The impact of the neisserial DNA uptake sequence on genome evolution and stability

Size: px
Start display at page:

Download "The impact of the neisserial DNA uptake sequence on genome evolution and stability"

Transcription

1 The impact of the neisserial DNA uptake sequence on genome evolution and stability Ole Herman Ambur The Tønjum Group

2 Transformation

3 Neisserial transformation requires: DNA uptake sequence (DUS) Transformation apparatus, pili etc. Recombination components

4 DNA uptake sequence -DUS ATGCCGTCTGAA approx copies N. meningitidis Z2491

5 Bacterial sex

6 Transformation, like sex, is everywhere! Naturally competent prokaryotes (Johnsborg et al., 2007): Methanobacterium thermoautotrophicum Methanococcus voltae Deinococcus radioduransa Thermus aquaticus Thermus caldophilus Thermus flavus Thermus thermophilus Nostoc muscorum Synechococcus elongatusb Synechocystis spp.c Thermosynechococcus elongatus Chlorobium limicola Chlorobium tepidum Agrobacterium tumefaciens Methylobacterium organophilum Bradyrhizobium japonicumd Achromobacter spp. Eikenella corrodens Kingella denitrificans Kingella kingae Neisseria gonorrhoeae Neisseria meningitidis Ralstonia solanacearum Thiobacillus thioparus Thiobacillus sp. strain Y Acinetobacter baylyi Acinetobacter calcoaceticus Actinobacillus actinomycetemcomitans Actinobacillus pleuropneumoniae Aggregatibacter aphrophiluse Azotobacter vinelandii Cardiobacterium hominis Haemophilus influenzae Haemophilus parainfluenzae Haemophilus parasuis Legionella pneumophila Moraxella spp. Pseudomonas fluorescens Pseudomonas stutzeri and related species Pseudomonas spp.f Vibrio cholerae Vibrio parahaemolyticus Vibrio spp. Campylobacter coli Campylobacter jejuni Helicobacter pylori Bacillus amyloliquefaciens Bacillus licheniformis Bacillus subtilis Lactobacillus lactis Leuconostoc carnosum Streptococcus pneumoniae Streptococcus mitis Streptococcus oralis Streptococcus crista Streptococcus infantis Streptococcus gordonii Streptococcus sanguinisg Streptococcus anginosus Streptococcus intermedius Streptococcus constellatus Streptococcus thermophilush Streptococcus bovis Streptococcus mutans Thermoactinomyces vulgaris Mycobacterium smegmatis Streptomyces spp.

7 DNA uptake sequence DUS

8 DUS was identified in 1988 as a 10-mer 10-mer 12-mer degenerate Goodman and Scocca, 1988

9 DUS revised Transformation frequencies (10-7) M c M 400 Gc N400 ** * * * # # 10 p 0-DUS p 8-DUS p 9-DUS p 10-DUS p 11-DUS p 12-DUS Donor DNA 12 ** * # Ambur et al. J. Bacteriol. 2007

10 DUS inverted repeat forms transcriptional terminator/attenuator DUS 5 - A U A C G A U G C C G U C U G A A A U C G A U U C A G A C G G C A U U U A U U -OH 3 Complement DUS A U G C A 5 - A A G U C U G C C G U A A U A C G U U C A G A C G G C A U U U A U U -OH 3

11 A single DUS is sufficient for transformation 100 Mc MC58 Mc M400 Transformation frequencies (10-7) log 10 1 p0 psingle pdr pir Donor DNA Ambur et al. J. Bacteriol. 2007

12 DUS and neisserial sex Outline/hypothesis: Analysis of DUS conservation and distribution may reveal its evolutionary history and perhaps that of transformation/sex itself

13 M-GCAT global alignment of 6 neisserial genomes Treangen, Ambur et al., Genome Biology 9:2, 2008

14 6 neisserial genomes compared Genome Genome No of DUS distribution size (kb) genes % in CDS % alignment cdus Total DUS -1 N. men. Z , N. men. MC , N. men. FAM , N. men , N. gonorrhoeae , N. lactamica , Core genome More DUS in N. lactamica

15 Phylogeneny with strong consensus (+/ nt) surrounding DUS ubiquitous gene alignment entire concatenated multiple alignment Strong consensus phylogenetic tree that may guide us in detection of recombination

16 Two hypotheses for the manifestation of DUS DUS emerge by mutation DUS emerge by recombination (and sex)

17 DUS distribution Is there an association between DUS distribution and the recombinogenic past of neisserial genomes?

18 Comparing sequence columns DUS

19 DUS more conserved but in permissive regions DUS

20 DUS conservation 71% of the DUS in the multiple alignment were exactly conserved in all genomes. DUS, much more conserved (97%) than the average conserved sequence (~85%)

21 Purifying selection or mutation selection balanceof DUS non-degenerate, in all the other 5 genomes

22 Program: GENECONV (Sawyer, 1989) Detection of gene conversion elements finds the most likely candidates for aligned gene conversion events (signs of recombination) between pairs of sequences

23 DUS distribution is tuned N. meningitidis Z2491 Average DUS distance Ca nucleotides Average conversion fragment length Ca nucleotides

24 Signs of recombination DUS facing sequences with no similarity to DUS

25 2 lines of evidence for recombinational acquisition of DUS in populations The spacing of DUS matches the conversion fragment lengths Unique DUS in sequence columns are complete and show origin by recombination

26 DUS outside the core genome? Are DUS present in new laterally transferred sequences? New= present only in one genome (34 genes) Are DUS present in old lost sequences? Lost=absent in one and only one genome (29 genes)

27 DUS are absent in newly acquired and old lost sequences No. of DUS No. of genes p-value Ubiquitous genes New genes 0 34 <10-7 Lost genes 0 29 <10-6

28 Genetic variation is generated without DUS Phase variable genes are DUS-less Genes encoding outer membrane proteins are DUS-less

29 DUS and genome stability DUS are overrepresented in the core genome..underrepresented in regions under selective pressure driving diversification..totally absent in both recently acquired genes and recently lost genes

30 Summary of DUS evolution DUS is a 12-mer IR-DUS terminate/attenuate transcription Inter DUS distance is tuned Unique DUS suggest origin by recombination DUS are absent outside core genome

31 Sources of variation Spontaneous mutation Mutation rate modifiers (hypermutators) Mobile genetic elements (HGT) Evolved mechanisms for genetic variation Intrachromosomal recombination pili, phase variable genes encoding surface prot Antigenic variation Nucleotide tracts

32 Measuring genome instability Monitoring of phase variation Polynucleotide tract expansion and retraction Mutator phenotypes Effects of stress

33 DNA repair Davidsen and Tønjum, 2006

34 Acknowledgements Tone Tønjum Kristian Alfsnes Seetha Balasingham Tonje Davidsen Stephan Frye Håvard Homberset Sheba Lothe Emma Lång International: Eduardo Rocha (Pasteur Institute) Todd Treangen (ABI, Paris) CMBN Rognes group Koomey group Bjørås group Ottersen group Forskerlinje Marie Bergheim Ohr Jarle Breivik

The Evolution of DNA Uptake Sequences in Neisseria Genus from Chromobacteriumviolaceum. Cory Garnett. Introduction

The Evolution of DNA Uptake Sequences in Neisseria Genus from Chromobacteriumviolaceum. Cory Garnett. Introduction The Evolution of DNA Uptake Sequences in Neisseria Genus from Chromobacteriumviolaceum. Cory Garnett Introduction In bacteria, transformation is conducted by the uptake of DNA followed by homologous recombination.

More information

the Environment Bacterial Gene Transfer by Natural Genetic Transformation in Cyanobacteria...570

the Environment Bacterial Gene Transfer by Natural Genetic Transformation in Cyanobacteria...570 MICROBIOLOGICAL REVIEWS, Sept. 1994, p. 563-602 Vol. 58, No. 3 0146-0749/94/$04.00+0 Copyright C 1994, American Society for Microbiology Bacterial Gene Transfer by Natural Genetic Transformation in the

More information

Introduction and Objectives:

Introduction and Objectives: Introduction and Objectives: My research program asks why bacteria are naturally competent (able to take up DNA fragments from their surroundings). Answering this question will determine whether competence

More information

2 Genome evolution: gene fusion versus gene fission

2 Genome evolution: gene fusion versus gene fission 2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,

More information

EUCAST. Linezolid Rationale for the EUCAST clinical breakpoints, version th November 2005

EUCAST. Linezolid Rationale for the EUCAST clinical breakpoints, version th November 2005 Linezolid - Rationale document (http://www.eucast.org) 1 (9) Linezolid Rationale for the clinical breakpoints, version 1.0 18 th November 2005 Introduction Linezolid is the only clinically available representative

More information

Product Catalogue 2016 Clinical and Industrial Microbiology

Product Catalogue 2016 Clinical and Industrial Microbiology Acinetobacter baumannii ATCC BAA-747 * 89141 Acinetobacter baumannii ATCC 19606 * 89174 Actinomyces odontolyticus ATCC 17929 * 89114 Aeromonas hydrophila ATCC 7966 * 89119 Aeromonas hydrophila ATCC 35654

More information

Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria)

Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria) Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria) (don t study Concept 27.2) Some phyla Remember: Bacterial cell structure and shapes 1 Usually very small but some are unusually

More information

Product Catalogue 2015 Clinical and Industrial Microbiology

Product Catalogue 2015 Clinical and Industrial Microbiology Acinetobacter baumannii ATCC BAA-747 * 89141 Actinomyces odontolyticus ATCC 17929 * 89114 Aeromonas hydrophila ATCC 7966 * 89119 Aggregatibacter aphrophilus ATCC 7901 * 89091 Aspergillus brasiliensis ATCC

More information

Gentamicin Rationale for the EUCAST clinical breakpoints, version th February, 2009

Gentamicin Rationale for the EUCAST clinical breakpoints, version th February, 2009 Gentamicin Rationale for the EUCAST clinical breakpoints, version 1.2 16 th February, 2009 Introduction The aminoglycosides are a group of naturally occurring or semi-synthetic compounds with bactericidal

More information

The Minimal-Gene-Set -Kapil PHY498BIO, HW 3

The Minimal-Gene-Set -Kapil PHY498BIO, HW 3 The Minimal-Gene-Set -Kapil Rajaraman(rajaramn@uiuc.edu) PHY498BIO, HW 3 The number of genes in organisms varies from around 480 (for parasitic bacterium Mycoplasma genitalium) to the order of 100,000

More information

Microbial Typing by Machine Learned DNA Melt Signatures

Microbial Typing by Machine Learned DNA Melt Signatures Microbial Typing by Machine Learned DNA Melt Signatures Nadya Andini 1, Bo Wang 2, Pornpat Athamanolap 3, Justin Hardick 4, Billie J. Masek 5, Simone Thair 1, Annie Hu 1, Gideon Avornu 5, Stephen Peterson

More information

The type IV pilus - WWU Münster Kalvi Institute,

The type IV pilus - WWU Münster Kalvi Institute, The type IV pilus - a multifunctional bacterial motor Berenike Maier WWU Münster Kalvi Institute, 1.2.2011 1 Type IV pili are ubiquitous multifunctional polymers 2 Type IV pili are ubiquitous multifunctional

More information

Tetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009

Tetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009 Tetracycline Rationale for the EUCAST clinical breakpoints, version 1.0 20 th November 2009 Introduction The natural tetracyclines, including tetracycline, chlortetracycline, oxytetracycline and demethylchlortetracycline

More information

Introduction to Bioinformatics Integrated Science, 11/9/05

Introduction to Bioinformatics Integrated Science, 11/9/05 1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction

More information

Additional file 1 for Structural correlations in bacterial metabolic networks by S. Bernhardsson, P. Gerlee & L. Lizana

Additional file 1 for Structural correlations in bacterial metabolic networks by S. Bernhardsson, P. Gerlee & L. Lizana Additional file 1 for Structural correlations in bacterial metabolic networks by S. Bernhardsson, P. Gerlee & L. Lizana Table S1 The species marked with belong to the Proteobacteria subset and those marked

More information

Coevolution of DNA Uptake Sequences and Bacterial Proteomes

Coevolution of DNA Uptake Sequences and Bacterial Proteomes Coevolution of DNA Uptake Sequences and Bacterial Proteomes W. A. Findlay* and R. J. Redfield *Institute for Biological Sciences, National Research Council of Canada, Ottawa, Ontario, Canada; and Department

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.

Microbial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination. Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial

More information

Whole Genome based Phylogeny

Whole Genome based Phylogeny Whole Genome based Phylogeny Johanne Ahrenfeldt PhD student DTU Bioinformatics Short about me Johanne Ahrenfeldt johah@dtu.dk PhD student at DTU Bioinformatics Whole Genome based Phylogeny Graduate Engineer

More information

Most common dose (mg) 1 g x 3 1 g x mg -1.0 g x 3 1 g x mg -1 g x mg -1 g x 3

Most common dose (mg) 1 g x 3 1 g x mg -1.0 g x 3 1 g x mg -1 g x mg -1 g x 3 Meropenem Rationale for the EUCAST clinical breakpoints, version 1.5 1 st June 2009 Introduction Meropenem is a carbapenem, available only for parenteral use. Meropenem is relevant for therapy of septicaemia,

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Evolutionary Analysis by Whole-Genome Comparisons

Evolutionary Analysis by Whole-Genome Comparisons JOURNAL OF BACTERIOLOGY, Apr. 2002, p. 2260 2272 Vol. 184, No. 8 0021-9193/02/$04.00 0 DOI: 184.8.2260 2272.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Evolutionary Analysis

More information

Introduction to polyphasic taxonomy

Introduction to polyphasic taxonomy Introduction to polyphasic taxonomy Peter Vandamme EUROBILOFILMS - Third European Congress on Microbial Biofilms Ghent, Belgium, 9-12 September 2013 http://www.lm.ugent.be/ Content The observation of diversity:

More information

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.

Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p. READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

Bacterial clasification

Bacterial clasification Bacterial clasification Describe bacterial classification: List taxon levels Define taxonomy and identification Describe principles of taxonomy Explain classification of bacteria Taxonomy the science of

More information

Microbiology Helmut Pospiech

Microbiology Helmut Pospiech Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition

More information

Subsystem: Succinate dehydrogenase

Subsystem: Succinate dehydrogenase Subsystem: Succinate dehydrogenase Olga Vassieva Fellowship for Interpretation of Genomes The super-macromolecular respiratory complex II (succinate:quinone oxidoreductase) couples the oxidation of succinate

More information

MICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012

MICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012 MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular

More information

Figure S1. Pangenome plots of ten recombining bacterial species based on RAST annotated

Figure S1. Pangenome plots of ten recombining bacterial species based on RAST annotated Figure S1 Figure S2 Supplementary Figure legends Figure S1. Pangenome plots of ten recombining bacterial species based on RAST annotated genomes. To generate these plots all strains within a species were

More information

Genetic Basis of Variation in Bacteria

Genetic Basis of Variation in Bacteria Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material

More information

Fitness constraints on horizontal gene transfer

Fitness constraints on horizontal gene transfer Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:

More information

Rapid Test Methods. Bacteria Presumptive ID Additional Tests for Definitive ID

Rapid Test Methods. Bacteria Presumptive ID Additional Tests for Definitive ID Latest Update... Rapid Tests from Hardy Diagnostics which comply with the latest update of CLSI s Standards M35-A2 for the Rapid ID of Bacteria and Yeast. Rapid Test Methods Bacteria Presumptive ID Additional

More information

Tree of Life: An Introduction to Microbial Phylogeny Beverly Brown, Sam Fan, LeLeng To Isaacs, and Min-Ken Liao

Tree of Life: An Introduction to Microbial Phylogeny Beverly Brown, Sam Fan, LeLeng To Isaacs, and Min-Ken Liao Microbes Count! 191 Tree of Life: An Introduction to Microbial Phylogeny Beverly Brown, Sam Fan, LeLeng To Isaacs, and Min-Ken Liao Video VI: Microbial Evolution Introduction Bioinformatics tools allow

More information

ABSTRACT. As a result of recent successes in genome scale studies, especially genome

ABSTRACT. As a result of recent successes in genome scale studies, especially genome ABSTRACT Title of Dissertation / Thesis: COMPUTATIONAL ANALYSES OF MICROBIAL GENOMES OPERONS, PROTEIN FAMILIES AND LATERAL GENE TRANSFER. Yongpan Yan, Doctor of Philosophy, 2005 Dissertation / Thesis Directed

More information

The use of gene clusters to infer functional coupling

The use of gene clusters to infer functional coupling Proc. Natl. Acad. Sci. USA Vol. 96, pp. 2896 2901, March 1999 Genetics The use of gene clusters to infer functional coupling ROSS OVERBEEK*, MICHAEL FONSTEIN, MARK D SOUZA*, GORDON D. PUSCH*, AND NATALIA

More information

Microbiological Evaluation of the New VITEK 2 Neisseria-Haemophilus Identification Card

Microbiological Evaluation of the New VITEK 2 Neisseria-Haemophilus Identification Card JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2007, p. 3493 3497 Vol. 45, No. 11 0095-1137/07/$08.00 0 doi:10.1128/jcm.00953-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Microbiological

More information

SENCA: A codon substitution model to better estimate evolutionary processes

SENCA: A codon substitution model to better estimate evolutionary processes SENCA: A codon substitution model to better estimate evolutionary processes Fanny Pouyet Marc Bailly-Bechet, Dominique Mouchiroud and Laurent Guéguen LBBE - UCB Lyon - UMR 5558 June 2015, Porquerolles,

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Molecular Evolution & the Origin of Variation

Molecular Evolution & the Origin of Variation Molecular Evolution & the Origin of Variation What Is Molecular Evolution? Molecular evolution differs from phenotypic evolution in that mutations and genetic drift are much more important determinants

More information

Considerations with Antibiotic Therapy PART

Considerations with Antibiotic Therapy PART Considerations with Antibiotic Therapy PART 1 The Wonderful World of Microbiology 1 Despite the promises of the household-products industry, almost every surface is covered in microorganisms almost all

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

Most common dose (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1. Maximum dose schedule (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1

Most common dose (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1. Maximum dose schedule (mg) 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 1g x 1 Ertapenem Rationale for the EUCAST clinical breakpoints, version 1.3 1 st June 2009 Introduction Ertapenem is a carbapenem, available only for parenteral use. Ertapenem is relevant for therapy of septicaemia,

More information

rho Is Not Essential for Viability or Virulence in Staphylococcus aureus

rho Is Not Essential for Viability or Virulence in Staphylococcus aureus ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2001, p. 1099 1103 Vol. 45, No. 4 0066-4804/01/$04.00 0 DOI: 10.1128/AAC.45.4.1099 1103.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved.

More information

Essentiality in B. subtilis

Essentiality in B. subtilis Essentiality in B. subtilis 100% 75% Essential genes Non-essential genes Lagging 50% 25% Leading 0% non-highly expressed highly expressed non-highly expressed highly expressed 1 http://www.pasteur.fr/recherche/unites/reg/

More information

IS IT MORE TO BACTERIAL SEX THAN EXPLORING THE FITNESS LANDSCAPE OF OTHER ORGANISMS?

IS IT MORE TO BACTERIAL SEX THAN EXPLORING THE FITNESS LANDSCAPE OF OTHER ORGANISMS? Old Herborn University Seminar Monograph 25: Bacterial species as partners and pathogens. Editors: Peter J. Heidt, Tore Midtvedt, Volker Rusch, and James Versalovic. Old Herborn University Foundation,

More information

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

CONTROL ORGANISMS ss

CONTROL ORGANISMS ss CONTROL ORGANISMS 032918ss CONTENTS CONTROL ORGANISMS 1 Lyophilized KWIK-STIK & LYFO DISK 29 Epower 32 Epower CRM 34 EZ-Accu Shot 36 EZ-Accu Shot Select 36 EZ-CFU 38 EZ-CFU One Step 41 EZ-Hydro Shot 40

More information

MECHANISMS OF, AND BARRIERS TO, HORIZONTAL GENE TRANSFER BETWEEN BACTERIA

MECHANISMS OF, AND BARRIERS TO, HORIZONTAL GENE TRANSFER BETWEEN BACTERIA MECHANISMS OF, AND BARRIERS TO, HORIZONTAL GENE TRANSFER BETWEEN BACTERIA Christopher M. Thomas* and Kaare M. Nielsen Abstract Bacteria evolve rapidly not only by mutation and rapid multiplication, but

More information

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification

Microbial Taxonomy. Classification of living organisms into groups. A group or level of classification Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think

More information

# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp

# shared OGs (spa, spb) Size of the smallest genome. dist (spa, spb) = 1. Neighbor joining. OG1 OG2 OG3 OG4 sp sp sp Bioinformatics and Evolutionary Genomics: Genome Evolution in terms of Gene Content 3/10/2014 1 Gene Content Evolution What about HGT / genome sizes? Genome trees based on gene content: shared genes Haemophilus

More information

Structural Proteomics of Eukaryotic Domain Families ER82 WR66

Structural Proteomics of Eukaryotic Domain Families ER82 WR66 Structural Proteomics of Eukaryotic Domain Families ER82 WR66 NIH Protein Structure Initiative Mission Statement To make the three-dimensional atomic level structures of most proteins readily available

More information

Prokaryotic phylogenies inferred from protein structural domains

Prokaryotic phylogenies inferred from protein structural domains Letter Prokaryotic phylogenies inferred from protein structural domains Eric J. Deeds, 1 Hooman Hennessey, 2 and Eugene I. Shakhnovich 3,4 1 Department of Molecular and Cellular Biology, Harvard University,

More information

TER 26. Preview for 2/6/02 Dr. Kopeny. Bacteria and Archaea: The Prokaryotic Domains. Nitrogen cycle

TER 26. Preview for 2/6/02 Dr. Kopeny. Bacteria and Archaea: The Prokaryotic Domains. Nitrogen cycle Preview for 2/6/02 Dr. Kopeny Bacteria and Archaea: The Prokaryotic Domains TER 26 Nitrogen cycle Mycobacterium tuberculosis Color-enhanced images shows rod-shaped bacterium responsible for tuberculosis

More information

Quantitative Exploration of the Occurrence of Lateral Gene Transfer Using Nitrogen Fixation Genes as a Case Study

Quantitative Exploration of the Occurrence of Lateral Gene Transfer Using Nitrogen Fixation Genes as a Case Study Lin 1 Quantitative Exploration of the Occurrence of Lateral Gene Transfer Using Nitrogen Fixation Genes as a Case Study by Jason Lin Advisor: Professor Peter Bickel Introduction Under the concept of evolution,

More information

Figure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case)

Figure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case) Chapter 11 The Prokaryotes: Domains Bacteria and Archaea Objective Questions 1) Which of the following are found primarily in the intestines of humans? A) Gram-negative aerobic rods and cocci B) Aerobic,

More information

Correlations between Shine-Dalgarno Sequences and Gene Features Such as Predicted Expression Levels and Operon Structures

Correlations between Shine-Dalgarno Sequences and Gene Features Such as Predicted Expression Levels and Operon Structures JOURNAL OF BACTERIOLOGY, Oct. 2002, p. 5733 5745 Vol. 184, No. 20 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.20.5733 5745.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Correlations

More information

10ml. Set (4 poly and 17 monovalent, 2ml each)

10ml. Set (4 poly and 17 monovalent, 2ml each) 120314TR Bordetella pertussis Antigen 10ml Contents 1 Bordetella pertussis Antigen 1 Clostridium perfringens Type A 2 Escherichia coli 5 Legionella pneumophila 5 Listeria monocytogenes 6 Pseudomonas aeruginosa

More information

The Prokaryotes: Domains Bacteria and Archaea

The Prokaryotes: Domains Bacteria and Archaea PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 11 The Prokaryotes: Domains Bacteria and Archaea Table 11.1 Classification of Selected Prokaryotes*

More information

1. Which of the following species have strains that are capable of undergoing the process of conjugation?

1. Which of the following species have strains that are capable of undergoing the process of conjugation? Biology 3340 Summer 2005 Second Examination Version A Name Be sure to put your name on the mark-sense sheet as well Directions: Write your name in the correct space on the mark-sense sheet and the exam

More information

Universiteit van Pretoria University of Pretoria. Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March Examiners: Dr L Moleleki

Universiteit van Pretoria University of Pretoria. Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March Examiners: Dr L Moleleki Universiteit van Pretoria University of Pretoria Mikrobiologie 251 Toets Maart 2012 Microbiology 251 Test March 2012 Tyd: 1 uur Time: 1 hour Eksaminatore: Dr L Moleleki Examiners: Dr L Moleleki Beantwoord

More information

MiGA: The Microbial Genome Atlas

MiGA: The Microbial Genome Atlas December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From

More information

Gene Family Content-Based Phylogeny of Prokaryotes: The Effect of Criteria for Inferring Homology

Gene Family Content-Based Phylogeny of Prokaryotes: The Effect of Criteria for Inferring Homology Syst. Biol. 54(2):268 276, 2005 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150590923335 Gene Family Content-Based Phylogeny of Prokaryotes:

More information

2/25/2013. Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes

2/25/2013. Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes 1 2 3 4 5 6 7 8 9 10 11 12 Chapter 11 The Prokaryotes: Domains Bacteria and Archaea The Prokaryotes Domain Bacteria Proteobacteria From the mythical Greek god Proteus, who could assume many shapes Gram-negative

More information

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.

Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species. Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four

More information

Nitroxoline Rationale for the NAK clinical breakpoints, version th October 2013

Nitroxoline Rationale for the NAK clinical breakpoints, version th October 2013 Nitroxoline Rationale for the NAK clinical breakpoints, version 1.0 4 th October 2013 Foreword NAK The German Antimicrobial Susceptibility Testing Committee (NAK - Nationales Antibiotika-Sensitivitätstest

More information

Subsystem: TCA Cycle. List of Functional roles. Olga Vassieva 1 and Rick Stevens 2 1. FIG, 2 Argonne National Laboratory and University of Chicago

Subsystem: TCA Cycle. List of Functional roles. Olga Vassieva 1 and Rick Stevens 2 1. FIG, 2 Argonne National Laboratory and University of Chicago Subsystem: TCA Cycle Olga Vassieva 1 and Rick Stevens 2 1 FIG, 2 Argonne National Laboratory and University of Chicago List of Functional roles Tricarboxylic acid cycle (TCA) oxidizes acetyl-coa to CO

More information

Midterm Exam #1 : In-class questions! MB 451 Microbial Diversity : Spring 2015!

Midterm Exam #1 : In-class questions! MB 451 Microbial Diversity : Spring 2015! Midterm Exam #1 : In-class questions MB 451 Microbial Diversity : Spring 2015 Honor pledge: I have neither given nor received unauthorized aid on this test. Signed : Name : Date : TOTAL = 45 points 1.

More information

INTERPRETATION OF THE GRAM STAIN

INTERPRETATION OF THE GRAM STAIN INTERPRETATION OF THE GRAM STAIN DISCLOSURE Relevant relationships with commercial entities none Potential for conflicts of interest within this presentation none Steps taken to review and mitigate potential

More information

OUTLINE INTRODUCTION TO CLSI M35-A2 INTRODUCTION TO CLSI M35-A2 BENEFITS OF RAPID RESULTS

OUTLINE INTRODUCTION TO CLSI M35-A2 INTRODUCTION TO CLSI M35-A2 BENEFITS OF RAPID RESULTS Overview of CLSI Document M35-A2 For Bench-level Identification of Clinically-significant Microorganisms OUTLINE I. Introduction of concept II. III. Major players Application one Erik Munson Clinical Microbiology

More information

Phylogenetic analysis of Cytochrome P450 Structures. Gowri Shankar, University of Sydney, Australia.

Phylogenetic analysis of Cytochrome P450 Structures. Gowri Shankar, University of Sydney, Australia. Phylogenetic analysis of Cytochrome P450 Structures Gowri Shankar, University of Sydney, Australia. Overview Introduction Cytochrome P450 -- Structures. Results. Conclusion. Future Work. Aims How the structure

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

Microbiological Testing Summary

Microbiological Testing Summary BACTERICIDAL ACTIVITY EN 1276 - Chemical disinfectants and antiseptics - Quantitative suspension test for the evaluation of bactericidal activity of chemical disinfectants and antiseptics used in food,

More information

Multifractal characterisation of complete genomes

Multifractal characterisation of complete genomes arxiv:physics/1854v1 [physics.bio-ph] 28 Aug 21 Multifractal characterisation of complete genomes Vo Anh 1, Ka-Sing Lau 2 and Zu-Guo Yu 1,3 1 Centre in Statistical Science and Industrial Mathematics, Queensland

More information

Introduction to the SNP/ND concept - Phylogeny on WGS data

Introduction to the SNP/ND concept - Phylogeny on WGS data Introduction to the SNP/ND concept - Phylogeny on WGS data Johanne Ahrenfeldt PhD student Overview What is Phylogeny and what can it be used for Single Nucleotide Polymorphism (SNP) methods CSI Phylogeny

More information

HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS

HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae

More information

Genome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.

Genome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting. Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction

More information

Assist. Prof. Martina Šeruga Musić acad. year 2016/17

Assist. Prof. Martina Šeruga Musić acad. year 2016/17 Assist. Prof. Martina Šeruga Musić acad. year 2016/17 PHYTOPATHOGENIC BACTERIA there are more than 100 species of known phytopathogenic bacteria genera Agrobacterium, Erwinia, Ralstonia, Pseudomonas, Xanthomonas,

More information

Bacterial Classifications Derived from RecA Protein Sequence Comparisons

Bacterial Classifications Derived from RecA Protein Sequence Comparisons JOURNAL OF BACTERIOLOGY, Dec. 1995, p. 6881 6893 Vol. 177, No. 23 0021-9193/95/$04.00 0 Copyright 1995, American Society for Microbiology Bacterial Classifications Derived from RecA Protein Sequence Comparisons

More information

Principles of Genetics

Principles of Genetics Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Comparison of trap formation by fresh and autoclaved dung samples. The fresh or autoclaved dung was diluted with water and placed on a water agar plate within

More information

Chapter 19. Microbial Taxonomy

Chapter 19. Microbial Taxonomy Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)

More information

The RecA Protein as a Model Molecule for Molecular Systematic Studies of Bacteria: Comparison of Trees of RecAs and 16S rrnas from the Same Species

The RecA Protein as a Model Molecule for Molecular Systematic Studies of Bacteria: Comparison of Trees of RecAs and 16S rrnas from the Same Species J Mol Evol (1995) 41:1105-1123 jou A or MOLECULAR IEVOLUTION Springer-Verlag New York Inc. 1995 The RecA Protein as a Model Molecule for Molecular Systematic Studies of Bacteria: Comparison of Trees of

More information

CHN62: REPORTING OF MICROBIOLOGY RESULTS

CHN62: REPORTING OF MICROBIOLOGY RESULTS CHN62: 1.1 Introduction This SOP provides guidance on reporting of all the microbiological results in the Microbiology laboratory for CHAIN study. 1.2 Purpose This SOP will aid in a standard reporting

More information

THE ROLE OF HORIZONTAL GENE TRANSFER IN BACTERIAL EVOLUTION

THE ROLE OF HORIZONTAL GENE TRANSFER IN BACTERIAL EVOLUTION THE ROLE OF HORIZONTAL GENE TRANSFER IN BACTERIAL EVOLUTION A Dissertation Presented to The Academic Faculty by Alejandro Caro-Quintero In Partial Fulfillment of the Requirements for the Degree Doctor

More information

Retail Catalog 39th Edition Supplemental Information Individual Microorganisms Price Microorganism Description

Retail Catalog 39th Edition Supplemental Information Individual Microorganisms Price Microorganism Description LYFO DISK KWIK-STIK Vial 6 Pk Pk Individual Microorganisms Price Microorganism Description ode BSL omment 049L 049K 049P 0645L 0645K 0645P Aggregatibacter aphrophilus AT 4997 D formerly Haemophilus paraphrophilus

More information

Creating a Dichotomous Key

Creating a Dichotomous Key Dichotomous Keys A tool used that allows users to determine the identity of unknown species Keys consist of a series of choices, where the user selects from a series of connected pairs Each pair of choices

More information

Deposited research article Short segmental duplication: parsimony in growth of microbial genomes Li-Ching Hsieh*, Liaofu Luo, and Hoong-Chien Lee

Deposited research article Short segmental duplication: parsimony in growth of microbial genomes Li-Ching Hsieh*, Liaofu Luo, and Hoong-Chien Lee This information has not been peer-reviewed. Responsibility for the findings rests solely with the author(s). Deposited research article Short segmental duplication: parsimony in growth of microbial genomes

More information

Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: A new family of genes responsible for autoinducer production

Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: A new family of genes responsible for autoinducer production Proc. Natl. Acad. Sci. USA Vol. 96, pp. 1639 1644, February 1999 Microbiology Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: A new family of genes responsible for autoinducer

More information

EZ-COMP EZ-COMP For Training and Proficiency Testing Product Details

EZ-COMP EZ-COMP For Training and Proficiency Testing Product Details EZ-COMP For Training and Proficiency Testing Mixed microorganism populations Identified by codes rather than descriptions Refrigerated storage Traceable to reference culture Product warranty Product Details

More information

Comparative Genomics Background and Strategies. Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee

Comparative Genomics Background and Strategies. Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee Comparative Genomics Background and Strategies Nitya Sharma, Emily Rogers, Kanika Arora, Zhiming Zhao, Yun Gyeong Lee Introduction Why comparative genomes? h"p://www.ensembl.org/info/about/species.html

More information

Base Composition Skews, Replication Orientation, and Gene Orientation in 12 Prokaryote Genomes

Base Composition Skews, Replication Orientation, and Gene Orientation in 12 Prokaryote Genomes J Mol Evol (1998) 47:691 696 Springer-Verlag New York Inc. 1998 Base Composition Skews, Replication Orientation, and Gene Orientation in 12 Prokaryote Genomes Michael J. McLean, Kenneth H. Wolfe, Kevin

More information

Approximate Search on Protein Structures for Identification of Horizontal Gene Transfer in Bacteria

Approximate Search on Protein Structures for Identification of Horizontal Gene Transfer in Bacteria Proceedings of the Ninth Symposium on Abstraction, Reformulation and Approximation Approximate Search on Protein Structures for Identification of Horizontal Gene Transfer in Bacteria Swetha Billa 1, Mark

More information

Plasmids of Neisseria gonorrhoeae and Other Neisseria Species

Plasmids of Neisseria gonorrhoeae and Other Neisseria Species CLINICAL MICROBIOLOGY REVIEWS, Apr. 1989, p. S18-S23 0893-8512/89/OSOS18-06$02.00/0 Copyright 1989, American Society for Microbiology Vol. 2, Suppl. Plasmids of Neisseria gonorrhoeae and Other Neisseria

More information

Objects of the Medical Microbiology revision a) Pathogenic microbes (causing diseases of human beings or animals) b) Normal microflora (microbes commo

Objects of the Medical Microbiology revision a) Pathogenic microbes (causing diseases of human beings or animals) b) Normal microflora (microbes commo Institute for Microbiology, Medical Faculty of Masaryk University and St. Anna Faculty Hospital in Brno Miroslav Votava MORPHOLOGY AND STRUCTURE OF BACTERIAL CELL The 2nd lecture for 2nd-year students

More information

Our product offering. The ATCC Licensed Derivative Program

Our product offering. The ATCC Licensed Derivative Program Our product offering Currently MECCONTI offers three different product lines of lyophilized micro-organisms: MicroSwabs: A MicroSwab consists of a lyophilized pellet of a single micro-organism strain inside

More information

The two daughter cells are genetically identical to each other and the parent cell.

The two daughter cells are genetically identical to each other and the parent cell. Prokaryote Growth and Reproduction This micrograph shows a bacillus bacteria (probably E. coli) undergoing binary fission. This is a form of asexual reproduction. During prokaryotic binary fission, as

More information

Rise and Fall of Mutator Bacteria

Rise and Fall of Mutator Bacteria Rise and Fall of Mutator Bacteria The Evolution of Mutation Rates in Bacteria Yoav Ram Hadany Evolutionary Theory Lab 29 May 2011 Bacteria Bacteria are unicellular, haploid and asexual Reproduce by binary

More information

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines

Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large

More information