AtFH8 Is Involved in Root Development under Effect of Low-Dose Latrunculin B in Dividing Cells

Transcription

1 Molecular Plant Volume 4 Number 2 Pages March 2011 RESEARCH ARTICLE AtFH8 Is Involved in Root Development under Effect of Low-Dose Latrunculin B in Dividing Cells Xiu-Hua Xue a,2, Chun-Qing Guo a,2, Fei Du a, Quan-Long Lu b, Chuan-Mao Zhang b and Hai-Yun Ren a,1 a Key Laboratory of Cell Proliferation and Regulation Biology of Ministry of Education, College of Life Science, Beijing Normal University, Beijing , China b The Key Laboratory of Cell Proliferation and Differentiation of Ministry of Education and the State Key Laboratory of Bio-Membrane and Membrane Bio-Engineering, College of Life Science, Peking University, Beijing , China ABSTRACT Formins have been paid much attention for their potent nucleating activity. However, the connection between the in vivo functions of AtFHs (Arabidopsis thaliana formin homologs) and their effects on actin organization is poorly understood. In this study, we characterized the bundling activity of AtFH8 in vitro and in vivo. Biochemical analysis showed that AtFH8(FH1FH2) could form dimers and bundle preformed actin filaments or induce stellar structures during actin polymerization. Expression of truncated forms of AtFH8 and immunolocalization analysis showed that AtFH8 localized primarily to nuclear envelope in interphase and to the new cell wall after cytokinesis, depending primarily on its N-terminal transmembrane domain. GUS histochemical staining showed AtFH8 was predominantly expressed in Arabidopsis root meristem, vasculature, and outgrowth points of lateral roots. The primary root growth and lateral root initiation of atfh8 could be decreased by latrunculin B (LatB). Analysis of the number of dividing cells in Arabidopsis root tips showed that much fewer dividing cells in Lat B-treated atfh8 plants than wild-type plants, which indicates that AtFH8 was involved in cell division. Actin cytoskeleton in root meristem of atfh8-1 was more sensitive to LatB treatment than that of wild-type. Altogether, our results indicate that AtFH8 is an actin filament nucleator and bundler that functions in cell division and root development. Key words: Actin binding protein; formin; cell division; root meristem; lateral root initiation; actin nucleator and bundler. INTRODUCTION Actin, as a very important component of eukaryotic cells, exists in various highly organized states in living cells, including monomers, filaments, networks, and cables. To participate in the critical cellular processes in plant cells, such as cytoplasmic streaming, cytokinesis, and tip growth, actin needs to be organized rapidly into different kinds of structures under the regulation of actin binding proteins (ABPs) that are able to initiate actin filament formation as well as bundle or crosslink actin filaments, etc. (Thomas et al., 2008; Wang et al., 2008a). Therefore, the study of these ABPs is of extreme significance. Formin proteins are well known regulators of actin dynamics and have been identified in various eukaryotic organisms, including fungi, animals, and plants. In yeast and animals, formins associate with the barbed end and the side of the actin filament through its formin homology 2 (FH2) domain a common feature of all formin homology proteins (for review, see Deeks et al., 2002). By binding to the barbed end, formins nucleate actin filament assembly and alternate the rate of polymerization and depolymerization (for review, see Kovar, 2006). In contrast, binding to the side of actin filaments leads to fragmentation of the filaments (Harris et al., 2004). Formins also induce actin filaments to form actin bundles in vitro (Moseley and Goode, 2005; Harris and Higgs, 2006) and actin cables in vivo (Evangelista et al., 2002; Pruyne et al., 2002; Sagot et al., 2002). Studies on Arabidopsis thailiana formin homologs (AtFHs) show that some of the members are conserved in nucleating, partial capping, or bundling activities (Deeks et al., 2005; Ingouff et al., 2005; Michelot et al., 2005; Yi et al., 2005; Michelot et al., 2006; Ye et al., 2009), while AtFH4 can also bind to microtubules in addition to nucleate actin assembly (Deeks et al., 2010). Studies on type-i Arabidopsis formins reveal that some of the members localize in plasma membrane (AtFH1, AtFH6, AtFH4) and are involved in a series of cellular processes, such as tip growth of root hair cells (AtFH8) and pollen tubes (AtFH1), giant cell formation (AtFH6), proper morphogenesis of the endosperm posterior 1 To whom correspondence should be addressed. hren@bnu.edu.cn. 2 These authors contributed equally to this work. ª The Author Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPP and IPPE, SIBS, CAS. doi: /mp/ssq085, Advance Access publication 9 February 2011 Received 26 July 2010; accepted 28 December 2010

2 Xue et al. d AtFH8 Is Involved in Root Development 265 pole (AtFH5), and cell division (AtFH5 and AtFH6) (for review, see Baluška and Hlavačka, 2005; Guo and Ren, 2006). Spatial and temporal patterns of AtFH6 expression in Arabidopsis indicate that it may be involved in the early differentiation of vascular cylinder cells, especially in the root apex and during lateral root development (Favery et al., 2004). Recently, lossof-function genetic studies show that AtFH3 regulates the formation of actin cables that are important for cytoplasmic streaming and polarized growth in pollen tubes (Ye et al., 2009). Nevertheless, the connection between the in vivo functions of AtFHs and their effects on actin organization is poorly understood, and, more importantly, how actin cytoskeleton directed by AtFHs from specific sub-cellular localization regulates cell morphogenesis and growth. In this study, we further examine the nucleating and bundling activity of AtFH8 and its effects on the physiological processes of Arabidopsis root development. Our in vitro experiments demonstrate that AtFH8(FH1FH2) can form dimer as a structure basis for its nucleating and bundling activity and in vivo experiments show that AtFH8 localizes primarily to nuclear envelope in interphase and to the newly formed cell wall after cytokinesis that is required for cell division. In intact plant, it is involved in the primary root growth and lateral root initiation through regulating actin cytoskeleton in the dividing cells. RESULTS AtFH8(FH1FH2) Forms Dimers in Solution The truncated protein, AtFH8(FH1FH2), was expressed in E. coli as described previously (Yi et al., 2005) to further characterize AtFH8 in vitro. FPLC (Fast Protein Liquid Chromatography) in combination with SDS PAGE (SDS polyacrylamide gel electrophoresis) were conducted to verify the oligomeric state of AtFH8(FH1FH2). As shown in Figure 1A, a representative chromatogram with a principle peak at the elution volume of 80 ml, corresponding to a molecular weight of 158 kda, was obtained. The peak component was identified to be AtFH8(FH1FH2) as demonstrated by SDS PAGE. As the molecular weight of monomeric AtFH8(FH1FH2) is 70 kda, it is likely that the 158-kDa protein is a dimer form of AtFH8. Sedimentation-velocity analytical ultracentrifugation was conducted to verify whether AtFH8(FH1FH2) could form dimers. AtFH8(FH1FH2) was sedimented at 58 and 117 kda during sedimentation velocity analytical ultracentrifugation, which represented monomers and dimers of AtFH8(FH1FH2), respectively (Figure 1B). The ratio between monomer and dimer is 12:1. Two individual strategies to clarify monomers and oligomers confirmed that AtFH8(FH1FH2) was able to form dimers. Figure 1. AtFH8(FH1FH2) Can Form Dimers. (A) FPLC analysis of AtFH8(FH1FH2). Standard curve is the elution profile of gel filtration standard. The numbers above the standard curve indicate the molecular weight of respective elution peak. AtFH8 curve is the elution profile of AtFH8(FH1FH2). An elution peak corresponding to about 158 kda is observed and then applied to SDS PAGE to verify that it is AtFH8(FH1FH2). Inset is the result of SDS PAGE. (B) Sedimentation velocity analytical centrifugation of AtFH8(FH1FH2). AtFH8(FH1FH2) sedimented at 2.7 and 4.6 S. Conversion of the parameters give an apparent mass of 58 and 117 kda, which represented monomers and dimers, respectively. AtFH8 Truncated Proteins Effectively Bundle Actin Filaments To confirm the bundling activity of AtFH8 in vitro, several techniques that could distinguish individual actin filaments from actin bundles were used. By confocal microscopy, it was observed that both AtFH8(FH1FH2) and AtFH8(FH2) could bundle actin filaments in a steady state (polymerized for 16 h at 4 C) (Figure 2A 2C). However, the actin bundles generated by AtFH8(FH1FH2) were longer and thicker than the actin bundles generated by AtFH8(FH2). The details of the actin bundle structures were further studied using electron microscopy, which revealed that the actin bundle structures consisted of many individual actin filaments (Figure 2D 2F). The average diameter of actin bundles induced by AtFH8(FH1FH2) ( nm, mean 6 SD, n = 30) was about 10-fold that of the single actin filament (8 6 1 nm, mean 6 SD, n = 30), and was 1.5-fold that of actin bundles induced by AtFH8(FH2) ( nm, mean 6 SD, n = 30). Low-speed cosedimentation assay (centrifuge at g) was conducted to quantify the bundling activity of AtFH8 (Figure 2G and 2H). This assay provided data in agreement with microscopic observation. When AtFH8(FH1FH2) or AtFH8(FH2) was added into pre-polymerized actin filaments, more actin was recovered in the pellets than in the control sample, indicating that there were more actin bundles formed in the presence of AtFH8 truncated proteins. Analysis of the SDS PAGE gel by densitometry showed that truncated AtFH8 proteins bundled actin filaments in a concentration-dependent manner and that AtFH8(FH1FH2) bundled more actin filaments than did AtFH8(FH2) at the indicated concentrations (Figure 2H). The actin filaments that polymerized for 16 h mostly consist of ADP-loaded actin. To investigate whether the nucleotide state of actin could alter the bundling activity of AtFH8, we also duplicated the above experiments using actin filaments polymerized for 2 h at 22 C, in which the actin filaments were ATP/ADP-Pi-loaded (Supplemental Figure 1). Both fluorescence microcopy and low-speed cosedimentation assay confirmed that AtFH8(FH1FH2) and AtFH8(FH2) could bundle ATP/ADP- Pi-loaded actin filaments (Supplemental Figure 1A 1D).

3 266 Xue et al. d AtFH8 Is Involved in Root Development Figure 2. Both AtFH8(FH1FH2) and AtFH8(FH2) Can Bundle Actin Filaments. Actin bundles examined by fluorescence microscopy (A C) and electron microscopy (D F). (A) and (D) Control actin filaments. (B) and (E) Actin bundles generated by AtFH8(FH1FH2). (C) and (F) Actin bundles generated by AtFH8(FH2). For (A C), bar = 20 lm. For (D F), bar = 100 nm. (G) AtFH8(FH1FH2) and AtFH8(FH2) bundle actin filaments in a concentration-dependent manner. The left panel shows the control sample and samples containing AtFH8(FH1FH2) and the right panel shows the samples containing AtFH8(FH2). (H) The bundling activity of AtFH8(FH2) is weaker than AtFH8(FH1FH2). The percentage of pellet obtained by densitometry analysis of the SDS PAGE gel in G is plotted against AtFH8(FH1FH2) or AtFH8(FH2) concentration. White column, AtFH8(FH1FH2); gray column, AtFH8(FH2). (I) AtFH8(FH2) binds to actin filament side weaker than AtFH8(FH1FH2). Lanes 1 5 are high-speed cosedimentation samples with 200 nm AtFH8(FH2) and 0, 1, 2, 3, and 4 lm pre-polymerized actin filaments. (J) Plot of relative gray scale of AtFH8(FH2) in Coomassie blue-stained SDS PAGE gel against actin concentrations as described in Figure 2I. The gray scale of AtFH8(FH2) in pellets is indicated by black rhombuses and the supernatants are indicated by black squares; the intersection of the two indicates that 50% of AtFH8(FH2) binds to actin filaments. A representative of three independent experiments is shown.

4 Xue et al. d AtFH8 Is Involved in Root Development 267 However, the ability of AtFH8(FH1FH2) and AtFH8(FH2) to bundle ATP/ADP-Pi-loaded actin filaments was lower than to bundle ADP-loaded actin filaments (Supplemental Figure 1D and 1E; Figure 2H). Thus, the bundling activity of AtFH8(FH1FH2) and AtFH8(FH2) is altered by the nucleotide state of actin filaments. AtFH8(FH1FH2) Induces Stellar Structure Formation during Actin Assembly Based on the ability that AtFH8 can nucleate actin assembly (Yi et al., 2005) and bundle polymerized actin filaments, we examined the comprehensive effects of AtFH8 on actin filament structure during the process of actin polymerization. Fluorescence microscopy showed that instead of remaining as individual actin filaments, actin did polymerize into actin bundles in the presence of 100 nm or higher concentration of AtFH8(FH1FH2) (Figure 3A and 3B). Interestingly, many stellar structures composed of several actin bundles that were oriented to different directions were also observed (Figure 3C). However, AtFH8(FH2) could only induce actin to form actin bundles, but not stellar structures (Figure 3D). As it is well known that actin exists mainly in an actin profilin complex pool in living plant cells (Gibbon et al., 1999), the effects of AtFH8 on the assembly of actin profilin complex were also examined. Actin alone could only polymerize into few short actin fragments in the presence of profilin (Figure 3E). When AtFH8(FH1FH2) was added to the polymerization system containing actin and profilin, actin polymerized into actin bundles (Figure 3F) and stellar structures (Figure 3G). However, neither typical actin bundles nor stellar structures were observed when AtFH8(FH2) was added (Figure 3H). Using electron microscopy, it was demonstrated that both actin bundles and stellar structures consisted of individual actin filaments (Figure 3I 3K). The average diameter of the unbranched bundles ( nm, mean 6 SD, n = 30) was about half that of the bundles formed by pre-polymerized actin filaments ( nm, mean 6 SD, n = 30). The average diameter of the bundles in the basal of the stellar structure ( nm, mean 6 SD, n = 30) was nearly equal to that of the bundles formed by pre-polymerized actin filaments and was about two-fold that of the unbranched bundles. However, the actin bundles became gradually thinner as they grew away from the central region (Figure 3K). The proteins in the supernatant after ultracentrifugation at g also preserved the activities (data not shown), indicating that it was not an artifact resulting from non-specific protein aggregation. The stellar structure formation revealed a novel feature of the biochemical activity of AtFH8. Furthermore, the capacity of AtFH8(FH1FH2) or AtFH8(FH2) to induce bundled actin filaments formation in the absence or presence of profilin was quantified by low-speed cosedimentation assay. As shown in Figure 3L, AtFH8(FH1FH2) induced both actin and actin profilin complex to form bundled actin filaments in a concentration-dependent manner, but their amount was much less produced by actin profilin complex than by actin, indicating that the ability of AtFH8(FH1FH2) to induce bundled actin filaments formation during actin assembly is quantitatively modulated by profilin. Figure 3M shows the statistic analysis of the three experiments. The results also indicated that AtFH8(FH2) could induce actin to form bundled actin filaments, but its capacity was much lower than AtFH8(FH1FH2), and when profilin waspresent,nosignificantincreaseofactininpelletswas observed (Figure 3L and 3M). We further determined the K d value of AtFH8(FH1FH2) to bind to spontaneously assembled actin filaments in the presence or absence of profilin using high-speed cosedimentation assay (Supplemental Figure 2A). In the absence of profilin, the K d value of AtFH8(FH1FH2) to bind to spontaneously assembled actin filaments was lm (mean 6 SE, n = 3). Because much fewer actin filaments were assembled in the presence of profilin, the actin filament amounts were normalized, and a K d value of lm (mean 6 SE, n = 3) was obtained for AtFH8(FH1FH2) to bind to spontaneously assembled actin filaments in the presence of profilin (Supplemental Figure 2B). Thus, AtFH8(FH1FH2) binds to spontaneously assembled actin filaments in the presence of profilin tighter than in the absence of profilin. Because the presence of profilin may affect side binding as well, we then compared the K d value of AtFH8(FH1FH2) to actin filaments in the presence or absence of profilin (Supplemental Figure 2). In the presence of profilin, the K d value of AtFH8(FH1FH2) to actin filaments was lm (mean 6 SE, n = 3, Supplemental Figure 3B), higher than lm the K d value of AtFH8(FH1FH2) to bind to spontaneously assembled actin filaments the AtFH8(FH1FH2). Therefore, the binding actin ability of AtFH8(FH1FH2) during actin polymerizing was even lower than that during the prepolymerized actin filaments, and the binding ability was lower in the presence of profilin. AtFH8 Localizes Primarily to Nuclear Envelope in Inter phase and to Phragmoplast in Cytokinesis To observe the sub-cellular localization and physiological significances of AtFH8 in vivo, we fused the full-length AtFH8, the truncated AtFH8 lacking the N-terminal sequence and N-terminal transmembrane domain of AtFH8, respectively, to the N- terminus of GFP (Green Fluorescent Protein) (Figure 4A). These GFP chimerics (AtFH8:GFP, DN:GFP, and N:GFP) were transformed to Arabidopsis plant and conditionally expressed under the control by estrogen inducible promoter. In the meristem zone of the transgenic Arabidopsis root, we observed that the full-length AtFH8 and N-terminus of AtFH8 localized predominantly to the nuclear envelope of interphase cells (Figure 4B and 4F, solid arrowheads) and the newly formed cell wall of mitotic cells during cytokinesis (Figure 4C and 4G, arrows). The truncated AtFH8 that lacked the transmembrane domain primarily localized in the nucleus (Figure 4D and 4E, open arrowheads).

5 268 Xue et al. d AtFH8 Is Involved in Root Development Figure 3. Actin Can Polymerize into Stellar Structures in the Presence of AtFH8(FH1FH2). Actin was polymerized in the presence of 400 nm AtFH8(FH1FH2) and AtFH8(FH2) for 1 h. The samples were phalloidin stained and observed under fluorescence microscope and electron microscope. (A H) Actin structures observed by fluorescence microscopy and (I, J) electron microscopy. (A) Polymerized actin filaments. (E) Polymerized actin profilin complex. (B) and (F) Actin bundles generated in the absence of profilin (B) and presence of profilin (F). (C, G) The typical stellar structures generated in the absence of profilin (C) and presence of profilin (G). (D) and (H) are the actin bundles or actin filaments generated by AtFH8(FH2) in the absence of profilin (D) or presence of profilin (H). (I) Actin filaments observed under electron microscope. (J) Actin bundles and stellar structures generated by AtFH8(FH1FH2). (K) The fine structure of actin bundle generated by AtFH8(FH1FH2). Inset is the higher magnification of the indicated area. (L) The samples containing the indicated proteins were incubated at room temperature for 1 h and resolved by SDS PAGE. Supernatants and pellets are as indicated. From left lane to right lane, 0, 200, 400, 600, and 800 nm AtFH8(FH1FH2) or AtFH8(FH2) were added. +p, in the presence of profilin; p, in the absence of profilin. (M) Profilin weakens but does not block the ability of AtFH8(FH1FH2) to induce actin bundle formation during actin assembly while profilin can abolish the corresponding ability of AtFH8(FH2). The percentage of pellet obtained by densitometry analysis of the SDS PAGE gel in (L) is plotted against AtFH8(FH1FH2) or AtFH8(FH2) concentration. Gray column with solidus, actin polymerized in the presence of AtFH8(FH1FH2); gray column, actin polymerized in the presence of AtFH8(FH2); white column with solidus, actin polymerized in the presence of AtFH8(FH1FH2) and profilin; white column, actin polymerized in the presence of AtFH8(FH2) and profilin. In (A-H), bar = 100 lm. In (J), bar = 2 lm. In (I) and (K), bar = 500 nm. In inset of (K), bar = 10 nm. To investigate the in vivo localization and function of AtFH8, two T-DNA insertion alleles (atfh8-1 and atfh8-2) were analyzed (Supplemental Figure 3A). Because the phenotypes of the two T-DNA insertion alleles were identical (data not

6 Xue et al. d AtFH8 Is Involved in Root Development 269 primers indicated that atfh8-1 and atfh8-2 mutants were homozygote (Supplemental Figure 3B). The expression level of AtFH8 in atfh8-1 and PAtFH8:AtFH8 GFP was determined by RT PCR and the fluorescence quantitative PCR (Supplemental Figure 4). As expected, AtFH8 expression was blocked in atfh8-1 and the complemented plants expressed nearly equal levels of AtFH8 to wild-type Arabidopsis. Then, we conducted immunostaining using anti-gfp antibody as an alternative method to confirm the localization of AtFH8 in root tip cells. The results showed that AtFH8 localized primarily to the nuclear envelope (Figure 4H) in interphase and to the newly formed cell wall in the cytokinesis (Figure 4I). Thus, we conclude that AtFH8 localizes to nuclear envelope in interphase and to cell plate in cytokinesis dependent on the N- terminal sequence. AtFH8 Loss-of-Function Plants Are Sensitive to F-Actin- Depolymerizing Drug LatB Figure 4. AtFH8 Localizes to the Nuclear Envelope and the Newly Formed Cell Wall in Transgenic Arabidopsis Root Cells. Wild-type Arabidopsis and AtFH8 T DNA insertion mutants were respectively transformed by inducible vectors carrying AtFH8 GFP chimeras and the PAtFH8:AtFH8 GFP vector. Gene expression was inducted by 100 nm estrogen and observed by confocal microscopy. (A) Schematic domain composition of AtFH8 GFP fusion constructs. PRR, proline rich region; TM, transmembrane domain; FH1, formin homology 1 domain; FH2, formin homology 2 domain; GFP, green fluorescent protein. Numbers under each construct indicate the amino acids that it contains. (B, C) The localization of full-length AtFH8 in wild-type Arabidopsis. (D, E) The localization of the truncated AtFH8 lacking the N-terminus in wild-type Arabidopsis. (F, G) The localization of the N-terminus of AtFH8 in wild-type Arabidopsis. (H, I) The immunolocalization of AtFH8 in PAtFH8:AtFH8 GFP transgenic lines. The nuclear envelope (H) and the newly formed cell wall (I) immunolocalization of AtFH8 in the root tip cells. The solid arrowheads indicate the nuclear envelope, the arrows indicate the newly formed cell wall, and the open arrowheads indicate the nuclear sub-cellular localization. Bar = 10 lm. shown), we only showed the results of atfh8-1 mutant plants. The AtFH8:GFP construct was also expressed, which was driven by AtFH8 native promoter (PAtFH8), against the background of atfh8-1 and atfh8-2 mutant plants (PAtFH8:AtFH8 GFP, or named complemented plants). PCR with T-DNA-specific To investigate the tissue-specific expression patterns of AtFH8, we generated transgenic plants that transformed with b- glucuronidase (GUS) reporter gene driven by the AtFH8 native promoter (PAtFH8:GUS). Progeny from 10 independent PAtFH8:GUS transgenic plant lines were used for histochemical analysis of GUS activity and all had the same expression pattern (Figure 5). Untransformed lines and transgenic lines harboring GUS but lacking the AtFH8 promoter did not show any GUS activity (Figure 5A). GUS activity of AtFH8 promoter was restricted to vascular tissue in hypocotyl as well as in roots (Figure 5B and 5D). In roots, there was evidently staining in root apical meristem and in cells of the root cap (Figure 5C). The AtFH8 promoter lines also showed strong GUS activity at the outgrowth points of lateral roots and in cells of the lateral root cap (Figure 5E and 5F). The tissue and sub-cellular localization of AtFH8 in Arabidopsis root made us explore the involvement of AtFH8 in Arabidopsis root development. However, no phenotype difference, such as root length, growth rate, and lateral root development, was observed in wild-type, atfh8-1, and PAtF- H8:AtFH8 GFP complemented plants (Figure 6A), which might be due to the function redundancy of other Arabidopsis formin family members. Because formins are key regulators of cytoskeletal organization and function in mammals and plants (Staiger et al., 2010), we tested whether AtFH8 loss of function affected the organization of actin in Arabidopsis seedlings that stressed by adding F-actin-depolymerizing drug LatB. The young seedlings were treated with LatB at doses that had mild, but perceptible (0, 30, 40, and 50 nm), effects on the growth of the wild-type root. The primary root length of atfh8-1 was shorter and numbers of the lateral root of atfh8 was lower than wild-type (Figure 6). The primary root growth of the young seedlings was significantly slowed down, while the lateral root development between the different lines was indistinguishable when LatB concentration reached to 60 nm or higher (data not shown). PAtFH8:AtFH8 GFP was able to complement the phenotype of atfh8-1 in the presence of LatB

7 270 Xue et al. d AtFH8 Is Involved in Root Development Figure 5. The Histochemical Localization of AtFH8. The histochemical localization of AtFH8 in the transgenic line expressing the promoter of AtFH8 fused with the b-glucuronidase (GUS) (PAtFH8:GUS). Seedlings stained for PAtFH8:GUS expression in 5-day-old wild-type Arabidopsis (A) and PAtFH8:GUS transgenic plants (B F). (C) is the magnification of the black frame of (B), (E) is the magnification of the black frame of (D), and (F) is the magnification of the red frame of (D). In (A), (B), and (D), bar = 25 lm. In (C) and (E, F), bar = 100 lm. (Figure 6A 6C). The atfh8-2 plants also showed hypersensitivity to the LatB (Supplemental Figure 4). To understand whether the reduced root length in atfh8-1 is due to alternation of either cell number or cell size, we compared the cell length of cells in the maturation zone and the number of dividing cells in root apical meristem of wild-type, atfh8-1, and PAtFH8:AtFH8 GFP. We found that there was no significant difference between the cell length of wild-type and atfh8-1 (Figure 6D); however, the number of dividing cells in root apical meristem of atfh8-1 was lower than that of wildtype and PAtFH8:AtFH8 GFP in the presence of LatB (Figure 6E), indicating that AtFH8 participates in cell division in root apical meristem. We next sought to determine whether the growth of afh8-1 plants responds to Cytochalasin D (Cyt D), the other actin inhibitors differentially. When Cyt D was used, the atfh8-1 plants showed the similar results to LatB treatments in the primary root and lateral root development (Supplemental Figure 5). The specific drugs of microtubule, oryzalin (30;80 nm) (Supplemental Figure 6), and taxol (30;70 nm) (Supplemental Figure 7) were introduced to study whether AtFH8 has a relationship with microtubules. In the presence of the two drugs, we found that the length of the primary root and lateral root numbers of atfh8-1 plants were identical to that of wild-type, indicating that the atfh8 plants were just hypersensitive to the actin disrupting drug. These results suggest that AtFH8 has a specific role in actin cytoskeleton. F-Actin Structures of atfh8 Seedlings Are Sensitive to LatB The F-actin structures in root apical meristem, root vasculature, and lateral root-initiated places were further compared in wild-type, atfh8-1, and PAtFH8:AtFH8 GFP seedlings expressing 35S:GFP fabd2. In wild-type, the extensive F-actin networks throughout the root apical meristem and five optical sections through the center of root apical meristem revealed a network of F-actin surrounding the nuclei (Figure 7A), the longitudinal actin bundles in cortex (Figure 7E), and thicker actin bundles in the root pericycle that were identified as the lateral root initials (Figure 7I and 7M, open arrowheads). In the lateral root primordia, extensive actin networks were also found (Figure 7M, solid arrowhead). In young atfh8-1 seedlings, the similar actin networks were found in the root apical meristem, pericycle, and the lateral root primordia, but the fluorescence intensity was relatively weak (Figure 7B, 7F, 7J, and 7N). After treatment with LatB, actin filaments in root apical meristem of wild-type were disrupted into shorter filaments (Figure 7C), the longitudinal actin bundles in cortex cells and pericycle were slightly thinner (Figure 7G and 7K), and the actin structures in the lateral root primordia were less than the control (Figure 7O). However, actin filaments in root apical meristem and lateral root primordia of atfh8 were disrupted severely: most of the F-actin networks disappeared (Figure 7D), although actin bundles in the cortex and pericycle cells were still detected (Figure 7H and 7L, open arrowhead). Then, we measured the average fluorescence intensity of actin filaments before and after LatB treatment in wild-type and atfh8-1 plants (Supplemental Figure 8). The fluorescence intensity of atfh8-1 was weaker than wild-type, and the root tips and the pericycle of the atfh8-1 plant showed much less fluorescence intensity than wild-type. These results indicate that the actin structures in root apical meristem of atfh8-1 are more sensitive to LatB treatment and the actin bundles in the vasculature are less affected by the applied pharmacological agent. DISCUSSION Formin family members usually form dimers to nucleate and bundle actin filaments (Xu et al., 2004; Michelot et al., 2006). In this study, we find that all AtFH8(FH1FH2) truncates are identified as dimers in FPLC assay, but only 7.5% AtFH8(FH1FH2) truncates are in dimer state in sedimentation velocity analytical ultracentrifugation assay. We assumed that this might be due to different experimental strategies. Similar results were reported by another group involved in the studies of the oliogmeric state of other proteins (Smertenko et al., 2004). This study indicates that dimers are probably the structure basis of formin functions. Our previous study revealed that AtFH8(FH1FH2) could bind actin filament side tightly with an apparent K d value of 0.69 lm and it could sever actin filaments into short fragments at lower concentration (Yi et al., 2005). In this study, we further characterize the side binding activity of AtFH8(FH1FH2) on

8 Xue et al. d AtFH8 Is Involved in Root Development 271 Figure 6. AtFH8 Participates in Arabidopsis Root Development. (A) Digital camera images of the primary root growth and lateral root initiation in 8-day-old wild-type, atfh8-1, and the PAtFH8:AtFH8 GFP complemented transgenic line treated with or without LatB. The primary root growth was slower and lateral root initiation was inhibited in atfh8-1 and the PAtFH8:AtFH8 GFP transgenic line complemented the phenotype. (B, C) The primary root length and the lateral root numbers of 8-day-old wild-type, atfh8-1, and PAtFH8:AtFH8 GFP treated with 0, 30, 40, and 50 nm of LatB, showing significantly (*P, 0.05) reduced primary root length and lateral root numbers of atfh8-1 seedlings in a LatB concentration-dependent manner. Mean values 6 95% confidence intervals are given for each genotype (n = 30). The loss of AtFH8 decreases the dividing cells of the root tip treatment with 40 nm LatB (D, E). The length of the epidermal cells of maturation zone in wild-type, atfh8-1, and PAtFH8:AtFH8-GFP (D). The numbers of dividing cells in root tips of wild-type, atfh8, and PAtFH8:AtFH8 GFP in the presence and absence of LatB at 3, 4, 5, 6, and 7 d after sowing (E). Solid diamond, wild-type without LatB; solid rectangle, atfh81 without LatB; the solid triangle, PAtFH8:AtFH8 GFP without LatB; the diamond, wild-type treatment with LatB; rectangle, atfh8-1 treatment with LatB; triangle, PAtFH8:AtFH8 GFP treatment with LatB. The experiment was performed independently four times, with similar results. Error bars indicate SE (n = 30).

9 272 Xue et al. d AtFH8 Is Involved in Root Development Figure 7. F-Actin Organization in the Root of 8-Day-Old Wild-Type and atfh8-1 Seedlings Marked by 35S:GFP fabd2 Treated With or Without 40 nm LatB. (A, E, I, M) Actin filaments in wild-type root without LatB. (A) The root apical meritem. (E) The cortex of the root vasculature. (I) The vasculature of the root. (M) Lateral root primordia. (B, F, J, N) Actin filaments in atfh8-1 root without LatB. (B) The root apical meristem. (F) The cortex of the root vasculature. (J) The vasculature of the root. (N) Lateral root primordia. (C, G, K, O) Actin filaments in wild-type root treated with 40 nm LatB. (C) The root apical meristem. (G) The cortex of the root vasculature. (K) The vasculature of the root. (O) Lateral root primordia. (D, H, L, P) Actin filaments in atfh8-1 root treated with 40 nm LatB. (D) The root apical meristem. (H) The cortex of the root vasculature. (L) The vasculature of the root. (P) Lateral root primordia. The open arrowheads, actin bundles in pericycle of the root; the solid arrowheads, Factin in lateral root primordia cells. In (A L), bar = 20 lm, and in (M P), bar = 10 lm.

10 Xue et al. d AtFH8 Is Involved in Root Development 273 actin organization and find that it can induce actin filaments to form actin bundles at 100 nm or higher concentration, which is confirmed by fluorescence microscopy, electron microscopy, and low-speed cosedimentation assay. AtFH8(FH2) can also bundle actin filaments, but the bundling ability is much weaker, probably because the actin filament side binding ability is weak. We reported previously that AtFH8(FH1FH2) nucleated actin assembly more effectively than AtFH8(FH2) (Yi et al., 2005). Other studies also reveal that the presence of FH1 domain modulates the functions of FH2 domain to some extent. For instance, AtFH1 FH2 transits from a strong capper to a leaky capper in the presence of the FH1 domain and lack of the FH1 domain can fully abolish the nucleating activity of AtFH5 FH2-Cter (Ingouff et al., 2005; Michelot et al., 2005). Since the nucleating, capping, or bundling activities of FH2 domain are all affected by the presence of FH1 domain, we presume that in addition to binding to profilin and regulating the assembly of actin profilin complex, the FH1 domain may modulate the function of FH2 domain in a presently unknown fashion. Both unbranched actin bundles and stellar structures are formed when actin is polymerized in the presence of higher concentrations of AtFH8(FH1FH2). The stellar structures form a center that carries actin bundles in different directions. The number of actin bundles in each stellar structure is similar, indicating that it should not be the consequence of random distributing of AtFH8(FH1FH2) dimers in the polymerization system. Ultracentrifugation ( g) also confirms that it is not a consequence of non-specific protein aggregation. Therefore, it is reasonable to assume that there might be oligomers existing in the solution that contains dimers, which may form a center that nucleates actin assembly and induces actin bundles with different directions. The oligomers have not yet been detected in FPLC and sedimentation velocity analytical ultracentrifugation. This is probably due to the amount of the oligomers being too low to be detected. Moreover, the ability of AtFH8(FH1FH2) to induce stellar structure formation is dependent on the FH1 domain, because AtFH8(FH2) can only induce actin bundle formation. The stellar structures only formed by AtFH8(FH1FH2) not AtFH8(FH2) may be due to their different capabilities of binding actin filaments or the FH1 domain may play an important role in inducing the stellar structure formation compared with the only FH2 domain. The immunofluorescence with the anti-his tag in vitro found that the AtFH8(FH1FH2) proteins stayed at the center of the stellar structures (our unpublished data), which may indicate that the AtFH8(FH1FH2) could nucleate actins in the center and then move to the side of the mother filament, where it can nucleate additional filaments or crosslink adjacent filaments into bundles and stellar structures (Michelot et al., 2006; Blanchoin and Staiger, 2008). Furthermore, we find that the ability of AtFH8(FH1FH2) to induce actin bundle and stellar structure formation is weakened, but not abolished, in the presence of profilin. Profilin binds to G-actin with 1:1 stoichiometry and forms moderate affinity profilin actin complexes (Valenta et al., 1993; Gibbon et al., 1998). The FH2 domain of formins is essential for actin filament nucleation, whereas the FH1 domain recruits profilin actin complexes to the assembly machine. The K d values reveal that that AtFH8(FH1FH2) binds to spontaneously assembled actin much tighter filaments in the presence of profilin than in the absence of profilin. Because it was found the AtFH8(FH1FH2) nucleated actin profilin assembly weaker than actin alone (Yi et al., 2005), we assume that the tight binding may result in fewer actin filaments in the polymerization system, and therefore fewer actin bundles exist. The results provide clues about how AtFH8 induce actin bundles and stellar structures directly even under in vivo conditions that G-actin mainly exists in a state of actin profilin complex (Gibbon et al., 1999). That AtFH8(FH1FH2) and AtFH8(FH2) can bundle ATP/ADP-Pi-loaded actin filaments also reveals that AtFH8 functions in living plant cells, because ATP/ ADP-Pi-loaded is the primary existing form of actin filaments in vivo (Wolven et al., 2000). In the study of AtFH8 localization, we find the N-terminus of AtFH8 and the full-length AtFH8is located primarily to the nuclear envelope. We failed to see any detectable fluorescent signals when the expression of the AtFH8 GFP fusion protein is driven by the AtFH8 native promoter, but the immunostaining using the anti-gfp antibody confirms the nuclear envelope and the newly formed cell wall localization. These results indicate that the native expression of AtFH8 is quite low, and the N-terminal transmembrane domain is critical for the proper localization of AtFH8 and the other domains may also be involved in the localization of the protein in vivo, although a small possibility exists that the organelle distribution might be due to overexpression of AtFH8. AtFH8 falls into the family of type-i Arabidopsis formins based on the N-terminal transmembrane domain (for review, see Deeks et al., 2002). The studies on other type-i Arabidopsis formins show that they localize in the plasma membrane (Cheung and Wu, 2004; Favery et al., 2004; Deeks et al., 2005). AtFH8 is the only Arabidopsis formin member reported to be targeted to nuclear envelope by its N-terminal transmembrane domain, reflecting the differences among the structurally similar type-i Arabidopsis formins. The spatial expression pattern of AtFH8 is focused on root apical meristem and the outgrowth points of lateral root and the result from characterizing atfh8 mutant indicate that AtFH8 is involved in the primary root elongation and the lateral root initiation. Our result shows that treatment with LatB on the atfh8 plants induces slightly slower primary root growth. LatB treatment does not impair the length of cells in the root maturation zone, but the number of dividing cells in the root apical meristem of atfh8 decreases, indicating that the shortage of the root length is due to less root cell number. Combined with the sub-cellular localization of AtFH8 in root tip cells, it is suggested that AtFH8 is involved in cell division in the root tip. AtFH5 has also been shown to localize in the maturing cell plates and play a role in cytokinesis (Ingouff

11 274 Xue et al. d AtFH8 Is Involved in Root Development et al., 2005). It is well known that intact actin cytoskeleton guided the dynamic vesicle traffic that is required for the polar transport of auxin, which plays a major role in controlling cell elongation (Muday and Murphy, 2002; Blakeslee et al., 2005; Rahman et al., 2007). It is reported that 10 lm concentration of LatB treatment induced dwarf Arabidopsis due to the impaired cell elongation in the absence of F-actin (Baluška et al., 2001; Barrero et al., 2002). The concentration of LatB used in our experiment is much lower (40 nm), which does not disrupt thick longitudinal actin bundles so that it may not affect the transport of auxin. However, actin networks of dividing cells are more sensitive to LatB than those of interphase cells (Sheahan et al., 2004). The actin filaments of the root meristem in atfh8 mutants are disrupted severely and then may impair the cell division of the root meristem. In addition, knockout of AtFH8 decreases the lateral root initiation sites. Lateral roots in Arabidopsis originate from the pericycle cells adjacent to the vascular bundles (De Smet et al., 2006). Its formation can be divided into two major phases: cell cycle reactivation in the pericycle and establishment of a new meristem, both of which need the periclinal and transverse divisions (Himanen et al., 2002). Recently, it has been shown to exhibit fine F-actin in lateral root primordia and thick longitudinal actin bundles in the base of lateral root, which indicates that actin cytoskeleton may play an important role in the lateral root development (Wang et al., 2008b). In our experiment, the fine F-actin in lateral root primordia and thick longitudinal actin bundles in the pericycle are also found in the wild-type lines, but the F-actin structures in the pericycle cells and lateral root primordia of atfh8 seedlings are destroyed severely after LatB treatment, indicating that AtFH8 may play an important role in maintaining intact actin structures during cell cycle reactivation in the pericycle cells or establishment of a new meristem, especially under the treatment of LatB. In conclusion, we speculate that AtFH8 is involved in root development through regulating actin cytoskeleton during cell division. Mechanism for the function of AtFH8 related with actin cytoskeleton during Arabidopsis lateral root initiation should be further studied. METHODS Protein Preparation and Purification Rabbit skeletal muscle actin was prepared as described by Pardee and Spudich (1982) and dialyzed against G-buffer (5 mm Tris-HCl, 0.1 mm CaCl 2, 1 mm DTT, and 0.05 mm ATP, ph 7.0). We expressed the truncated proteins AtFH8(FH1FH2) and AtFH8(FH2) as 6 His-tagged fusion proteins as described previously (Yi et al., 2005). BL21 (DE3) strain comprising the expression vector was grown to OD in LB (Luria-Bertani) medium, then the fusion proteins were induced by addition of 0.5 mm IPTG (isopropylthio-b-galactoside) at 20 C overnight. The bacterial cells were collected and re-suspended in binding buffer (400 mm NaCl, 40 mm NaH 2 PO 4, ph 8.0) followed by purification using a Ni-NTA HisBind â Resin according to the manufacturer s instruction (Novagen). The proteins were dialyzed against TK buffer (5 mm Tris, 50 mm KCl, 0.5 mm dithiothreitol, and 0.5 mm EDTA). All purification steps were conducted at 4 C. FPLC Analysis of AtFH8(FH1FH2) AtFH8(FH1FH2) was dialyzed against a buffer containing 20 mm Tris-HCl, 300 mm NaCl overnight then applied to AKTA Explorer system (GE Healthcare, USA) equipped with a XK16/70 column filled with Superdex 200 medium (GE Healthcare, USA). A gel filtration standard (Bio-Rad, USA) was used to calibrate the column. The fractions in the elution peak were collected and analyzed by SDS PAGE. Actin Bundle Observation by Fluorescence Microscopy Actin (3 lm) was polymerized at 4 C for 16 h in F-buffer (G-buffer containing 50 mm KCl, 2.5 mm MgCl 2, and 0.25 mm ATP). Then, AtFH8(FH1FH2) or AtFH8(FH2) or the corresponding dialysis buffer were added to each sample (800 nm final) and mixed by gentle flicking. After incubation at room temperature for 30 min, a 3 ll sample was mixed with a 2 ll F-buffer containing 6.6 lm Alexa Fluor â 488 phalloidin (Invitrogen, USA) and incubated for 5 min at 4 C. After being diluted with 45 ll 1 F buffer, the sample was observed on a laser scanning confocal microscope (Olympus FV300-IX 70, Japan). For observation of actin bundles induced during actin assembly, actin (3 lm) or actin profilin (1:4) complex was polymerized in the presence of 800 nm AtFH8(FH1FH2) or AtFH8(FH2) at room temperature for 1 h (Human profilin was used), stained with Alexa Fluor â 488 phalloidin (Invitrogen, USA) as described above, and observed on a fluorescence microscope (Zeiss Axio Imager A1, Germany). Actin Bundle Observation by Electron Microscopy For observation of actin bundles formed by pre-polymerized actin filaments, samples were prepared as for fluorescence microscopy, applied onto EM grids, and stained with 2% uranyl acetate. The sample was observed with JEM-1010 electron microscope (JEOL company, Japan) equipped with an AMT CCD camera (AMT Company, USA). For observation of actin bundles induced by AtFH8(FH1FH2) during actin assembly, actin (3 lm) was polymerized in the presence of various concentrations of AtFH8(FH1FH2) at room temperature for 1 h and observed on the same electron microscope. Low-Speed Cosedimentation Assay Actin (5 lm) was polymerized at 4 C for 16 h in F-buffer. AtFH8(FH1FH2) or AtFH8(FH2) was added to final concentrations of 200, 400, 600, and 800 nm, respectively, and the sample with the addition of TK buffer was used as control. After

12 Xue et al. d AtFH8 Is Involved in Root Development 275 incubated for 30 min at room temperature, the samples were centrifuged at g at 4 C for 30 min. The supernatants and pellets were analyzed by SDS PAGE. The gel obtained was quantified by a densitometry using Glyko Bandscan software (Glyko, Novato, CA, USA) and plotted with Microsoft Excel (Microsoft, USA). To quantify the bundling activity of AtFH8(FH1FH2) or AtFH8(FH2) during actin or actin profilin complex assembly, actin (5 lm) or actin profilin complex (1:4) were polymerized in the absence or presence of AtFH8(FH1FH2) or AtFH8(FH2) for 1 h at room temperature. Then the samples were treated and analyzed as described above. High-Speed Cosedimentation Assay Different concentrations of actin were polymerized at 4 C for 16 h. AtFH8(FH2) was added to a final concentration of 200 nm and mixed by gentle flicking. After incubation for 30 min on ice, the samples were centrifuged at g for 45 min at 4 C in a TLA-110 rotor (Beckman, Fullerton, CA, USA). After centrifugation, the supernatants and pellets were analyzed by SDS PAGE. The AtFH8(FH2) bands were quantified by densitometry using Glyko Bandscan software (Glyko, Novato, CA, USA) and the percentage of AtFH8(FH2) in pellets was calculated. To clarify the difference between AtFH8(FH1FH2) binding to nucleated actin filaments in the absence or presence of profilin, various concentrations of actin were polymerized in the presence of 200 nm AtFH8(FH1FH2), in the absence or presence of profilin, for 1 h. After ultracentrifugation at g for 1 h, supernatants and pellets were resolved by SDS PAGE and quantified as described above. Construction of Vectors and Plant Transformation The stable and inducible expressing vectors contain the forms of truncated AtFH8 fused with GFP were constructed. The DNA sequences encoding the full-length AtFH8 ( bp), the truncated AtFH8 lacking the transmembrane domain ( bp), and the N-terminal transmembrane domain of AtFH8 (1 450 bp) were amplified using pgem AtFH8 plasmid as a template. The cloned DNA fragments fused with GFP were cloned into the XhoI and SpeI restriction sites of per8 vector (Zuo et al., 2000) to produce the estrogen-inducible expression vectors. The coding sequence of GFP fabd2 (Sheahan et al., 2004) was cloned into the XbaI and SacI restriction sites of pcambia1300 and expressed as a living probe for F-actin the Arabidopsis plant. The native promoter sequence of AtFH8 was 1619 bp in length on the upstream of the start code. The sequence was amplified from the genome DNA of the wild-type Arabidopsis and cloned into the BamHI and HindIII restriction sites of pbi121 vector to produce the PAtFH8:GUS vector. The 35S promoter was instead by the AtFH8 promoter in the pcambia1300 vector carrying the AtFH8 fusion with GFP to produce the PAtFH8:AtFH8 GFP expression vector. By the floral dip method, the inducible expression vectors and the pbi121 vector containing the AtFH8 promoter fusion with the GUS gene (PAtFH8:GUS) were respectively transformed into wild-type Arabidopsis and AtFH8 T-DNA insertion homozygous mutant atfh8-1 (SALK_118841) and atfh8-2 (SALK_095392) (Clough and Bent, 1998). Seeds of homozygous atfh8-1 and atfh8-2 were obtained from ABRC (Alonso et al., 2003). The mutants were genetically analyzed by the primers: TBRP, TACTCAAGTCCAATGCTTTGG; TBLP, GCTTGTTTGTGA- AGCTTTTGG; TDRP, AAACTTGCAACCCACATTTTG; TDLP, AGG- AATCTCTGTAACGGGCTC; LBb1.3, ATTTTGCCGATTTCGGAAC. Transformed plants were selected by hygromycin or kanamycin resistance. T 2 plants positive for hygromycin were used as induction for AtFH8 expression and observe the localization of AtFH8 in different genetic backgrounds. More than 10 lines were observed for localization. 100 mg of 7-day-old seedlings of the above lines were used to extract RNA, reverse-transcripted, and a pair of AtFH8 specific primers (forward: CAGTTTCGATGGCGATTTAATG- GAA; reverse: TGAGCACAATCGCTGTGTTTT GAGA) was used to conduct standard RT PCR and fluorescence quantitative PCR according to the manufacturer s instructions (ABI, USA). Plant Growth and Analysis of Transgenic Lines All the seeds of homozygous atfh8-1 and atfh8-2 used in the experiments were surface-sterilized and planted onto cm plasma Petri dishes supplemented with MS salts, 3% sucrose, and 1% agar as described by Motes et al. (2005). The seeds were allowed to vernalize and imbibe for 2 3 d at 4 C. Then, the plates were transferred to a growth chamber set with 16 h light/8 h dark cycles at 22 C. For observing fluorescence of GFP, 5-day-old seedlings were transferred to the new plates that was added with 100 nm extrogen to induce the expression of GFP chimerics (AtFH8:GFP, DN:GFP, and N:GFP). For LatB treatment analysis, plates were wrapped with Parafilm and oriented vertically to allow roots to grow on the surface of the media. Plates were placed in a growth chamber set with 16 h light/8 h dark cycles at 22 C. Seedlings treated with LatB, which was dissolved with DMSO and kept in 20 C, were transferred to mediums with the LatB after 3 d. Growth of roots was monitored by capturing images of the roots for 8 d with a Sony DSC-S85 camera (Japan). The length of the primary root was measured from digitized images using Image J software. Lateral root numbers was measured with the AXIO IMAGER A1 microscope. The number of the dividing cells in the root tips was measured in accordance with Schutter et al. (2007). Root tips (most distal 2 3 mm) of 8-dayold seedlings in a control plate (0 nm LatB) or plate containing 40 nm LatB were harvested, stained with DAPI, and the number of mitotic cells per tips squashed. The microtubule depolymerizing and stabilizing drugs, oryzalin and taxol, were kept at 20 C and were used at the required concentration in the experiment. The drug treatment experiments were duplicated three times.