homologs. Structure evolves slower than sequence Sequence is less conserved than structure If BLAST gives

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Homology Modeling. Roberto Lins EPFL - summer semester 2005

Homology Modeling. Roberto Lins EPFL - summer semester 2005 Homology Modeling Roberto Lins EPFL - summer semester 2005 Disclaimer: course material is mainly taken from: P.E. Bourne & H Weissig, Structural Bioinformatics; C.A. Orengo, D.T. Jones & J.M. Thornton,

More information

Get familiar with PDBsum and the PDB Extract atomic coordinates from protein data files Compute bond angles and dihedral angles

Get familiar with PDBsum and the PDB Extract atomic coordinates from protein data files Compute bond angles and dihedral angles CS483 Assignment #2 Due date: Mar. 1 at the start of class. Protein Geometry Bedbug spit? Just say NO! Purpose of this assignment Get familiar with PDBsum and the PDB Extract atomic coordinates from protein

More information

Orientational degeneracy in the presence of one alignment tensor.

Orientational degeneracy in the presence of one alignment tensor. Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two

More information

Properties of amino acids in proteins

Properties of amino acids in proteins Properties of amino acids in proteins one of the primary roles of DNA (but not the only one!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids repeated

More information

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS SUPPLEMENTARY MATERIALS Enhanced Recognition of Transmembrane Protein Domains with Prediction-based Structural Profiles Baoqiang Cao, Aleksey Porollo, Rafal Adamczak, Mark Jarrell and Jaroslaw Meller Contact:

More information

Computational Molecular Biology. Protein Structure and Homology Modeling

Computational Molecular Biology. Protein Structure and Homology Modeling Computational Molecular Biology Protein Structure and Homology Modeling Prof. Alejandro Giorge1 Dr. Francesco Musiani Sequence, function and structure relationships v Life is the ability to metabolize

More information

Model Mélange. Physical Models of Peptides and Proteins

Model Mélange. Physical Models of Peptides and Proteins Model Mélange Physical Models of Peptides and Proteins In the Model Mélange activity, you will visit four different stations each featuring a variety of different physical models of peptides or proteins.

More information

Contact map guided ab initio structure prediction

Contact map guided ab initio structure prediction Contact map guided ab initio structure prediction S M Golam Mortuza Postdoctoral Research Fellow I-TASSER Workshop 2017 North Carolina A&T State University, Greensboro, NC Outline Ab initio structure prediction:

More information

09/06/25. Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Non-uniform distribution of folds. Scheme of protein structure predicition

09/06/25. Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Non-uniform distribution of folds. Scheme of protein structure predicition Sequence identity Structural similarity Computergestützte Strukturbiologie (Strukturelle Bioinformatik) Fold recognition Sommersemester 2009 Peter Güntert Structural similarity X Sequence identity Non-uniform

More information

Template Free Protein Structure Modeling Jianlin Cheng, PhD

Template Free Protein Structure Modeling Jianlin Cheng, PhD Template Free Protein Structure Modeling Jianlin Cheng, PhD Associate Professor Computer Science Department Informatics Institute University of Missouri, Columbia 2013 Protein Energy Landscape & Free Sampling

More information

Protein quality assessment

Protein quality assessment Protein quality assessment Speaker: Renzhi Cao Advisor: Dr. Jianlin Cheng Major: Computer Science May 17 th, 2013 1 Outline Introduction Paper1 Paper2 Paper3 Discussion and research plan Acknowledgement

More information

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror

Protein structure prediction. CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror Protein structure prediction CS/CME/BioE/Biophys/BMI 279 Oct. 10 and 12, 2017 Ron Dror 1 Outline Why predict protein structure? Can we use (pure) physics-based methods? Knowledge-based methods Two major

More information

Protein Structure Prediction

Protein Structure Prediction Protein Structure Prediction Michael Feig MMTSB/CTBP 2006 Summer Workshop From Sequence to Structure SEALGDTIVKNA Ab initio Structure Prediction Protocol Amino Acid Sequence Conformational Sampling to

More information

The Structure and Functions of Proteins

The Structure and Functions of Proteins Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science and Engineering 2003 The Structure and Functions of Proteins Dan E. Krane Wright State University

More information

Bioinformatics Practical for Biochemists

Bioinformatics Practical for Biochemists Bioinformatics Practical for Biochemists Andrei Lupas, Birte Höcker, Steffen Schmidt WS 2013/14 03. Sequence Features Targeting proteins signal peptide targets proteins to the secretory pathway N-terminal

More information

Dihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769

Dihedral Angles. Homayoun Valafar. Department of Computer Science and Engineering, USC 02/03/10 CSCE 769 Dihedral Angles Homayoun Valafar Department of Computer Science and Engineering, USC The precise definition of a dihedral or torsion angle can be found in spatial geometry Angle between to planes Dihedral

More information

Supersecondary Structures (structural motifs)

Supersecondary Structures (structural motifs) Supersecondary Structures (structural motifs) Various Sources Slide 1 Supersecondary Structures (Motifs) Supersecondary Structures (Motifs): : Combinations of secondary structures in specific geometric

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

Sequence Bioinformatics. Multiple Sequence Alignment Waqas Nasir

Sequence Bioinformatics. Multiple Sequence Alignment Waqas Nasir Sequence Bioinformatics Multiple Sequence Alignment Waqas Nasir 2010-11-12 Multiple Sequence Alignment One amino acid plays coy; a pair of homologous sequences whisper; many aligned sequences shout out

More information

Number sequence representation of protein structures based on the second derivative of a folded tetrahedron sequence

Number sequence representation of protein structures based on the second derivative of a folded tetrahedron sequence Number sequence representation of protein structures based on the second derivative of a folded tetrahedron sequence Naoto Morikawa (nmorika@genocript.com) October 7, 2006. Abstract A protein is a sequence

More information

Homology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana

Homology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana www.bioinformation.net Hypothesis Volume 6(3) Homology modeling of Ferredoxin-nitrite reductase from Arabidopsis thaliana Karim Kherraz*, Khaled Kherraz, Abdelkrim Kameli Biology department, Ecole Normale

More information

Bioinformatics III Structural Bioinformatics and Genome Analysis Part Protein Secondary Structure Prediction. Sepp Hochreiter

Bioinformatics III Structural Bioinformatics and Genome Analysis Part Protein Secondary Structure Prediction. Sepp Hochreiter Bioinformatics III Structural Bioinformatics and Genome Analysis Part Protein Secondary Structure Prediction Institute of Bioinformatics Johannes Kepler University, Linz, Austria Chapter 4 Protein Secondary

More information

Protein Structure Bioinformatics Introduction

Protein Structure Bioinformatics Introduction 1 Swiss Institute of Bioinformatics Protein Structure Bioinformatics Introduction Basel, 27. September 2004 Torsten Schwede Biozentrum - Universität Basel Swiss Institute of Bioinformatics Klingelbergstr

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

Viewing and Analyzing Proteins, Ligands and their Complexes 2

Viewing and Analyzing Proteins, Ligands and their Complexes 2 2 Viewing and Analyzing Proteins, Ligands and their Complexes 2 Overview Viewing the accessible surface Analyzing the properties of proteins containing thousands of atoms is best accomplished by representing

More information

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and

More information

PROTEIN SECONDARY STRUCTURE PREDICTION: AN APPLICATION OF CHOU-FASMAN ALGORITHM IN A HYPOTHETICAL PROTEIN OF SARS VIRUS

PROTEIN SECONDARY STRUCTURE PREDICTION: AN APPLICATION OF CHOU-FASMAN ALGORITHM IN A HYPOTHETICAL PROTEIN OF SARS VIRUS Int. J. LifeSc. Bt & Pharm. Res. 2012 Kaladhar, 2012 Research Paper ISSN 2250-3137 www.ijlbpr.com Vol.1, Issue. 1, January 2012 2012 IJLBPR. All Rights Reserved PROTEIN SECONDARY STRUCTURE PREDICTION:

More information

DATE A DAtabase of TIM Barrel Enzymes

DATE A DAtabase of TIM Barrel Enzymes DATE A DAtabase of TIM Barrel Enzymes 2 2.1 Introduction.. 2.2 Objective and salient features of the database 2.2.1 Choice of the dataset.. 2.3 Statistical information on the database.. 2.4 Features....

More information

Secondary and sidechain structures

Secondary and sidechain structures Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.

More information

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2 Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell

More information

Structural Alignment of Proteins

Structural Alignment of Proteins Goal Align protein structures Structural Alignment of Proteins 1 2 3 4 5 6 7 8 9 10 11 12 13 14 PHE ASP ILE CYS ARG LEU PRO GLY SER ALA GLU ALA VAL CYS PHE ASN VAL CYS ARG THR PRO --- --- --- GLU ALA ILE

More information

Report of protein analysis

Report of protein analysis Report of protein analysis By the WHAT IF program 2010-09-19 1 Introduction what check is the name of the validation option in what if. It doesn t matter whether you use the what check program or the what

More information

Presentation Outline. Prediction of Protein Secondary Structure using Neural Networks at Better than 70% Accuracy

Presentation Outline. Prediction of Protein Secondary Structure using Neural Networks at Better than 70% Accuracy Prediction of Protein Secondary Structure using Neural Networks at Better than 70% Accuracy Burkhard Rost and Chris Sander By Kalyan C. Gopavarapu 1 Presentation Outline Major Terminology Problem Method

More information

Prediction and refinement of NMR structures from sparse experimental data

Prediction and refinement of NMR structures from sparse experimental data Prediction and refinement of NMR structures from sparse experimental data Jeff Skolnick Director Center for the Study of Systems Biology School of Biology Georgia Institute of Technology Overview of talk

More information

Protein Structure Prediction

Protein Structure Prediction Protein Structure Prediction Michael Feig MMTSB/CTBP 2009 Summer Workshop From Sequence to Structure SEALGDTIVKNA Folding with All-Atom Models AAQAAAAQAAAAQAA All-atom MD in general not succesful for real

More information

HSQC spectra for three proteins

HSQC spectra for three proteins HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

Bioinformatics. Macromolecular structure

Bioinformatics. Macromolecular structure Bioinformatics Macromolecular structure Contents Determination of protein structure Structure databases Secondary structure elements (SSE) Tertiary structure Structure analysis Structure alignment Domain

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11054 Supplementary Fig. 1 Sequence alignment of Na v Rh with NaChBac, Na v Ab, and eukaryotic Na v and Ca v homologs. Secondary structural elements of Na v Rh are indicated above the

More information

Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two

Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two Supplementary Figure 1. Biopanningg and clone enrichment of Alphabody binders against human IL 23. Positive clones in i phage ELISA with optical density (OD) 3 times higher than background are shown for

More information

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy

Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Design of a Novel Globular Protein Fold with Atomic-Level Accuracy Brian Kuhlman, Gautam Dantas, Gregory C. Ireton, Gabriele Varani, Barry L. Stoddard, David Baker Presented by Kate Stafford 4 May 05 Protein

More information

Details of Protein Structure

Details of Protein Structure Details of Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Anne Mølgaard, Kemisk Institut, Københavns Universitet Learning Objectives

More information