An Auxin-Mediated Shift toward Growth Isotropy Promotes Organ Formation at the Shoot Meristem in Arabidopsis

Size: px
Start display at page:

Download "An Auxin-Mediated Shift toward Growth Isotropy Promotes Organ Formation at the Shoot Meristem in Arabidopsis"

Transcription

1 Current Biology, Volume 24 Supplemental Information An Auxin-Mediated Shift toward Growth Isotropy Promotes Organ Formation at the Shoot Meristem in Arabidopsis Massimiliano Sassi, Olivier Ali, Frédéric Boudon, Gladys Cloarec, Ursula Abad, Coralie Cellier, Xu Chen, Benjamin Gilles, Pascale Milan, Jiri Friml, Teva Vernoux, Christophe Godin, Olivier Hamant, and Jan Traas

2 Supplemental Information Supplemental Figures and Legends

3 Figure S1. Development of ring-like outgrowths following auxin treatments on NPA pins. Related to Figure 1 in the main text (A) Time-course imaging of ring-like primordia development upon treatments with IAA in 35S::GFP-LTI6b. The images show 3D reconstructions of the outer surface of NPA pins imaged from the side at the indicated times. Coloured dots mark the same cells over time. (B) Time-course of MONOPTEROS/AUXIN RESPONSE FACTOR 5 (MP/ARF5) expression during the development of ring-like primordia upon treatments with IAA in pmp::3xgfp plants. The images show 3D reconstructions of the inner surface of NPA pins imaged from the side at the indicated times. Inset at t=96h shows the same meristem imaged from the top. Notice ARF5/MP expression throughout the cells of the ring, marking organ primordium identity. (C) Time-course imaging of untreated 35S::GFP-MBD NPA pins. CMT alignment and pin shape are stably maintained over 96h. (D) Time-course imaging of IAA-treated 35S::GFP-MBD NPA pins. Before auxin treatment (t=0) CMT are circumferentially aligned around the periphery of the SAM. Twenty-four h after the initial auxin application (t=24h), CMT become disorganized in each cells and the circumferential supracellular alignment is lost (see also Fig.1A-E). At this stage no outgrowth is visible at the SAM periphery. Seventy-two h after the initial auxin application (t=72h), a circular outgrowth starts bulging out from the SAM periphery. At this stage CMT of the cells belonging to the outgrowth are still disorganized, whereas circumferential CMT alignment begins to be restored around the summit of the SAM. This leads to the formation of a crease between the ring-like outgrowth and the SAM center at t=96h. The upper images display CMT alignment over the meristem surface. The lower images display the XZ orthogonal projection passing through the center of the meristem.

4

5 Figure S2. Genetic manipulation of CMT organization alters auxin responsiveness and organ formation at the SAM. Related to Figure 2 in the main text (A) CMT disorganization precedes outgrowth formation in NPA-grown bot1-7 mutants. Upper panel: time-course analysis of spontaneous outgrowth formation (indicated by the arrowhead) in the SAM of a bot1-7 35S::GFP-MBD plant constantly grown on NPA. Images were taken at the indicated times. Lower panel: higher magnification details of the regions highlighted by white boxes at t=0, t=24h and t=48h in the upper panel, displaying that CMT disorganization on the cell surface precedes the bulging of the outgrowth. (B) Full images of the representative meristems of WT, bot1-7 and rop6-1 before (t=0) and 24h after the beginning of the auxin treatment, displayed in Figures 2F, 2H and 2J of the main text. (C) Expression of ABP1, KTN1, ROP6 and RIC1 in inflorescences of Col-0 wild-type plants. The graph shows the expression levels of the indicated genes relative to the expression of the Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) obtained by qpcr.

6

7 Figure S3. Mutations in ABP1 alter CMT organization, auxin responsiveness and organ formation at the SAM. Related to Figure 3 in the main text (A) Full images of the representative meristems of WT, abp1-5 and abp1-1s/abp1-5 mutants, before (t=0) and 24h after the beginning of the auxin treatment, displayed in Figures 3C, 3E and 3G of the main text. (B and C) abp1-5 mutation delays auxin-induced organ initiation. (F) WT SAM showing major outgrowth formation 96h after the beginning of the auxin treatment. Left panel, surface reconstruction of the SAM viewed from the top; right panel, orthogonal projection of the same meristem drawn along the white line in the left panel. (G) abp1-5 SAM showing reduced outgrowth formation 98h after the beginning of the auxin treatment. Left panel, surface reconstruction of the SAM viewed from the top; right panel, orthogonal projection of the same meristem drawn along the white line in the left panel. The red asterisks mark the center of the meristem; the arrowheads mark the auxin-induced outgrowths at the flank of the meristem. (D) Spontaneous outgrowth formation in absence of auxin transport in abp1-1/abp1-5 meristems. Time-course analysis of spontaneous outgrowth formation (indicated by red arrowheads) in the SAM of a abp1-1s/abp1-5 35S::GFP-MBD plant constantly grown on NPA. Images were taken at the indicated times. (E) Surface reconstructions of confocal images of NPA-grown abp1-5, abp1-5 bot1-7 and bot 1-7 shoot apices stained with FM4-64. Seeds of the segregating F2 population of the abp1-5xbot1-7 cross were germinated on NPA-containing medium and grown until bolting. When the SAM became visible plants were stained with FM4-64, imaged and further processed for DNA extraction and subsequent genotyping. Notice that the abp1-5 bot1-7 double mutant displays organ outgrowths on NPA as the parental bot1-7 suggesting that KTN1 acts downstream of ABP1. Asterisks mark the center of the SAMs; arrowheads mark the spontaneous outgrowths at the flank of the meristems.

8 Figure S4. Variable changes in outer cell wall rigidity measured by AFM. Related to Figure 4 in the main text The graph shows the values of Young s Modulus obtained by AFM analysis of 8 independent meristems probed 72h after the beginning of the auxin treatments (see Fig. 4G-H). Notice the variability of the response. The highest reduction in cell wall rigidity was recorded for SAM 1 and 3, where the rigidity of the peripheral cells was reduced of 26% and 30%, respectively, compared to the apex. Error bars represent standard deviation.

9 Supplemental Experimental Procedures Plant material and growth condition Arabidopsis thaliana Col-0 and Ws-2 were the wild types in this study. Growth conditions were previously described [S1]. All the transgenic lines and mutant used in this studies were previously described: 35S::GFP-MBD [S1]; 35S::GFP-LTI6b [S2]; bot1-7 35S::GFP-MBD [S3]; pmp::3x-gfp [S4]; abp1-5 [S5], rop6-1 and ric1-1 [S6]; DR5::VENUS-N7 [S7]; pin1-1 (introgressed in Col-0) [S8], pin1-6 [S9], abp1-1s ( [S10]. The DR5::VENUS-N7 35S::GFP-MBD, rop6-1 35S::GFP-MBD, abp1-1s/abp1-5, abp1-5 35S::GFP-MBD, bot1-7 pin1-6 and abp1-5 bot1-7 lines were generated by crossing and further selected by genotyping or antibiotic selection. Chemical treatments NPA treatments were carried out as previously described [S11]. Plants were further kept on NPA-containing medium for all the duration of the experiments. To induce organ formation plants were treated in petri dishes with 1mM IAA liquid solution for 3h after imaging the t=0 time point and again the next day after imaging the t=24h time point. No other IAA was added after the 24h time point until the completion of the experiment. Lanolin paste for local SAM treatments was prepared as follows: 1 volume of chemical stock solution (3x concentrated) was added to 2 volumes of melted (55 C) lanolin and thoroughly mixed until the formation of a homogenous emulsion. Stocks concentration were 3mM for IAA; 666 µg/ml for oryzalin. Local applications were made with a pipette tip under a binocular. After lanolin application, plants were kept in humid conditions in a transparent plastic box for 4 days before further analyses. Equal amounts of DMSO were used for untreated controls Microscopy Confocal microscopy was carried out with a Zeiss LSM700 upright microscope equipped with 40x water immersion lens. Live imaging of NPA pins was carried out directly in petri dishes, after submerging plantlets with water. SAMs of plant grown on soil were imaged as previously described [S12] or in whole mount preparations. Briefly, for whole mount preparations plants were grown on soil in flat vessels until bolting. Plants were imaged after the removal of older flower buds to expose the SAM surface with a droplet of water between the objective and the SAM surface. Plants were kept in humid transparent boxes for all the duration of the experiments to prevent SAM desiccation.

10 Scanning electron microscopy was carried out with a Hirox SH-3000 table-top SEM on fresh plant material at -20 C, with an accelerating voltage of 5kV. Images of SAMs treated with lanolin paste were taken with a Leica MZ12 stereomicroscope equipped with a Leica DFC320 camera. Image analyses Image processing for GFP-LTI6b, pmp::3x-gfp and FM4-64 stained SAMs was carried out with the ZEN software (Zeiss) using the 3D transparent projection. For MT visualization, confocal stacks were further processed with MerryProj [S13] to obtain the projection of MTs on the L1 layer. Measurements of MT organization were carried out with the MT plug-in for ImageJ [S3]. Briefly, for each meristem cell contours were inferred from the original confocal stack (loaded onto the FIJI release of ImageJ; and further saved in a single Region Of Interest (ROI) file. The ROI file was then overlaid on the corresponding MerryProj-derived image and used as template to measure MT organization with the MT plug-in as previously described [S3]. Supracellular organization of MT in the SAM was assessed with FIJI by calculating the angle between the radius of the SAM and the average MT orientation from each cell as obtained by MT plug-in. At least three meristems were analysed for each condition. Graphs and statistics were obtained with Microsoft Excel software. Gene expression analysis Total RNA was extracted from inflorescences of Arabidopsis Col-0 ecotype using the Spectrum Plant Total RNA kit (Sigma-Aldrich). Total RNA was processed with processed with DNAse (kit Turbo DNA free, Ambion), and further reverse transcribed with M-MulV reverse transcriptase (Fermentas). Quantitative PCR was performed with the FastStart Universal SYBR Green Master (Roche) using a StepOne Plus (Applied Biosystem) according to manufactures instructions. Each reaction was performed in triplicates. Data were normalized according to Pfaffl [S14]. Details on primer sequences are given below. Atomic Force Microscopy Sample preparation for AFM analysis was as follow: in vitro grown plantlets (untreated or treated with auxin as described above) were individually transferred onto 35x10mm round tissue culture dish (BD Falcon) containing solid (2% agar) culture medium and subsequently fixed by using 1.5% of lukewarm low-melting agarose (Sigma-Aldrich), to prevent vibrations

11 during AFM scanning. Before AFM analysis each meristem was imaged by confocal microscopy to correctly determine position of the sample. Atomic force microscopy was carried out with a JPK NanoWizard3 system loaded with a SCANASYST-AIR tip (Bruker; tip radius: 2 nm; K: 0.4 N/m), by using a constant force of 70nN. This resulted in an average indentation of nm on the SAM surface for each contact point. Data analysis was carried out with the JPK Data Processing Software (v. 4.2). The Young s Modulus was estimated using the contact model for a four-sided pyramidal indenter [S15]. Numerical Simulations Mechanical simulations were designed with a previously developed modelling framework based on the SOFA software platform [S16] for FEM simulation and specific data structure for cellular representation. This framework aimed at computing mechanically-induced growth of plant tissues and is described in details elsewhere (Boudon et al., submitted manuscript). A synthetic, schematic, pin-like meristem was designed by concatenating a cylinder and a hemisphere. Each wall of the epidermis of the structure is transformed into triangular finite elements. Mechanically these finite elements displayed a linear anisotropic elastic behavior characterized by two Young s Moduli defined in two perpendicular directions. The synthetic meristem was divided in four different zones, featuring specific values of the Young s moduli: the central zone, the periphery, the primordium and the frontier zone, on the top border of primordium (see Figure 4A in the main text). The elastic properties of the periphery were set anisotropic: a Young s modulus of 1000 MPa circumferentially and 400 MPa vertically; the central zone displayed an isotropic Young s modulus of 700 MPa. The frontier zone featured the same values of Young s moduli that the periphery but with a different orientation: the stronger direction defined tangential to the contour of the primordium region and the softer one toward the primordium. Concerning the primordium, we compared 4 scenarios. In the first case the primordium cells have the same material properties than the ones of the periphery to model a pin shape. In another case, the overall rigidity of the primordium is decreased by a 70% (cells within the primordium are assigned Young s moduli of 300 MPa circumferentially and 120 MPa vertically). In the last two cases, the overall rigidity of the primordium is decreased by 50% but in two different ways. In one way the original anisotropy of rigidity is preserved (the circumferential Young s modulus is set to 500 MPa and the vertical one to 200 MPa). In the other way, the cells within the primordium were assigned the same average value (350 MPa) of Young s modulus in both directions. A turgor pressure of 0.4 MPa was set inside all cells and gave rise to stresses within the cell walls.

12 Bottom of the structure is attached to a plane. Given the turgor pressure and an initial shape, the simulation framework, first, computes the deformation of the structure satisfying mechanical equilibrium and then, if strain reaches a given threshold, initiates the growth phase. For that specific study, the strain threshold (0.03) was chosen so that it inhibits growth in the circumferential direction but allows it in the vertical direction, in the periphery. Mechanical equilibrium and growth equations will be given elsewhere (Boudon et al., submitted manuscript). List of primers used in this study Primer Sequence use KTN F 5 -AGGGAGCTGCCTCAAAATCT-3 qpcr KTN R 5 -CATAGCAGCCAGGTCCTCAT-3 qpcr ABP1 F 5 -TCTTGGCCAACAGTACAATTCA-3 qpcr ABP1R 5 -CGGCCGAGATATGATAACCA-3 qpcr ROP6 F 5 -ACGGTGCTGTTGGAAAGACT-3 qpcr ROP6 R 5 -TCCCACAATCCCAAGTTGAT-3 qpcr RIC1 F 5 -AGGATTTCCGACCGATGTAA-3 qpcr RIC1 R 5 -CTTGCGGGTTGTATTTGTTG-3 qpcr bot1-7 F 5 -TCTCCGAGATCGAAGCTCTTGC-3 Genotyping bot1-7 R 5 -TGCCAAAAGGGGTGACAAAA-3 Genotyping abp1-5 F 5 -TGACCTTCCTCAGGATAACTATGG-3 Genotyping* abp1-5 R 5 -CCAACACCTGCAGGTCCTCATGAC-3 Genotyping* abp1-1s F 5 -ATTTGCAATAGCGCATTGAAC-3 Genotyping abp1-1s R 5 -GATGGGACAAGGAGCTCCTAG-3 Genotyping *the genotyping of abp1-5 mutation is obtained by further restriction of PCR fragments with RsaI as described in [S5] Supplemental References S1. Hamant, O., Heisler, M. G., Jönsson, H., Krupinski, P., Uyttewaal, M., Bokov, P., Corson, F., Sahlin, P., Boudaoud, A., Meyerowitz, E. M., et al. (2008). Developmental patterning by mechanical signals in Arabidopsis. Science 322, S2. Cutler, S. R., Ehrhardt, D. W., Griffitts, J. S., and Somerville, C. R. (2000). Random GFP::cDNA fusions enable visualization of subcellular structures in cells of Arabidopsis at a high frequency. Proc. Natl. Acad. Sci. U. S. A. 97, S3. Uyttewaal, M., Burian, A., Alim, K., Landrein, B., Borowska-Wykręt, D., Dedieu, A., Peaucelle, A., Ludynia, M., Traas, J., Boudaoud, A., et al. (2012). Mechanical stress

13 acts via katanin to amplify differences in growth rate between adjacent cells in Arabidopsis. Cell 149, S4. Schlereth, A., Möller, B., Liu, W., Kientz, M., Flipse, J., Rademacher, E. H., Schmid, M., Jürgens, G., and Weijers, D. (2010). MONOPTEROS controls embryonic root initiation by regulating a mobile transcription factor. Nature 464, S5. Robert, S., Kleine-Vehn, J., Barbez, E., Sauer, M., Paciorek, T., Baster, P., Vanneste, S., Zhang, J., Simon, S., Čovanová, M., et al. (2010). ABP1 mediates auxin inhibition of clathrin-dependent endocytosis in Arabidopsis. Cell 143, S6. Xu, T., Wen, M., Nagawa, S., Fu, Y., Chen, J.-G., Wu, M.-J., Perrot-Rechenmann, C., Friml, J., Jones, A. M., and Yang, Z. (2010). Cell surface- and rho GTPase-based auxin signaling controls cellular interdigitation in Arabidopsis. Cell 143, S7. Vernoux, T., Brunoud, G., Farcot, E., Morin, V., Van den Daele, H., Legrand, J., Oliva, M., Das, P., Larrieu, A., Wells, D., et al. (2011). The auxin signalling network translates dynamic input into robust patterning at the shoot apex. Mol. Syst. Biol. 7, 508. S8. Sassi, M., Lu, Y., Zhang, Y., Wang, J., Dhonukshe, P., Blilou, I., Dai, M., Li, J., Gong, X., Jaillais, Y., et al. (2012). COP1 mediates the coordination of root and shoot growth by light through modulation of PIN1- and PIN2-dependent auxin transport in Arabidopsis. Development 139, S9. Vernoux, T., Kronenberger, J., Grandjean, O., Laufs, P., and Traas, J. (2000). PIN- FORMED 1 regulates cell fate at the periphery of the shoot apical meristem. Development 127, S10. Tzafrir, I., Pena-muralla, R., Dickerman, A., Berg, M., Rogers, R., Hutchens, S., Sweeney, T. C., Mcelver, J., Aux, G., Patton, D., et al. (2004). Identification of Genes Required for Embryo Development in Arabidopsis. Plant Physiol. 135, S11. Grandjean, O., Vernoux, T., Laufs, P., Belcram, K., Mizukami, Y., and Traas, J. (2004). In Vivo Analysis of Cell Division, Cell Growth, and Differentiation at the Shoot Apical Meristem in Arabidopsis The Plant Cell. Plant Cell 16, S12. Fernandez, R., Das, P., Mirabet, V., Moscardi, E., Traas, J., Verdeil, J., Malandain, G., and Godin, C. (2010). imaging plant growth in 4d : robust tissue reconstruction and lineaging at cell resolution. Nat. Methods 7, S13. De Reuille, P. B., Bohn-Courseau, I., Ljung, K., Morin, H., Carraro, N., Godin, C., and Traas, J. (2006). Computer simulations reveal properties of the cell-cell signaling network at the shoot apex in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 103, S14. Pfaffl, M. W. (2001). A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. S12. Bilodeau, G.G. (1992). Regular Pyramid punch problem. J. Appl. Mech. 59,

14 S13. Faure, F., Duriez, C., Delingette, H., Allard, J., Gilles, B., Marchesseau, S., Talbot, H., Courtecuisse, H., Bousquet, G., Peterlik, I., et al. (2012). SOFA: A Multi- ModelFramework for Interactive Physical Simulation. In Soft Tissue Biomechanical Modeling for Computer Assisted Surgery. Studies in Mechanobiology, Tissue Engineering and Biomaterials 11, Y. Payan, ed. (Springer-Verlag, Heidelberg).

Mediated Shift toward Growth Isotropy Promotes Organ Formation at the Shoot Meristem in Arabidopsis.

Mediated Shift toward Growth Isotropy Promotes Organ Formation at the Shoot Meristem in Arabidopsis. An Auxin-Mediated Shift toward Growth Isotropy Promotes Organ Formation at the Shoot Meristem in Arabidopsis Massimiliano Sassi, Olivier Ali, Frédéric Boudon, Gladys Cloarec, Ursula Abad, Coralie Cellier,

More information

Phyllotaxis DEVELOPMENT. Jan Traas*

Phyllotaxis DEVELOPMENT. Jan Traas* AT A GLANCE 249 Development 140, 249-253 (2013) doi:10.1242/dev.074740 2013. Published by The Company of Biologists Ltd Phyllotaxis Jan Traas* Summary The precise arrangement of plant organs, also called

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

More information

From Genome to Phenotype: Modeling the interaction of physical and chemical signals in plant meristems. Meyerowitz Lab and many collaborators

From Genome to Phenotype: Modeling the interaction of physical and chemical signals in plant meristems. Meyerowitz Lab and many collaborators From Genome to Phenotype: Modeling the interaction of physical and chemical signals in plant meristems Meyerowitz Lab and many collaborators Needs to understand tissues, morphogenesis and development:

More information

AUXIN BINDING PROTEIN 1 (ABP1): A matter of fact. Chun-Ming Liu, Professor

AUXIN BINDING PROTEIN 1 (ABP1): A matter of fact. Chun-Ming Liu, Professor Commentary AUXIN BINDING PROTEIN 1 (ABP1): A matter of fact Chun-Ming Liu, Professor Editor-in-Chief Journal of Integrative Plant Biology (JIPB) Correspondence: cmliu@ibcas.ac.cn This article has been

More information

Towards a dynamic model of the Arabidopsis meristem

Towards a dynamic model of the Arabidopsis meristem F S P M 0 4 Towards a dynamic model of the Arabidopsis meristem Pierre Barbier de Reuille 1, Jan Traas 2, Christophe Godin 3 1 INRA, UMR AMAP Montpellier 2 INRA, Laboratoire de biologie cellulaire de Versailles

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/2/1/e1500989/dc1 Supplementary Materials for An epidermis-driven mechanism positions and scales stem cell niches in plants Jérémy Gruel, Benoit Landrein, Paul Tarr,

More information

Auxin is not asymmetrically distributed in initiating Arabidopsis leaves. *Author for correspondence: Marcus G Heisler

Auxin is not asymmetrically distributed in initiating Arabidopsis leaves. *Author for correspondence: Marcus G Heisler 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Auxin is not asymmetrically distributed in initiating Arabidopsis leaves Neha Bhatia 1 and Marcus G. Heisler 1* Affiliations

More information

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil

More information

23-. Shoot and root development depend on ratio of IAA/CK

23-. Shoot and root development depend on ratio of IAA/CK Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

More information

In the growing plant shoot, new leaf and flower primordia

In the growing plant shoot, new leaf and flower primordia An auxin-driven polarized transport model for phyllotaxis Henrik Jönsson*, Marcus G. Heisler, Bruce E. Shapiro, Elliot M. Meyerowitz, and Eric Mjolsness *Computational Biology and Biological Physics Group,

More information

Framework for 3D Mechanical Modeling of Plant Morphogenesis with Cellular Resolution.

Framework for 3D Mechanical Modeling of Plant Morphogenesis with Cellular Resolution. A Computational Framework for 3D Mechanical Modeling of Plant Morphogenesis with Cellular Resolution Frédéric Boudon, Jérôme Chopard, Olivier Ali, Benjamin Gilles, Olivier Hamant, Arezki Boudaoud, Jan

More information

Mechanical Stress Acts via Katanin to Amplify Differences in Growth Rate between Adjacent Cells in Arabidopsis

Mechanical Stress Acts via Katanin to Amplify Differences in Growth Rate between Adjacent Cells in Arabidopsis Mechanical Stress Acts via Katanin to Amplify Differences in Growth Rate between Adjacent Cells in Arabidopsis Magalie Uyttewaal, 1,3,7 Agata Burian, 4,7 Karen Alim, 5,7 Benoît Landrein, 1,2 Dorota Borowska-Wykręt,

More information

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin

More information

Cover Page. The handle holds various files of this Leiden University dissertation

Cover Page. The handle   holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/29080 holds various files of this Leiden University dissertation Author: Fan, Yuanwei Title: The role of AGC3 kinases and calmodulins in plant growth responses

More information

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho

More information

COMPETITIVE CANALIZATION OF AUXIN IN PEA CAN BE INVOLVED IN INITIATION OF AXILLARY BUD OUTGROWTH

COMPETITIVE CANALIZATION OF AUXIN IN PEA CAN BE INVOLVED IN INITIATION OF AXILLARY BUD OUTGROWTH COMPETITIVE CANALIZATION OF AUXIN IN PEA CAN BE INVOLVED IN INITIATION OF AXILLARY BUD OUTGROWTH Medveďová Z. 1, Balla J. 1, 2, Procházka S. 1 1 CEITEC - Central European Institute of Technology, Mendel

More information

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild

More information

BIO1PS 2012 Plant Science Lecture 4 Hormones Pt. I

BIO1PS 2012 Plant Science Lecture 4 Hormones Pt. I BIO1PS 2012 Plant Science Lecture 4 Hormones Pt. I Dr. Michael Emmerling Department of Botany Room 410 m.emmerling@latrobe.edu.au Hormones and Ghost gum Eucalyptus papuana Coordination ~3 Lectures Leaves

More information

Real-time lineage analysis reveals oriented cell divisions associated with morphogenesis at the shoot apex of Arabidopsis thaliana

Real-time lineage analysis reveals oriented cell divisions associated with morphogenesis at the shoot apex of Arabidopsis thaliana Research article 4225 Real-time lineage analysis reveals oriented cell divisions associated with morphogenesis at the shoot apex of Arabidopsis thaliana G. Venugopala Reddy 1, Marcus G. Heisler 1, David

More information

Outline. Leaf Development. Leaf Structure - Morphology. Leaf Structure - Morphology

Outline. Leaf Development. Leaf Structure - Morphology. Leaf Structure - Morphology Outline 1. Leaf Structure: Morphology & Anatomy 2. Leaf Development A. Anatomy B. Sector analysis C. Leaf Development Leaf Structure - Morphology Leaf Structure - Morphology 1 Leaf Structure - Morphology

More information

The mode of development in animals and plants is different

The mode of development in animals and plants is different The mode of development in animals and plants is different Outcome of animal embryogenesis is a mini edition of the adult Outcome of plant embryogenesis is a simple structure with -root apical meristem

More information

There is strong evidence that active auxin transport, generated

There is strong evidence that active auxin transport, generated Computer simulations reveal properties of the cell cell signaling network at the shoot apex in Arabidopsis Pierre Barbier de Reuille*, Isabelle Bohn-Courseau, Karin Ljung, Halima Morin, Nicola Carraro,

More information

A developmental geneticist s guide to roots Find out about the hidden half of plants

A developmental geneticist s guide to roots Find out about the hidden half of plants the Centre for Plant Integrative Biology A developmental geneticist s guide to roots Find out about the hidden half of plants What do roots look like from the inside? How do roots form? Can we improve

More information

Mechanical stress in Arabidopsis leaves orients microtubules in a continuous supracellular pattern

Mechanical stress in Arabidopsis leaves orients microtubules in a continuous supracellular pattern Jacques et al. BMC Plant Biology 2013, 13:163 RESEARCH ARTICLE Open Access Mechanical stress in Arabidopsis leaves orients microtubules in a continuous supracellular pattern Eveline Jacques, Jean-Pierre

More information

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

More information

Useful Propagation Terms. Propagation The application of specific biological principles and concepts in the multiplication of plants.

Useful Propagation Terms. Propagation The application of specific biological principles and concepts in the multiplication of plants. Useful Propagation Terms Propagation The application of specific biological principles and concepts in the multiplication of plants. Adventitious Typically describes new organs such as roots that develop

More information

Computer simulations reveal novel properties of the cell-cell signaling network at the shoot apex in Arabidopsis.

Computer simulations reveal novel properties of the cell-cell signaling network at the shoot apex in Arabidopsis. Computer simulations reveal novel properties of the cell-cell signaling network at the shoot apex in Arabidopsis. Pierre Barbier de Reuille (1), Isabelle Bohn-Courseau (1), Karen Ljung, Halima Morin, Nicola

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation

More information

Actions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin)

Actions of auxin. Hormones: communicating with chemicals History: Discovery of a growth substance (hormone- auxin) Hormones: communicating with chemicals History- discovery of plant hormone. Auxin Concepts of hormones Auxin levels are regulated by synthesis/degradation, transport, compartmentation, conjugation. Polar

More information

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined

More information

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

The auxin influx carrier is essential for correct leaf positioning

The auxin influx carrier is essential for correct leaf positioning The Plant Journal (2002) 32, 509 517 The auxin influx carrier is essential for correct leaf positioning Pia A. Stieger, Didier Reinhardt and Cris Kuhlemeier Institute of Plant Sciences, University of Berne,

More information

Molecular Genetics of. Plant Development STEPHEN H. HOWELL CAMBRIDGE UNIVERSITY PRESS

Molecular Genetics of. Plant Development STEPHEN H. HOWELL CAMBRIDGE UNIVERSITY PRESS Molecular Genetics of Plant Development STEPHEN H. HOWELL CAMBRIDGE UNIVERSITY PRESS Contents Preface A Word on Genetic Nomenclature page xiii xvii 1 Approaches to the Study of Plant Development 1 Pattern

More information

TOPIC 9.3 GROWTH IN PLANTS

TOPIC 9.3 GROWTH IN PLANTS TOPIC 9.3 GROWTH IN PLANTS 9.3 A Growth INTRO http://cdn2.hubspot.net/hubfs/18130/social-suggested-images/plant_growing.jpeg IB BIO 9.3 3 In general, plants are able to grow indeterminately. This means

More information

Visualizing Auxin Transport Routes in Arabidopsis Leaf Primordia

Visualizing Auxin Transport Routes in Arabidopsis Leaf Primordia Chapter 2 Visualizing Auxin Transport Routes in Arabidopsis Leaf Primordia Danielle Marcos and Thomas Berleth Abstract The phytohormone auxin plays a pivotal role in plant development, regulating a myriad

More information

Plants are sessile. 10d-17/giraffe-grazing.jpg

Plants are sessile.   10d-17/giraffe-grazing.jpg Plants are sessile www.mccullagh.org/db9/ 10d-17/giraffe-grazing.jpg Plants have distinct requirements because of their sessile nature Organism-level requirements Must adjust to environment at given location

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the

More information

Morphogenesis at the inflorescence shoot apex of Anagallis arvensis: surface geometry and growth in comparison with the vegetative shoot

Morphogenesis at the inflorescence shoot apex of Anagallis arvensis: surface geometry and growth in comparison with the vegetative shoot Journal of Experimental Botany, Vol. 60, No. 12, pp. 3407 3418, 2009 doi:10.1093/jxb/erp176 Advance Access publication 9 June, 2009 This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html

More information

Aida, M., Vernoux, X., Furutani, M., Traas, J. and Tasaka, M. (2002). Development 129, On page 3972 of this article, the sentence This

Aida, M., Vernoux, X., Furutani, M., Traas, J. and Tasaka, M. (2002). Development 129, On page 3972 of this article, the sentence This ERRATUM Roles of PIN-FORMED1 and MONOPTEROS in pattern formation of the apical region of the Arabidopsis embryo Aida, M., Vernoux, X., Furutani, M., Traas, J. and Tasaka, M. (2002). Development 129, 3965-3974.

More information

Samantha Ramirez, MSE. Stress. The intensity of the internal force acting on a specific plane (area) passing through a point. F 2

Samantha Ramirez, MSE. Stress. The intensity of the internal force acting on a specific plane (area) passing through a point. F 2 Samantha Ramirez, MSE Stress The intensity of the internal force acting on a specific plane (area) passing through a point. Δ ΔA Δ z Δ 1 2 ΔA Δ x Δ y ΔA is an infinitesimal size area with a uniform force

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

Fibonacci Patterns in Plants

Fibonacci Patterns in Plants Fibonacci Patterns in Plants Matt Pennybacker Alan Newell Zhiying Sun Patrick Shipman The University of Arizona 29 March 2010 Matt Pennybacker, The University of Arizona Fibonacci Patterns 1/12 An Example

More information

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid Plant Hormones Lecture 9: Control Systems in Plants What is a Plant Hormone? Compound produced by one part of an organism that is translocated to other parts where it triggers a response in target cells

More information

Plant Structure and Organization - 1

Plant Structure and Organization - 1 Plant Structure and Organization - 1 In our first unit of Biology 203 we will focus on the structure and function of the higher plants, in particular the angiosperms, or flowering plants. We will look

More information

Auxin and self-organization at the shoot apical meristem

Auxin and self-organization at the shoot apical meristem Journal of Experimental Botany, Vol. 64, No. 9, pp. 2579 2592, 2013 doi:10.1093/jxb/ert101 Advance Access publication 12 April, 2013 REVIEW PAPER Auxin and self-organization at the shoot apical meristem

More information

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in

More information

COP1 mediates the coordination of root and shoot growth by light through modulation of PIN1- and PIN2-dependent auxin transport in Arabidopsis

COP1 mediates the coordination of root and shoot growth by light through modulation of PIN1- and PIN2-dependent auxin transport in Arabidopsis 3402 RESEARCH ARTICLE Development 139, 3402-3412 (2012) doi:10.1242/dev.078212 2012. Published by The Company of Biologists Ltd COP1 mediates the coordination of root and shoot growth by light through

More information

Mapping the mechanical stiffness of live cells with the scanning ion conductance microscope

Mapping the mechanical stiffness of live cells with the scanning ion conductance microscope SUPPLEMENTARY INFORMATION Mapping the mechanical stiffness of live cells with the scanning ion conductance microscope Johannes Rheinlaender and Tilman E. Schäffer Supplementary Figure S1 Supplementary

More information

Live imaging of developmental processes in a living meristem of Davidia involucrata (Nyssaceae)

Live imaging of developmental processes in a living meristem of Davidia involucrata (Nyssaceae) METHODS ARTICLE published: 13 November 2014 doi: 10.3389/fpls.2014.00613 Live imaging of developmental processes in a living meristem of Davidia involucrata (Nyssaceae) Markus Jerominek 1 *, Kester Bull-Hereñu

More information

CONTROL SYSTEMS IN PLANTS

CONTROL SYSTEMS IN PLANTS AP BIOLOGY PLANTS FORM & FUNCTION ACTIVITY #5 NAME DATE HOUR CONTROL SYSTEMS IN PLANTS HORMONES MECHANISM FOR HORMONE ACTION Plant Form and Function Activity #5 page 1 CONTROL OF CELL ELONGATION Plant

More information

From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology

From basic research to crop improvement. Dirk Inze VIB-UGent Center for Plant Systems Biology From basic research to crop improvement Dirk Inze VIB-UGent Center for Plant Systems Biology Oct 2017 The Great Challenge By 2050 70% more food on the same land area Growing world population Climate change

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Mourier et al., http://www.jcb.org/cgi/content/full/jcb.201411100/dc1 Figure S1. Size and mitochondrial content in Mfn1 and Mfn2 knockout hearts. (A) Body

More information

Comptes Rendus Biologies

Comptes Rendus Biologies C. R. Biologies 333 (2010) 290 296 Contents lists available at ScienceDirect Comptes Rendus Biologies www.sciencedirect.com Plant biology and pathology/biologie et pathologie végétales Auxin: A major regulator

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

Progress in modeling biological development as it bears on SBML

Progress in modeling biological development as it bears on SBML Progress in modeling biological development as it bears on SBML Eric Mjolsness UC Irvine representing the Computable Plant project www.computableplant.org Three relevant examples Meristem maintenance by

More information

Auxin flow-mediated competition between axillary buds to restore apical. *Correspondence and requests for materials should be addressed to J.B.

Auxin flow-mediated competition between axillary buds to restore apical. *Correspondence and requests for materials should be addressed to J.B. Supplementary Information Auxin flow-mediated competition between axillary buds to restore apical dominance Jozef Balla 1,2+ *, Zuzana Medveďová 1,4+, Petr Kalousek 2, Natálie Matiješčuková 1, Jiří Friml

More information

Embryo Development. Embryo Development. Embryo Development. Embryo Development (Cont.) Vegetative Plant Development

Embryo Development. Embryo Development. Embryo Development. Embryo Development (Cont.) Vegetative Plant Development Vegetative Plant Development Chapter 37 Embryo Development Begins once the egg cell is fertilized -The growing pollen tube enters angiosperm embryo sac and releases two sperm cells -One sperm fertilizes

More information

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

More information

Amanda Rawson Independent Research Project Report Bio219 Cell Biology. December 3, 2008

Amanda Rawson Independent Research Project Report Bio219 Cell Biology. December 3, 2008 Evidence That Treatment with Cytochalasin B Increases the Average Velocity of Cytoplasmic Streaming in Amoebae Proteus Amanda Rawson Independent Research Project Report Bio219 Cell Biology December 3,

More information

Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in Brassica and Arabidopsis

Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in Brassica and Arabidopsis The Plant Cell, Vol. 17, 2738 2753, October 2005, www.plantcell.org ª 2005 American Society of Plant Biologists Brassinosteroids Stimulate Plant Tropisms through Modulation of Polar Auxin Transport in

More information

Modelling meristem development in plants

Modelling meristem development in plants Modelling meristem development in plants Heisler, Marcus G.; Jönsson, Henrik Published in: Current Opinion in Plant Biology DOI: 10.1016/j.pbi.2006.11.005 2007 Link to publication Citation for published

More information

Mechanical Engineering Ph.D. Preliminary Qualifying Examination Solid Mechanics February 25, 2002

Mechanical Engineering Ph.D. Preliminary Qualifying Examination Solid Mechanics February 25, 2002 student personal identification (ID) number on each sheet. Do not write your name on any sheet. #1. A homogeneous, isotropic, linear elastic bar has rectangular cross sectional area A, modulus of elasticity

More information

Report. A ROP GTPase-Dependent Auxin Signaling Pathway Regulates the Subcellular Distribution of PIN2 in Arabidopsis Roots

Report. A ROP GTPase-Dependent Auxin Signaling Pathway Regulates the Subcellular Distribution of PIN2 in Arabidopsis Roots Current Biology 22, 1319 1325, July 24, 2012 ª2012 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2012.05.019 A ROP GTPase-Dependent Auxin Signaling Pathway Regulates the Subcellular Distribution of

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary figures % Occupancy 90 80 70 60 50 40 30 20 Wt tol-1(nr2033) Figure S1. Avoidance behavior to S. enterica was not observed in wild-type or tol-1(nr2033) mutant nematodes.

More information

Supplementary Material For: Modeling halotropism: A key role for root tip architecture and reflux loop remodeling in redistributing auxin

Supplementary Material For: Modeling halotropism: A key role for root tip architecture and reflux loop remodeling in redistributing auxin Supplementary Material For: Modeling halotropism: A key role for root tip architecture and reflux loop remodeling in redistributing auxin Thea van den Berg, Ruud Korver, Christa Testerink, Kirsten ten

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/33/6048/1436/dc1 Supporting Online Material for Generation of Spatial Patterns Through Cell Polarity Switching Sarah Robinson, Pierre Barbier de Reuille, Jordi Chan,

More information

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within

More information

Lipid transfer proteins confer resistance to trichothecenes

Lipid transfer proteins confer resistance to trichothecenes Lipid transfer proteins confer resistance to trichothecenes John McLaughlin and Anwar Bin-Umer Tumer Laboratory National Fusarium Head Blight Forum December 6th, 2012 FY09-11: Identify trichothecene resistance

More information

Chapter 33 Plant Responses

Chapter 33 Plant Responses Chapter 33 Plant Responses R. Cummins 1 Chapter 33 Plant Responses External Factors Light, Day Length, Gravity, Temperature Internal Factors Hormones R. Cummins 2 Tropisms R. Cummins 3 Phototropism and

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

Keywords: Arabidopsis shoot apical meristem plant nutrition plant development cytokinin hormones

Keywords: Arabidopsis shoot apical meristem plant nutrition plant development cytokinin hormones SI Appendix Title: Nitrate modulates stem cell dynamics in Arabidopsis shoot meristems through cytokinins Authors: Benoit Landrein a, Pau Formosa-Jordan a, Alice Malivert a,b, Christoph Schuster a, Charles

More information

Reproduction, Seeds and Propagation

Reproduction, Seeds and Propagation Reproduction, Seeds and Propagation Diploid (2n) somatic cell Two diploid (2n) somatic cells Telophase Anaphase Metaphase Prophase I One pair of homologous chromosomes (homologues) II Homologues condense

More information

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly

More information

Cell type-specific auxin responses in the Arabidopsis root. Dominant expression patterns in cell type-specific auxin responses

Cell type-specific auxin responses in the Arabidopsis root. Dominant expression patterns in cell type-specific auxin responses A map of cell type-specific auxin responses Bargmann et al. Molecular Systems Biology 2013 Supplementary Information Table of Content Supplementary Materials and methods p2-3 Supplementary Figures p4-15

More information

Nature Protocols: doi: /nprot Supplementary Figure 1

Nature Protocols: doi: /nprot Supplementary Figure 1 Supplementary Figure 1 Photographs of the 3D-MTC device and the confocal fluorescence microscopy. I: The system consists of a Leica SP8-Confocal microscope (with an option of STED), a confocal PC, a 3D-MTC

More information

Plant Responses. NOTE: plant responses involve growth and changes in growth. Their movement is much slower than that of animals.

Plant Responses. NOTE: plant responses involve growth and changes in growth. Their movement is much slower than that of animals. Plant Responses A stimulus is anything that causes a reaction in an organism. Examples: light, gravity and temperature A response is the activity of an organism as a result of a stimulus. Examples: Growth,

More information

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

More information

Why plants make puzzle cells, and how their shape emerges

Why plants make puzzle cells, and how their shape emerges 1 Why plants make puzzle cells, and how their shape emerges 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Aleksandra Sapala 1,8, Adam Runions 1,2,8, Anne-Lise Routier-Kierzkowska 1,3, Mainak Das Gupta 1,4,

More information

Dynamics of cell wall elasticity pattern shapes the cell during yeast mating morphogenesis.

Dynamics of cell wall elasticity pattern shapes the cell during yeast mating morphogenesis. Dynamics of cell wall elasticity pattern shapes the cell during yeast mating morphogenesis. Björn Goldenbogen 1, Wolfgang Giese 1, Marie Hemmen 1, Jannis Uhlendorf 1, Andreas Herrmann 2, Edda Klipp 1 1.

More information

Regulation of Phosphate Homeostasis by microrna in Plants

Regulation of Phosphate Homeostasis by microrna in Plants Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,

More information

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family GENES & DEVELOPMENT (2000) 14: 108 117 INTRODUCTION Flower Diagram INTRODUCTION Abscission In plant, the process by which a plant

More information

Simon Scofield, Walter Dewitte, and James AH Murray* School of Biosciences; Cardiff University; Cardiff, UK

Simon Scofield, Walter Dewitte, and James AH Murray* School of Biosciences; Cardiff University; Cardiff, UK Short Communication Plant Signaling & Behavior 9, e28934; April; 2014 Landes Bioscience Short Communication STM sustains stem cell function in the Arabidopsis shoot apical meristem and controls KNOX gene

More information

Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and

Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and Lifeact-Ruby (red) were imaged in vivo to visualize secretion

More information

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro.

4) Please cite Dagda et al J Biol Chem 284: , for any publications or presentations resulting from use or modification of the macro. Supplement Figure S1. Algorithmic quantification of mitochondrial morphology in SH- SY5Y cells treated with known fission/fusion mediators. Parental SH-SY5Y cells were transiently transfected with an empty

More information

SCANNING ELECTRON MICROSCOPY OF FLORAL INITIATION AND DEVELOPMENTAL STAGES IN SWEET CHERRY (PRUNUS AVIUM) UNDER WATER DEFICITS HAKAN ENGIN

SCANNING ELECTRON MICROSCOPY OF FLORAL INITIATION AND DEVELOPMENTAL STAGES IN SWEET CHERRY (PRUNUS AVIUM) UNDER WATER DEFICITS HAKAN ENGIN Bangladesh J. Bot. 37(1): 15-19, 2008 (June) SCANNING ELECTRON MICROSCOPY OF FLORAL INITIATION AND DEVELOPMENTAL STAGES IN SWEET CHERRY (PRUNUS AVIUM) UNDER WATER DEFICITS HAKAN ENGIN Department of Horticulture,

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline. Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing

More information

The Geometric and Dynamic Essence of Phyllotaxis

The Geometric and Dynamic Essence of Phyllotaxis Math. Model. Nat. Phenom. Vol. 6, No. 2, 20, pp. 1 16 DOI:./mmnp/20620 The Geometric and Dynamic Essence of Phyllotaxis P. Atela Department of Mathematics, Smith College, Northampton, MA 06, USA Abstract.

More information

Rapid report. Research. Naden T. Krogan 1, Danielle Marcos 2, Aaron I. Weiner 1 and Thomas Berleth 2. Summary. Introduction

Rapid report. Research. Naden T. Krogan 1, Danielle Marcos 2, Aaron I. Weiner 1 and Thomas Berleth 2. Summary. Introduction Research The auxin response factor MONOPTEROS controls meristem function and organogenesis in both the shoot and root through the direct regulation of PIN genes Authors for correspondence: Naden T. Krogan

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,

More information