SENCA: A codon substitution model to better estimate evolutionary processes
|
|
- Tiffany Anthony
- 5 years ago
- Views:
Transcription
1 SENCA: A codon substitution model to better estimate evolutionary processes Fanny Pouyet Marc Bailly-Bechet, Dominique Mouchiroud and Laurent Guéguen LBBE - UCB Lyon - UMR 5558 June 2015, Porquerolles, France.
2 Codon Usage Bias - CUB Lysine codon usage in bacteria % of codons AAA AAG 20 0 A.dehalogenans B.radiodurans A.aeolicus E.coli B.aphidicola E.coli Lysine Usage sense codons, 20 amino acids Genes Number relative frequency of AAA codon 2/16
3 CUB How to measure it? Origins of the CUB: mutational vs. selective explanations. related trna concentration (um) Objectives: Disentangling the two hypotheses Codons usage (frequency %) Modelling evolutive processes explaining the observed CUB: at the nucleotidic (N), the codons (C) and the AA layers (A). 3/16
4 CUB How to measure it? Origins of the CUB: mutational vs. selective explanations. related trna concentration (um) Objectives: Disentangling the two hypotheses Codons usage (frequency %) Modelling evolutive processes explaining the observed CUB: at the nucleotidic (N), the codons (C) and the AA layers (A). 3/16
5 SENCA: Sites Evolution of Nucleotides, Codons and Amino-acids Let s have an example Thr ALANINE Gly Ser GCT GCC GCG GCA CCT CCG PROLINE CCC CCA Glu Asp GTT GTG VALINE GTC GTA Inspired by Yang and Nielsen 2008 (FMutSel). 4/16
6 SENCA: Sites Evolution of Nucleotides, Codons and Amino-acids N layer ALANINE T C GCT GCC C GCG GCA A CCT CCG PROLINE CCC CCA T GTT GTG VALINE GTC GTA κ : transition/transversion π n :equilibrium frequency of nucleotide n [A, C, G, T ]. 4/16
7 SENCA: Sites Evolution of Nucleotides, Codons and Amino-acids C layer ALANINE GCT GCC ALA GCT GCG ALA GCC ALA GCA GCA PRO CCG CCT CCG PROLINE CCC CCA GTT GTG VALINE GTC GTA VAL GTG φ AA (i) : codon i preference intra-aa. I codons(aa) φ AA(I) = 1 4/16
8 SENCA: Sites Evolution of Nucleotides, Codons and Amino-acids A layer ALANINE GCT GCC GCG GCA PRO CCT CCG PROLINE CCC CCA VAL GTT GTG VALINE GTC GTA ω : non-synonymous/synonymous substitution rates ψ AA : preference AA. AA amino acids ψ(aa) = 1 4/16
9 SENCA: Sites Evolution of Nucleotides, Codons and Amino-acids Inspiration and structure ALANINE GCT GCC ALA GCT GCG ALA GCC ALA GCA C T GCA A PRO CCG PRO C CCT CCG PROLINE CCC CCA VAL T GTT GTG VALINE GTC GTA VAL GTG Implemented in Bio++ 4/16
10 SENCA Formulas Instantaneous evolutionary rate from codon i to j : 0 if 2 or 3 different positions, πj k κ f (x i, x j ) synonymous transition, q ij = πj k κωf (x i, x j ) non-synonymous transition, πj k f (x i, x j ) synonymous transversion, πj k ωf (x i, x j ) non-synonymous transversion. with: and: f (x i, x j ) = log( x i x j ) 1 x i x j x i = n aai φ aa (i)ψ aai 5/16
11 Data 21 pathogeneous bacteria and archea From Lassalle et al., PLoS Genet concatenates of approx. 100 genes by increasing ENC (core genome, non-recombinant). Dataset Taxon Name Nb. of strains Nb of concatenates Mean GC % brucella Brucella spp francis Francisella tularensis mycobacterium Mycobacterium tuberculosis complex burk_mal Burkholderia Pseudomallei group yersinia Yersinia pestis clamydia Clamydia trachomatis sulfo Sulfolobus spp burk_ceno Burkholderia cenocepacia complex staph Staphylococcus aureus bifido Bifidobacterium longum acineto Acinetobacter spp campylo Campylobacter jejunii clostridium Clostridium botulinum strep_pyo Streptococcus pyogenes strep_pneu Streptococcus pneumoniae salmonella Salmonella enterica listeria Listeria spp B_anthracis Bacillus antharcis/aureus group nesseiria Nesseiria meningitidis escherichia Escherichia coli helicobacter Helicobacter pylori /16
12 Implementation Non-stationnary and homogeneous run, Intra-species runs: amino-acids preferences stationnary, Optimisation by max. likelihood: 109 parameters. Validation of the model: Comparisons with AIC criterium to standard codons model YN98xF61. SENCA is better in 68 over 78 concats. Exceptions are: 2 concats. of Brucella spp. and Burkholderia peusomallei, 1 of Salmonella enterica and Yersinia pestis, all of Sulfolobus spp. 7/16
13 Implementation Non-stationnary and homogeneous run, Intra-species runs: amino-acids preferences stationnary, Optimisation by max. likelihood: 109 parameters. Validation of the model: Comparisons with AIC criterium to standard codons model YN98xF61. SENCA is better in 68 over 78 concats. Exceptions are: 2 concats. of Brucella spp. and Burkholderia peusomallei, 1 of Salmonella enterica and Yersinia pestis, all of Sulfolobus spp. 7/16
14 What about the CUB? To disentangle between the 2 hypotheses: compute the CUB by comparison with expected if uniform > ENC index. Effective Number of Codons ENC varies between 61 and 20. ENC = 61 ENC = 32 ENC = 20 Strength of CUB 8/16
15 ENC index ENC SENCA OBS clostridium campylo francis staph sulfo B_anthracis listeria strep_pyo helico acineto clamy_trach strep_pneu yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium burk_ceno Burk_mal At equilibrium, frequency of codon i is proportional to: 3 f (i) πi k φ aai (i)n aai ψ aai k=1 > ENC SENCA ENC OBS Species ordered by incr. GC obs 9/16
16 Species ordered by incr. GC obs ENC index ENC N 20 SENCA OBS clostridium campylo francis staph sulfo B_anthracis listeria strep_pyo helico acineto clamy_trach strep_pneu yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium burk_ceno Burk_mal Compute ENCN : 3 f (i) πi k 1 1 > ENCN uniform CUB, k=1 9/16
17 ENC index ENC N C SENCA OBS clostridium campylo francis staph sulfo B_anthracis listeria strep_pyo helico acineto clamy_trach strep_pneu yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium burk_ceno Burk_mal Compute ENC C : f (i) 1 φ aai (i)n aai 1 > ENC C ENC SENCA Species ordered by incr. GC obs 9/16
18 ENC index ENC N C SENCA OBS YN98 clostridium campylo francis staph sulfo B_anthracis listeria strep_pyo helico acineto clamy_trach strep_pneu yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium burk_ceno Burk_mal ENC SENCA ENC OBS < ENC YN98, Is ENC SENCA mostly driven by ENC C? Quantifying. Species ordered by incr. GC obs 9/16
19 Quantification denc SENCA denc C + denc N CUB measured as distance to uniform usage: denc = 61 ENC, High correlation (R = 0.95, p-value<10e-16, Pearson correlation test), Relative importance of C and N: denc C denc SENCA > denc N denc SENCA. C N clostridium campylo francis staph sulfo B_anthracis listeria strep_pyo helico acineto clamy_trach strep_pneu yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium burk_ceno Burk_mal 10/16
20 What about genome composition? GC content 0.8 N C A SENCA OBS YN GC clostridium campylo francis staph sulfo B_anthracis listeria strep_pyo helico acineto clamy_trach strep_pneu yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium burk_ceno Burk_mal GC SENCA < GC obs SENCA combined effects of the 3 layers > AT enrichment at equilibrium. 11/16
21 What about genome composition? GC3 content 0.8 N C A SENCA OBS YN GC clostridium campylo francis staph B_anthracis sulfo listeria acineto strep_pyo clamy_trach strep_pneu helico yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium GC3 SENCA more biased than GC3 YN98 : in agreement with GC3 obs, Which layer has the most important impact on GC bias? burk_ceno Burk_mal 12/16
22 Quantification dgc dgc N + dgc C + dgc A dgc N + dgcc + dgca GC bias measured as dgc = 0.5 GC (distance to uniform composition). High correlation (R=0.99, p-value<10e-16, Pearson correlation test) dgc* Slope=1.04, intersect fixed to 0. 13/16
23 Quantification dgc dgc N + dgc C + dgc A A C N clostridium campylo francis staph sulfo B_anthracis listeria strep_pyo helico acineto clamy_trach strep_pneu yersinia escherichia salmo neisseria brucella bifido_longum mycobacterium N, C and A impact on GC. burk_ceno Burk_mal 14/16
24 Conclusion Methodologically: Non-stationary model Multilayered model New statistical tools: GC and ENC of layers Biologically: Bias towards AT at equilibrium Importance of N, C and A for genomic bias. CUB mostly due to C. 15/16
25 Perspectives Extension of the model: Gene expression factor : measure of CUB intensity within a genome Biological questions: Influence on ω estimation, HIV Human interaction and consequences on HIV CUB, Can we detect recombination patterns: BGC? Thank you for your attention! Acknowledgments: Laurent Guéguen, Marc Bailly-Bechet, Dominique Mouchiroud, Florent Lassalle, Vincent Daubin 16/16
26 Omega comparisons SENCA YN98 17/16
27 SENCA: Site Evolution of Nucleotides, Codons and Amino-acids Implementation and parameters SENCA with 65 parameters: πj k equil. frequency of mutational process of j k κ transition/transversion φ aa (i) codon preference. For each AA, we have: i φ aa(i) = 1 n aai degenerescence of the AA ω = dn ds mutation rate of non-synynymous dn and synonymous ds ψ aa AA preference. We have: aa ψ aa = 1 In Bio++ ( Optimisation by max. likelihood. Homogeneous, non-stationary analysis (ψ aa stat. because intra-species analyses) 18/16
SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA
SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.
More informationMICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012
MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular
More informationSequence Divergence & The Molecular Clock. Sequence Divergence
Sequence Divergence & The Molecular Clock Sequence Divergence v simple genetic distance, d = the proportion of sites that differ between two aligned, homologous sequences v given a constant mutation/substitution
More informationSupporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-
Supporting Information for Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Dependence and Its Ability to Chelate Multiple Nutrient Transition Metal Ions Rose C. Hadley,
More informationSupplementary Information for
Supplementary Information for Evolutionary conservation of codon optimality reveals hidden signatures of co-translational folding Sebastian Pechmann & Judith Frydman Department of Biology and BioX, Stanford
More informationMicrobial Typing by Machine Learned DNA Melt Signatures
Microbial Typing by Machine Learned DNA Melt Signatures Nadya Andini 1, Bo Wang 2, Pornpat Athamanolap 3, Justin Hardick 4, Billie J. Masek 5, Simone Thair 1, Annie Hu 1, Gideon Avornu 5, Stephen Peterson
More informationpart 4: phenomenological load and biological inference. phenomenological load review types of models. Gαβ = 8π Tαβ. Newton.
2017-07-29 part 4: and biological inference review types of models phenomenological Newton F= Gm1m2 r2 mechanistic Einstein Gαβ = 8π Tαβ 1 molecular evolution is process and pattern process pattern MutSel
More informationEdinburgh Research Explorer
Edinburgh Research Explorer Codon usage patterns in Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens; a review of the considerable
More informationPractical Bioinformatics
5/2/2017 Dictionaries d i c t i o n a r y = { A : T, T : A, G : C, C : G } d i c t i o n a r y [ G ] d i c t i o n a r y [ N ] = N d i c t i o n a r y. h a s k e y ( C ) Dictionaries g e n e t i c C o
More informationIdentification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides Derived from Cellular Proteins
Identification of Bacteria Using Phylogenetic Relationships Revealed by MS/MS Sequencing of Tryptic Peptides Derived from Cellular Proteins Jacek P. Dworzanski Geo-Centers, Inc., Aberdeen Proving Ground,
More informationSupplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss
Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss Methods Identification of orthologues, alignment and evolutionary distances A preliminary set of orthologues was
More informationRegulatory Sequence Analysis. Sequence models (Bernoulli and Markov models)
Regulatory Sequence Analysis Sequence models (Bernoulli and Markov models) 1 Why do we need random models? Any pattern discovery relies on an underlying model to estimate the random expectation. This model
More informationEvidence That Mutation Is Universally Biased towards AT in Bacteria
Evidence That Mutation Is Universally Biased towards AT in Bacteria Ruth Hershberg*, Dmitri A. Petrov Department of Biology, Stanford University, Stanford, California, United States of America Abstract
More informationAdvanced topics in bioinformatics
Feinberg Graduate School of the Weizmann Institute of Science Advanced topics in bioinformatics Shmuel Pietrokovski & Eitan Rubin Spring 2003 Course WWW site: http://bioinformatics.weizmann.ac.il/courses/atib
More informationUsing an Artificial Regulatory Network to Investigate Neural Computation
Using an Artificial Regulatory Network to Investigate Neural Computation W. Garrett Mitchener College of Charleston January 6, 25 W. Garrett Mitchener (C of C) UM January 6, 25 / 4 Evolution and Computing
More informationtypes of codon models
part 3: analysis of natural selection pressure omega models! types of codon models if i and j differ by > π j for synonymous tv. Q ij = κπ j for synonymous ts. ωπ j for non-synonymous tv. ωκπ j for non-synonymous
More informationINTERPRETATION OF THE GRAM STAIN
INTERPRETATION OF THE GRAM STAIN DISCLOSURE Relevant relationships with commercial entities none Potential for conflicts of interest within this presentation none Steps taken to review and mitigate potential
More informationTetracycline Rationale for the EUCAST clinical breakpoints, version th November 2009
Tetracycline Rationale for the EUCAST clinical breakpoints, version 1.0 20 th November 2009 Introduction The natural tetracyclines, including tetracycline, chlortetracycline, oxytetracycline and demethylchlortetracycline
More informationNSCI Basic Properties of Life and The Biochemistry of Life on Earth
NSCI 314 LIFE IN THE COSMOS 4 Basic Properties of Life and The Biochemistry of Life on Earth Dr. Karen Kolehmainen Department of Physics CSUSB http://physics.csusb.edu/~karen/ WHAT IS LIFE? HARD TO DEFINE,
More informationModelling and Analysis in Bioinformatics. Lecture 1: Genomic k-mer Statistics
582746 Modelling and Analysis in Bioinformatics Lecture 1: Genomic k-mer Statistics Juha Kärkkäinen 06.09.2016 Outline Course introduction Genomic k-mers 1-Mers 2-Mers 3-Mers k-mers for Larger k Outline
More informationWhole Genome based Phylogeny
Whole Genome based Phylogeny Johanne Ahrenfeldt PhD student DTU Bioinformatics Short about me Johanne Ahrenfeldt johah@dtu.dk PhD student at DTU Bioinformatics Whole Genome based Phylogeny Graduate Engineer
More informationSUPPLEMENTARY DATA - 1 -
- 1 - SUPPLEMENTARY DATA Construction of B. subtilis rnpb complementation plasmids For complementation, the B. subtilis rnpb wild-type gene (rnpbwt) under control of its native rnpb promoter and terminator
More informationWhy do more divergent sequences produce smaller nonsynonymous/synonymous
Genetics: Early Online, published on June 21, 2013 as 10.1534/genetics.113.152025 Why do more divergent sequences produce smaller nonsynonymous/synonymous rate ratios in pairwise sequence comparisons?
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationMicroGenomics. Universal replication biases in bacteria
Molecular Microbiology (1999) 32(1), 11±16 MicroGenomics Universal replication biases in bacteria Eduardo P. C. Rocha, 1,2 Antoine Danchin 2 and Alain Viari 1,3 * 1 Atelier de BioInformatique, UniversiteÂ
More informationpart 3: analysis of natural selection pressure
part 3: analysis of natural selection pressure markov models are good phenomenological codon models do have many benefits: o principled framework for statistical inference o avoiding ad hoc corrections
More informationydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC
Table S1. DNA primers used in this study. Name ydci P1ydcIkd3 Sequence GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC Kd3ydcIp2 lacz fusion YdcIendP1 YdcItrgP2 GAC AGC
More informationCrick s early Hypothesis Revisited
Crick s early Hypothesis Revisited Or The Existence of a Universal Coding Frame Ryan Rossi, Jean-Louis Lassez and Axel Bernal UPenn Center for Bioinformatics BIOINFORMATICS The application of computer
More informationCharacterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin
International Journal of Genetic Engineering and Biotechnology. ISSN 0974-3073 Volume 2, Number 1 (2011), pp. 109-114 International Research Publication House http://www.irphouse.com Characterization of
More information3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies
Richard Owen (1848) introduced the term Homology to refer to structural similarities among organisms. To Owen, these similarities indicated that organisms were created following a common plan or archetype.
More informationIntroduction to Molecular Phylogeny
Introduction to Molecular Phylogeny Starting point: a set of homologous, aligned DNA or protein sequences Result of the process: a tree describing evolutionary relationships between studied sequences =
More informationRise and Fall of Mutator Bacteria
Rise and Fall of Mutator Bacteria The Evolution of Mutation Rates in Bacteria Yoav Ram Hadany Evolutionary Theory Lab 29 May 2011 Bacteria Bacteria are unicellular, haploid and asexual Reproduce by binary
More informationDomain Bacteria. BIO 220 Microbiology Jackson Community College
Domain Bacteria BIO 220 Microbiology Jackson Community College John Ireland, Ph.D. 2006 Scientific Nomenclature Domain - Bacteria Phylum Important for gross characteristics Class Intermediate characteristics
More informationRELATING PHYSICOCHEMMICAL PROPERTIES OF AMINO ACIDS TO VARIABLE NUCLEOTIDE SUBSTITUTION PATTERNS AMONG SITES ZIHENG YANG
RELATING PHYSICOCHEMMICAL PROPERTIES OF AMINO ACIDS TO VARIABLE NUCLEOTIDE SUBSTITUTION PATTERNS AMONG SITES ZIHENG YANG Department of Biology (Galton Laboratory), University College London, 4 Stephenson
More informationThe Journal of Animal & Plant Sciences, 28(5): 2018, Page: Sadia et al., ISSN:
The Journal of Animal & Plant Sciences, 28(5): 2018, Page: 1532-1536 Sadia et al., ISSN: 1018-7081 Short Communication BIOINFORMATICS ANALYSIS OF CODON USAGE BIAS AND RNA SECONDARY STRUCTURES FOR SALT
More informationCodon-model based inference of selection pressure. (a very brief review prior to the PAML lab)
Codon-model based inference of selection pressure (a very brief review prior to the PAML lab) an index of selection pressure rate ratio mode example dn/ds < 1 purifying (negative) selection histones dn/ds
More informationCodon Distribution in Error-Detecting Circular Codes
life Article Codon Distribution in Error-Detecting Circular Codes Elena Fimmel, * and Lutz Strüngmann Institute for Mathematical Biology, Faculty of Computer Science, Mannheim University of Applied Sciences,
More informationEvolutionary Analysis of Viral Genomes
University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral
More informationProteins: Characteristics and Properties of Amino Acids
SBI4U:Biochemistry Macromolecules Eachaminoacidhasatleastoneamineandoneacidfunctionalgroupasthe nameimplies.thedifferentpropertiesresultfromvariationsinthestructuresof differentrgroups.thergroupisoftenreferredtoastheaminoacidsidechain.
More informationBiosynthesis of Bacterial Glycogen: Primary Structure of Salmonella typhimurium ADPglucose Synthetase as Deduced from the
JOURNAL OF BACTERIOLOGY, Sept. 1987, p. 4355-4360 0021-9193/87/094355-06$02.00/0 Copyright X) 1987, American Society for Microbiology Vol. 169, No. 9 Biosynthesis of Bacterial Glycogen: Primary Structure
More informationFigure S1. Pangenome plots of ten recombining bacterial species based on RAST annotated
Figure S1 Figure S2 Supplementary Figure legends Figure S1. Pangenome plots of ten recombining bacterial species based on RAST annotated genomes. To generate these plots all strains within a species were
More informationAn Analytical Model of Gene Evolution with 9 Mutation Parameters: An Application to the Amino Acids Coded by the Common Circular Code
Bulletin of Mathematical Biology (2007) 69: 677 698 DOI 10.1007/s11538-006-9147-z ORIGINAL ARTICLE An Analytical Model of Gene Evolution with 9 Mutation Parameters: An Application to the Amino Acids Coded
More informationGenetic Basis of Variation in Bacteria
Mechanisms of Infectious Disease Fall 2009 Genetics I Jonathan Dworkin, PhD Department of Microbiology jonathan.dworkin@columbia.edu Genetic Basis of Variation in Bacteria I. Organization of genetic material
More informationMicrobial Taxonomy. Classification of living organisms into groups. A group or level of classification
Lec 2 Oral Microbiology Dr. Chatin Purpose Microbial Taxonomy Classification Systems provide an easy way grouping of diverse and huge numbers of microbes To provide an overview of how physicians think
More informationFigure Page 117 Microbiology: An Introduction, 10e (Tortora/ Funke/ Case)
Chapter 11 The Prokaryotes: Domains Bacteria and Archaea Objective Questions 1) Which of the following are found primarily in the intestines of humans? A) Gram-negative aerobic rods and cocci B) Aerobic,
More informationCh 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria)
Ch 27: The Prokaryotes Bacteria & Archaea Older: (Eu)bacteria & Archae(bacteria) (don t study Concept 27.2) Some phyla Remember: Bacterial cell structure and shapes 1 Usually very small but some are unusually
More informationNUCLEOTIDE SUBSTITUTIONS AND THE EVOLUTION OF DUPLICATE GENES
Conery, J.S. and Lynch, M. Nucleotide substitutions and evolution of duplicate genes. Pacific Symposium on Biocomputing 6:167-178 (2001). NUCLEOTIDE SUBSTITUTIONS AND THE EVOLUTION OF DUPLICATE GENES JOHN
More informationObjective: You will be able to justify the claim that organisms share many conserved core processes and features.
Objective: You will be able to justify the claim that organisms share many conserved core processes and features. Do Now: Read Enduring Understanding B Essential knowledge: Organisms share many conserved
More information2 Genome evolution: gene fusion versus gene fission
2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,
More informationProbabilistic modeling and molecular phylogeny
Probabilistic modeling and molecular phylogeny Anders Gorm Pedersen Molecular Evolution Group Center for Biological Sequence Analysis Technical University of Denmark (DTU) What is a model? Mathematical
More informationgenome analysis, amino acid biosynthesis and transport, T-box, bacteria
236 Part 5 Chapter # EVOLUTIONAL AND FUNCTIONAL ANALYSIS OF T-BOX REGULON IN BACTERIA: IDENTIFICATION OF NEW GENES INVOLVED IN AMINO ACID METABOLISM Vitreschak A.G. *1, Lyubetsky V.A. 1, Gelfand M.S. 1
More informationTable S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R
Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R AAC MGG ATT AGA TAC CCK G GGY TAC CTT GTT ACG ACT T Detection of Candidatus
More informationBacterial pan-genomics
Bacterial pan-genomics Dave Ussery 4 th annual workshop on Comparative Microbial Genomics and Taxonomy Petropolois, Brazil Lecture #3 Wednesday, 5 August, 2009 What we DO know What we DON'T know Outline
More informationThe Prokaryotes: Domains Bacteria and Archaea
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 11 The Prokaryotes: Domains Bacteria and Archaea Table 11.1 Classification of Selected Prokaryotes*
More informationarxiv: v1 [q-bio.qm] 18 Nov 2013
Markovianness and Conditional Independence in Annotated Bacterial DNA Andrew Hart Servet Martínez arxiv:1311.4411v1 [q-bio.qm] 18 Nov 2013 November 19, 2013 Abstract We explore the probabilistic structure
More informationOverview of the major bacterial pathogens The major bacterial pathogens are presented in this table:
Practical Microbiology 30/11/2018 University of Sulaimani college of Pharmacy Year2 Lab. 5: Overview of the major bacterial pathogens The major bacterial pathogens are presented in this table: Major Bacterial
More informationAoife McLysaght Dept. of Genetics Trinity College Dublin
Aoife McLysaght Dept. of Genetics Trinity College Dublin Evolution of genome arrangement Evolution of genome content. Evolution of genome arrangement Gene order changes Inversions, translocations Evolution
More informationLecture 15: Realities of Genome Assembly Protein Sequencing
Lecture 15: Realities of Genome Assembly Protein Sequencing Study Chapter 8.10-8.15 1 Euler s Theorems A graph is balanced if for every vertex the number of incoming edges equals to the number of outgoing
More informationTaming the Beast Workshop
Workshop David Rasmussen & arsten Magnus June 27, 2016 1 / 31 Outline of sequence evolution: rate matrices Markov chain model Variable rates amongst different sites: +Γ Implementation in BES2 2 / 31 genotype
More informationProtein Threading. Combinatorial optimization approach. Stefan Balev.
Protein Threading Combinatorial optimization approach Stefan Balev Stefan.Balev@univ-lehavre.fr Laboratoire d informatique du Havre Université du Havre Stefan Balev Cours DEA 30/01/2004 p.1/42 Outline
More informationAdditional file 1 for Structural correlations in bacterial metabolic networks by S. Bernhardsson, P. Gerlee & L. Lizana
Additional file 1 for Structural correlations in bacterial metabolic networks by S. Bernhardsson, P. Gerlee & L. Lizana Table S1 The species marked with belong to the Proteobacteria subset and those marked
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationThe Trigram and other Fundamental Philosophies
The Trigram and other Fundamental Philosophies by Weimin Kwauk July 2012 The following offers a minimal introduction to the trigram and other Chinese fundamental philosophies. A trigram consists of three
More information160, and 220 bases, respectively, shorter than pbr322/hag93. (data not shown). The DNA sequence of approximately 100 bases of each
JOURNAL OF BACTEROLOGY, JUlY 1988, p. 3305-3309 0021-9193/88/073305-05$02.00/0 Copyright 1988, American Society for Microbiology Vol. 170, No. 7 Construction of a Minimum-Size Functional Flagellin of Escherichia
More informationGene Location and Bacterial Sequence Divergence
Gene Location and Bacterial Sequence Divergence Alex Mira* 1 and Howard Ochman* *Department of Ecology and Evolutionary Biology, University of Arizona; Department of Biochemistry and Molecular Biophysics,
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationSUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA
SUPPORTING INFORMATION FOR SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA Aik T. Ooi, Cliff I. Stains, Indraneel Ghosh *, David J. Segal
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationIntroduction to Bioinformatics Integrated Science, 11/9/05
1 Introduction to Bioinformatics Integrated Science, 11/9/05 Morris Levy Biological Sciences Research: Evolutionary Ecology, Plant- Fungal Pathogen Interactions Coordinator: BIOL 495S/CS490B/STAT490B Introduction
More informationSupplemental Figure 1.
A wt spoiiiaδ spoiiiahδ bofaδ B C D E spoiiiaδ, bofaδ Supplemental Figure 1. GFP-SpoIVFA is more mislocalized in the absence of both BofA and SpoIIIAH. Sporulation was induced by resuspension in wild-type
More informationProkaryotic phylogenies inferred from protein structural domains
Letter Prokaryotic phylogenies inferred from protein structural domains Eric J. Deeds, 1 Hooman Hennessey, 2 and Eugene I. Shakhnovich 3,4 1 Department of Molecular and Cellular Biology, Harvard University,
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationWorld Journal of Pharmaceutical Research SJIF Impact Factor 8.074
SJIF Impact Factor 8.074 Volume 7, Issue 5, 966-973. Research Article ISSN 2277 7105 MOLECULAR DETECTION OF ENTEROTOXIGENIC ISOLATES OF SALMONELLA TYPHIMURIUM, SHIGELLA FLEXNERI AND STAPHYLOCOCCUS AUREUS
More informationSequence Alignments. Dynamic programming approaches, scoring, and significance. Lucy Skrabanek ICB, WMC January 31, 2013
Sequence Alignments Dynamic programming approaches, scoring, and significance Lucy Skrabanek ICB, WMC January 31, 213 Sequence alignment Compare two (or more) sequences to: Find regions of conservation
More informationTranslation. A ribosome, mrna, and trna.
Translation The basic processes of translation are conserved among prokaryotes and eukaryotes. Prokaryotic Translation A ribosome, mrna, and trna. In the initiation of translation in prokaryotes, the Shine-Dalgarno
More informationIn previous lecture. Shannon s information measure x. Intuitive notion: H = number of required yes/no questions.
In previous lecture Shannon s information measure H ( X ) p log p log p x x 2 x 2 x Intuitive notion: H = number of required yes/no questions. The basic information unit is bit = 1 yes/no question or coin
More informationConsiderations with Antibiotic Therapy PART
Considerations with Antibiotic Therapy PART 1 The Wonderful World of Microbiology 1 Despite the promises of the household-products industry, almost every surface is covered in microorganisms almost all
More informationProduct List. - Kits & Reagents
Product List - Kits & Reagents Bacterial Pathogens Viral Pathogens Beverage Spoilage Organisms Yeast and Mold GMOs Allergens Animal Identification Veterinary Environmental Pharma DNA/RNA Extraction Additional
More informationHigh throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence
More informationPOPULATION GENETICS Biology 107/207L Winter 2005 Lab 5. Testing for positive Darwinian selection
POPULATION GENETICS Biology 107/207L Winter 2005 Lab 5. Testing for positive Darwinian selection A growing number of statistical approaches have been developed to detect natural selection at the DNA sequence
More informationPractical examination
Practical examination I. Sterile media 1. Bouillon, 2. Slant agar, tube agar 4. Enrichment media: meat bouillon 3., 5., 6.: Agar, blood agar and chocolate agar plates 7. Selective and differentiating media
More informationEncoding of Amino Acids and Proteins from a Communications and Information Theoretic Perspective
Jacobs University Bremen Encoding of Amino Acids and Proteins from a Communications and Information Theoretic Perspective Semester Project II By: Dawit Nigatu Supervisor: Prof. Dr. Werner Henkel Transmission
More informationProduct Catalogue 2015 Clinical and Industrial Microbiology
Acinetobacter baumannii ATCC BAA-747 * 89141 Actinomyces odontolyticus ATCC 17929 * 89114 Aeromonas hydrophila ATCC 7966 * 89119 Aggregatibacter aphrophilus ATCC 7901 * 89091 Aspergillus brasiliensis ATCC
More informationMODELING EVOLUTION AT THE PROTEIN LEVEL USING AN ADJUSTABLE AMINO ACID FITNESS MODEL
MODELING EVOLUTION AT THE PROTEIN LEVEL USING AN ADJUSTABLE AMINO ACID FITNESS MODEL MATTHEW W. DIMMIC*, DAVID P. MINDELL RICHARD A. GOLDSTEIN* * Biophysics Research Division Department of Biology and
More informationDiversity of Chlamydia trachomatis Major Outer Membrane
JOURNAL OF ACTERIOLOGY, Sept. 1987, p. 3879-3885 Vol. 169, No. 9 0021-9193/87/093879-07$02.00/0 Copyright 1987, American Society for Microbiology Diversity of Chlamydia trachomatis Major Outer Membrane
More informationGenetic code on the dyadic plane
Genetic code on the dyadic plane arxiv:q-bio/0701007v3 [q-bio.qm] 2 Nov 2007 A.Yu.Khrennikov, S.V.Kozyrev June 18, 2018 Abstract We introduce the simple parametrization for the space of codons (triples
More informationSupplemental data. Pommerrenig et al. (2011). Plant Cell /tpc
Supplemental Figure 1. Prediction of phloem-specific MTK1 expression in Arabidopsis shoots and roots. The images and the corresponding numbers showing absolute (A) or relative expression levels (B) of
More informationClay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture.
QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Clay Carter Department of Biology QuickTime and a TIFF (LZW) decompressor are needed to see this picture. Ornamental tobacco
More informationAntimicrobial peptides
Název: Školitel: Antimicrobial peptides Zbyněk Heger Datum: 2. 8. 2013 Reg.č.projektu: CZ.1.07/2.4.00/31.0023 Název projektu: Partnerská síť centra excelentního bionanotechnologického výzkumu 2 Content
More informationSequence Diversity of Flagellin (flic) Alleles in Pathogenic Escherichia coli
JOURNAL OF BACTERIOLOGY, Jan. 1999, p. 153 160 Vol. 181, No. 1 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Sequence Diversity of Flagellin (flic) Alleles
More informationProperties of amino acids in proteins
Properties of amino acids in proteins one of the primary roles of DNA (but not the only one!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids repeated
More informationANTIMICROBIAL TESTING. E-Coli K-12 - E-Coli 0157:H7. Salmonella Enterica Servoar Typhimurium LT2 Enterococcus Faecalis
ANTIMICROBIAL TESTING E-Coli K-12 - E-Coli 0157:H7 Salmonella Enterica Servoar Typhimurium LT2 Enterococcus Faecalis Staphylococcus Aureus (Staph Infection MRSA) Streptococcus Pyrogenes Anti Bacteria effect
More informationMassachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution
Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral
More informationGram negative bacilli
Gram negative bacilli 1-Enterobacteriaceae Gram negative bacilli-rods Enterobacteriaceae Are everywhere Part of normal flora of humans and most animals They are cause of -30-35% septisemia -more than 70%
More informationProduct Catalogue 2016 Clinical and Industrial Microbiology
Acinetobacter baumannii ATCC BAA-747 * 89141 Acinetobacter baumannii ATCC 19606 * 89174 Actinomyces odontolyticus ATCC 17929 * 89114 Aeromonas hydrophila ATCC 7966 * 89119 Aeromonas hydrophila ATCC 35654
More informationμ gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli gyra E. coli parc gyra parc gyra Escherichia coli E. coli E.
gyra parc Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa E. coli μ E. coli gyra parc gyra parc gyra parc μ μ gyra parc Key words Escherichia coli gyra parc Escherichia coli E. coli gyra
More informationEvolvable Neural Networks for Time Series Prediction with Adaptive Learning Interval
Evolvable Neural Networs for Time Series Prediction with Adaptive Learning Interval Dong-Woo Lee *, Seong G. Kong *, and Kwee-Bo Sim ** *Department of Electrical and Computer Engineering, The University
More informationcodon substitution models and the analysis of natural selection pressure
2015-07-20 codon substitution models and the analysis of natural selection pressure Joseph P. Bielawski Department of Biology Department of Mathematics & Statistics Dalhousie University introduction morphological
More informationBacterial clasification
Bacterial clasification Describe bacterial classification: List taxon levels Define taxonomy and identification Describe principles of taxonomy Explain classification of bacteria Taxonomy the science of
More informationPROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
More information