Intramolecular binding mode of the C-terminus of E. coli
|
|
- Emerald Booker
- 5 years ago
- Views:
Transcription
1 Supporting Information Intramolecular binding mode of the C-terminus of E. coli single-stranded DNA binding protein (SSB) determined by nuclear magnetic resonance spectroscopy Dmitry Shishmarev, Yao Wang, Claire E. Mason, Xun-Cheng Su, Aaron J. Oakley, Bim Graham, Thomas Huber, Nicholas E. Dixon and Gottfried Otting S1
2 Table S1. Long-range NOEs observed in SSB at ph LeuH γ 78TyrH δ 112LeuH δ a δ 78TyrH 112LeuH δ a βb 78TyrH 111MetH γ a δa 71LeuH 111MetH ε 70TyrH ε 111MetH ε 70TyrH δ 110GlnH N 79IleH γ 2 110GlnH N 79IleH δ1 110GlnH γ a ε 78TyrH 110GlnH β a ε 78TyrH 109MetH γ a γ2 79IleH 109MetH β a γa 77ValH 109MetH ε 77ValH γ a 109MetH ε 66ValH γ a 109MetH ε 67AlaH α 109MetH ε 63LeuH α 109MetH α 57ValH γ a 108ThrH N 79IleH γ 2 108ThrH γ 2 ε 78TyrH 108ThrH γ 2 δ 78TyrH 104AsnH α 60PheH β a 103ValH γ a αa 81GlyH 103ValH N 79IleH γ 2 102ValH γ a ε 60PheH 102ValH γ a δ 60PheH 102ValH β 60PheH δ 102ValH α 58ValH γ a 102ValH γ a γa 58ValH 102ValH γ a β 58ValH 101ValH γ b 84ArgH N 101ValH γ b 83LeuH N 101ValH γ b α 83LeuH 101ValH γ b αa 81GlyH 101ValH γ a αa 81GlyH 101ValH γ b 58ValH N 101ValH γ a δ2 55HisH 101ValH γ b δ2 55HisH 101ValH γ b δa 10LeuH 97TyrH δ 87LysH γ b 97TyrH δ 87LysH γ a 97TyrH ε 87LysH γ a 97TyrH δ 87LysH β a 97TyrH δ 85ThrH γ 2 97TyrH ε 85ThrH γ 2 96ArgH β a ε3 88TrpH 96ArgH β b ε1 88TrpH 96ArgH β b ε3 88TrpH 95AspH α 89ThrH γ 2 93GlyH α b γ2 89ThrH 93GlyH α a γ2 89ThrH 80GluH α 9IleH γ 2 80GluH α 9IleH β 79IleH γ 2 δa 10LeuH 79IleH β 10LeuH δ b 78TyrH δ 11ValH α 78TyrH δ 11ValH γ b 78TyrH ε 11ValH γ b 78TyrH ε 11ValH γ a 78TyrH ε 11ValH β 78TyrH δ 11ValH β 78TyrH ε 9IleH δ1 78TyrH ε 9IleH γ 2 78TyrH δ 9IleH γ 2 78TyrH β b γ2 9IleH 77ValH γ b δb 10LeuH 76GlnH α 13AsnH α 76GlnH β a α 13AsnH 73LysH α 16GlnH N 73LysH α 14LeuH δ a 73LysH α 14LeuH γ 70TyrH δ 66ValH α 70TyrH ε 66ValH α 70TyrH ε 66ValH γ a 70TyrH ε 66ValH γ b 70TyrH δ 66ValH γ a 70TyrH δ 66ValH γ b 70TyrH ε 66ValH β 70TyrH δ 66ValH β 70TyrH ε 19GluH γ a 70TyrH δ 10LeuH β b 60PheH α 29ValH γ b 60PheH δ 29ValH γ b 60PheH δ 29ValH γ a 60PheH ε 29ValH γ a 60PheH δ 29ValH γ b 60PheH ε 29ValH γ b 60PheH ζ 29ValH γ b 60PheH ε 23MetH ε 60PheH δ 23MetH ε 58ValH γ a α 31AsnH 57ValH γ a δa 10LeuH 55HisH δ 2 δb 10LeuH 55HisH δ 2 δa 10LeuH 55HisH δ 2 βb 10LeuH 55HisH ε 1 βb 10LeuH 55HisH ε 1 δb 10LeuH S2
3 55HisH ε 1 δa 10LeuH 55HisH β b δa 10LeuH 55HisH β a δa 10LeuH 55HisH β b δb 10LeuH 55HisH β a δb 10LeuH 54TrpH ζ 3 β 35AlaH 54TrpH ε 3 β 35AlaH 54TrpH ζ 3 α 35AlaH 54TrpH ε 3 β 35AlaH 54TrpH ζ 2 β 35AlaH 54TrpH η 2 β 35AlaH 54TrpH ε 1 β 35AlaH 54TrpH ε 3 β 33ThrH 54TrpH ε 3 γ2 33ThrH 54TrpH η 2 γ2 33ThrH 54TrpH ε 3 γb 20ValH 54TrpH ζ 3 αb 15GlyH 54TrpH ζ 3 αa 15GlyH 54TrpH η 2 αb 15GlyH 51GlnH β a η2 40TrpH 36ThrH γ 2 δb 10LeuH 35AlaH β 13AsnH β a 35AlaH β 13AsnH N 35AlaH β 12GlyH α b 32IleH γ 2 19GluH N 32IleH γ 2 βa 18ProH 30AlaH β 20ValH N 29ValH γ b ε 23MetH 29ValH γ a ε 23MetH 29ValH γ b γa 23MetH 29ValH γ a γb 23MetH 28AlaH N 23MetH ε 28AlaH β 22TyrH δ 28AlaH β 22TyrH ε 28AlaH α 22TyrH δ 28AlaH α 22TyrH ε Letters a and b in superscripts identify individual 1 H resonances of CH 2 groups, or individual CH 3 groups in isopropyl groups, using a for the more shielded resonance. All NOEs were suggested by CCPNMR Analysis (30) based on the assigned chemical shifts without reference to the 3D structure of the protein. No NOEs were observed that were not in agreement with the structure of SSB observed in the crystal structure 1EYG (9). S3
4 Table S2. PCSs measured for backbone amide protons of SSB with C1-lanthanide tag residue Tm 3 Tb 3 S R G V N K V I L V G N L G D E G V I L A T S E S W R D K A G E M K E Q H residue Tm 3 Tb 3 R V K G S Q V I Q L R T R K W T D Q S G Q Y T T E V V N V G T M M L G G R residue Tm 3 Tb 3 Q G A A G I Q G G Q Q Q G G N Q F S G A Q S R Q Q S A A A S E M D F D I F S4
5 Table S3. Δχ tensors determined from the PCSs of Table S2 a Δχ ax /10 32 m 3 Δχ rh /10 32 m 3 Tm 3+ Tb a The Δχ tensors were determined from the PCSs of Table S2 by fitting to the coordinates of the chain A of SSB in the crystal structure 1EYG (9). The PCSs were measured at ph 3.4 and 25 C for 15 N-labeled SSB E65C/E69D ligated with either a C1-Tm or a C1-Tb tag, using a sample with C1-Y tag as the diamagnetic reference. The fits were performed using the program Numbat (32), restricting the lanthanide position to be the same for the Tb 3+ and Tm 3+ data sets. S5
6 13 C ) A S R G V N K V I L V G N L G Q D P E V R Y M P N G G A V A N I T L A T S E S W R D K A T G E M K 13 C ) 13 1 H ) CSI SS E Q T E W H R V V L F G K L A E V A S E Y L R K G S Q V Y 13 C ) I E G Q L R T R K W T D Q S G Q D R Y T T 13 C ) 13 1 H ) CSI SS E V V V N V G G T M Q M L G G R Q G G G A P A G G N 13 C ) I G G G Q P Q G G W G Q P Q Q P Q G G N Q F S G 13 C ) 13 1 H ) CSI SS G A Q S R P Q Q S A P A A P S N E P P M D F D D D I 13 C ) P F 13 C ) 13 1 H ) CSI SS Figure S1. Secondary structure analysis of SSB. The figure was prepared using the program CCPNMR Analysis (30). The rows labeled δ( 13 C α ), δ( 13 C β ), δ( 13 C ), and δ( 1 H α ) indicate the chemical shift differences observed for any given residue with respect to the random coil S6
7 values of C α, C β, C, and H α resonances, respectively. The row labeled CSI reports the chemical shift indices (38). The segments of regular secondary structure in the chain A of the crystal structure 1EYG (9) are depicted underneath. Figure S2. Calculated versus experimental PCSs for the PCS-Rosetta structure that best fulfils the NMR data. The PCS data from residues in the OB-domain are shown in black while PCSs from residues in the C-peptide are shown in red. The left and right panels show the data for Tb 3+ and Tm 3+, respectively. S7
8 Figure S3. Revision of the 2.2 Å X-ray crystal structure of presumably proteolysed full length SSB (12). (A) Original structure, PDB code 1QVC; R = 0.247, Rfree = The OBfold is shown in cyan, except that regions where the amino acid sequence is out of register with the electron density (from residue 90) are shown in red. The orange segments of the Cdomain show weak and discontinuous electron density, with few clear protein protein or protein solvent interactions. (B) Revised structure, based on the deposited structure factors (PDB code 4MZ9), showing only the OB-fold (residues 1 114); R = 0.210, Rfree = S8
9 Supplementary References: 9. Raghunathan,S., Kozlov,A.G., Lohman,T.M. and Waksman,G. (2000) Structure of the DNA binding domain of E. coli SSB bound to ssdna. Nat. Struct. Biol., 7, Matsumoto,T., Morimoto,Y., Shibata,N., Kinebuchi,T., Shimamoto,N., Tsukihara,T. and Yasuoka,N. (2000) Roles of functional loops and C-terminal segments of a single-stranded DNA binding protein elucidated by X-ray structural analysis. J. Biochem., 127, Vranken,W.F., Boucher,W., Stevens,T.J., Fogh,R.H., Pajon,A., Llinas,M., Ulrich,E.L., Markley,J.L., Ionides,J. and Laue,E.D. (2005) The CCPN data model for NMR spectroscopy: development of a software pipeline. Proteins, 59, Schmitz,C., Stanton-Cook,M.J., Su,X.C., Otting, G. and Huber, T. (2008) Numbat: an interactive software tool for fitting Dc-tensors to molecular coordinates using pseudocontact shifts. J. Biomol. NMR, 41, Wishart,D.S., Sykes,B.D. and Richards,F.M. (1992) The chemical shift index: a fast and simple method for the assignment of protein secondary structure through NMR spectroscopy. Biochemistry, 31, S9
Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationSupporting information. Gadolinium tagging for high-precision measurements of 6 nm distances in protein assemblies by EPR
Supporting information Gadolinium tagging for high-precision measurements of 6 nm distances in protein assemblies by EPR Hiromasa Yagi, 1 Debamalya Banerjee, 2 Bim Graham, 3 Thomas Huber, 1 Daniella Goldfarb,
More informationProtein Structure Determination from Pseudocontact Shifts Using ROSETTA
Supporting Information Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Christophe Schmitz, Robert Vernon, Gottfried Otting, David Baker and Thomas Huber Table S0. Biological Magnetic
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationSupporting Information
S-1 Supporting Information Flaviviral protease inhibitors identied by fragment-based library docking into a structure generated by molecular dynamics Dariusz Ekonomiuk a, Xun-Cheng Su b, Kiyoshi Ozawa
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationDesorption/Ionization Efficiency of Common Amino Acids in. Surface-assisted Laser Desorption/ionization Mass Spectrometry
SUPPORTING INFORMATION Desorption/Ionization Efficiency of Common Amino Acids in Surface-assisted Laser Desorption/ionization Mass Spectrometry (SALDI-MS) with Nanostructured Platinum Syuhei Nitta, Hideya
More informationProtein Structures. 11/19/2002 Lecture 24 1
Protein Structures 11/19/2002 Lecture 24 1 All 3 figures are cartoons of an amino acid residue. 11/19/2002 Lecture 24 2 Peptide bonds in chains of residues 11/19/2002 Lecture 24 3 Angles φ and ψ in the
More informationPrinciples of Physical Biochemistry
Principles of Physical Biochemistry Kensal E. van Hold e W. Curtis Johnso n P. Shing Ho Preface x i PART 1 MACROMOLECULAR STRUCTURE AND DYNAMICS 1 1 Biological Macromolecules 2 1.1 General Principles
More informationProtein NMR. Bin Huang
Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationParamagnetic Effects BCMB/CHEM
Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationBasics of protein structure
Today: 1. Projects a. Requirements: i. Critical review of one paper ii. At least one computational result b. Noon, Dec. 3 rd written report and oral presentation are due; submit via email to bphys101@fas.harvard.edu
More informationProtein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.
Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small
More informationTHE UNIVERSITY OF MANITOBA. PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS
PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS EXAMINATION: Biochemistry of Proteins EXAMINER: J. O'Neil Section 1: You must answer all of
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationAnalysis and Prediction of Protein Structure (I)
Analysis and Prediction of Protein Structure (I) Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 2006 Free for academic use. Copyright @ Jianlin Cheng
More informationCAP 5510 Lecture 3 Protein Structures
CAP 5510 Lecture 3 Protein Structures Su-Shing Chen Bioinformatics CISE 8/19/2005 Su-Shing Chen, CISE 1 Protein Conformation 8/19/2005 Su-Shing Chen, CISE 2 Protein Conformational Structures Hydrophobicity
More informationProtein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche
Protein Structure Prediction II Lecturer: Serafim Batzoglou Scribe: Samy Hamdouche The molecular structure of a protein can be broken down hierarchically. The primary structure of a protein is simply its
More informationSupplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate dehydrogenase from Escherichia coli [ICD, pdb 1PB1, Mesecar, A. D., and Koshland,
More informationNB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5
SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,
More informationA prevalent intraresidue hydrogen bond stabilizes proteins
Supplementary Information A prevalent intraresidue hydrogen bond stabilizes proteins Robert W. Newberry 1 & Ronald T. Raines 1,2 * 1 Department of Chemistry and 2 Department of Biochemistry, University
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationStructure restraints from heteronuclear pseudocontact shifts generated by lanthanide tags at two different sites
Structure restraints from heteronuclear pseudocontact shifts generated by lanthanide tags at two different sites Benjamin J. G. Pearce 1, Shereen Jabar 1, Choy-Theng Loh 1, Monika Szabo 2, Bim Graham 2,
More informationStatistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics
Statistical Machine Learning Methods for Bioinformatics IV. Neural Network & Deep Learning Applications in Bioinformatics Jianlin Cheng, PhD Department of Computer Science University of Missouri, Columbia
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationSupplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R)
Supplementary Figure 1 Crystal contacts in COP apo structure (PDB code 3S0R) Shown in cyan and green are two adjacent tetramers from the crystallographic lattice of COP, forming the only unique inter-tetramer
More informationSupplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
More informationSUPPLEMENTARY INFORMATION
Dph2 SeMet (iron-free) # Dph2 (iron-free) Dph2-[4Fe-4S] Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell dimensions a, b, c (Å) 58.26, 82.08, 160.42 58.74, 81.87, 160.01 55.70, 80.53,
More informationDiphthamide biosynthesis requires a radical iron-sulfur enzyme. Pennsylvania State University, University Park, Pennsylvania 16802, USA
Diphthamide biosynthesis requires a radical iron-sulfur enzyme Yang Zhang, 1,4 Xuling Zhu, 1,4 Andrew T. Torelli, 1 Michael Lee, 2 Boris Dzikovski, 1 Rachel Koralewski, 1 Eileen Wang, 1 Jack Freed, 1 Carsten
More informationSingle-armed phenylsulfonated pyridine derivative of DOTA is a rigid
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supporting information Single-armed phenylsulfonated pyridine derivative of DTA is a rigid and
More informationTable 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2
Table 1. Crystallographic data collection, phasing and refinement statistics Native Hg soaked Mn soaked 1 Mn soaked 2 Data collection Space group P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 P2 1 2 1 2 1 Cell
More informationSolid-State NMR Structural Studies of Proteins Using Paramagnetic Probes
Solid-State NMR Structural Studies of Proteins Using Paramagnetic Probes Christopher Jaroniec Department of Chemistry & Biochemistry The Ohio State University Protein Structure by MAS Solid-State NMR D
More informationSUPPLEMENTARY INFORMATION
Table of Contents Page Supplementary Table 1. Diffraction data collection statistics 2 Supplementary Table 2. Crystallographic refinement statistics 3 Supplementary Fig. 1. casic1mfc packing in the R3
More informationProtein Structure Analysis and Verification. Course S Basics for Biosystems of the Cell exercise work. Maija Nevala, BIO, 67485U 16.1.
Protein Structure Analysis and Verification Course S-114.2500 Basics for Biosystems of the Cell exercise work Maija Nevala, BIO, 67485U 16.1.2008 1. Preface When faced with an unknown protein, scientists
More informationHydrogen/Deuterium Exchange Mass Spectrometry: A Mini-Tutorial
Florida State University National High Magnetic Field Laboratory Tallahassee-Florida Hydrogen/euterium Exchange Mass Spectrometry: A Mini-Tutorial George Bou-Assaf 56 th ASMS Conference June 2 nd, 2008
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationSupplementary Figures
1 Supplementary Figures Supplementary Figure 1 Type I FGFR1 inhibitors (a) Chemical structures of a pyrazolylaminopyrimidine inhibitor (henceforth referred to as PAPI; PDB-code of the FGFR1-PAPI complex:
More informationantibodies, it is first necessary to understand the solution structure antigenic human epithelial mucin core peptide. The peptide EXPERIMENTAL
Biochem. J. (1990) 267, 733-737 (Printed in Great Britain) Elements of secondary structure in a human epithelial mucin core peptide fragment Saul J. B. TENDLER Department of Pharmaceutical Sciences, University
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10955 Supplementary Figures Supplementary Figure 1. Electron-density maps and crystallographic dimer structures of the motor domain. (a f) Stereo views of the final electron-density maps
More informationCHAPTER 29 HW: AMINO ACIDS + PROTEINS
CAPTER 29 W: AMI ACIDS + PRTEIS For all problems, consult the table of 20 Amino Acids provided in lecture if an amino acid structure is needed; these will be given on exams. Use natural amino acids (L)
More informationFull wwpdb NMR Structure Validation Report i
Full wwpdb NMR Structure Validation Report i Feb 17, 2018 06:22 am GMT PDB ID : 141D Title : SOLUTION STRUCTURE OF A CONSERVED DNA SEQUENCE FROM THE HIV-1 GENOME: RESTRAINED MOLECULAR DYNAMICS SIMU- LATION
More informationSecondary and sidechain structures
Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationProtein Structure Determination
Protein Structure Determination Given a protein sequence, determine its 3D structure 1 MIKLGIVMDP IANINIKKDS SFAMLLEAQR RGYELHYMEM GDLYLINGEA 51 RAHTRTLNVK QNYEEWFSFV GEQDLPLADL DVILMRKDPP FDTEFIYATY 101
More informationPeptides And Proteins
Kevin Burgess, May 3, 2017 1 Peptides And Proteins from chapter(s) in the recommended text A. Introduction B. omenclature And Conventions by amide bonds. on the left, right. 2 -terminal C-terminal triglycine
More informationNanobiotechnology. Place: IOP 1 st Meeting Room Time: 9:30-12:00. Reference: Review Papers. Grade: 40% midterm, 60% final report (oral + written)
Nanobiotechnology Place: IOP 1 st Meeting Room Time: 9:30-12:00 Reference: Review Papers Grade: 40% midterm, 60% final report (oral + written) Midterm: 5/18 Oral Presentation 1. 20 minutes each person
More informationHomology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6
Homology models of the tetramerization domain of six eukaryotic voltage-gated potassium channels Kv1.1-Kv1.6 Hsuan-Liang Liu* and Chin-Wen Chen Department of Chemical Engineering and Graduate Institute
More informationTable S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.
Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1. PDZK1 constru cts Amino acids MW [kda] KD [μm] PEPT2-CT- FITC KD [μm] NHE3-CT- FITC KD [μm] PDZK1-CT-
More informationLS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor
LS1a Fall 2014 Problem Set #2 Due Monday 10/6 at 6 pm in the drop boxes on the Science Center 2 nd Floor Note: Adequate space is given for each answer. Questions that require a brief explanation should
More informationTridip Sheet, Raja Banerjee*
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Supplementary information The C NN motif: an intrinsic lover of sulfate and phosphate ions
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationMolecular dynamics simulations of anti-aggregation effect of ibuprofen. Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov
Biophysical Journal, Volume 98 Supporting Material Molecular dynamics simulations of anti-aggregation effect of ibuprofen Wenling E. Chang, Takako Takeda, E. Prabhu Raman, and Dmitri Klimov Supplemental
More informationDetails of Protein Structure
Details of Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Anne Mølgaard, Kemisk Institut, Københavns Universitet Learning Objectives
More informationCopyright Mark Brandt, Ph.D A third method, cryogenic electron microscopy has seen increasing use over the past few years.
Structure Determination and Sequence Analysis The vast majority of the experimentally determined three-dimensional protein structures have been solved by one of two methods: X-ray diffraction and Nuclear
More informationWelcome to all the participants
Homi Bhabha Centenary School on Relaxation in NMR and Related Aspects February 16-20, 2009 National Facility for High-Field NMR, TIFR Welcome to all the participants Relaxation References A. Abragam: Principles
More informationTHE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION
THE TANGO ALGORITHM: SECONDARY STRUCTURE PROPENSITIES, STATISTICAL MECHANICS APPROXIMATION AND CALIBRATION Calculation of turn and beta intrinsic propensities. A statistical analysis of a protein structure
More informationIdentification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr
188 Bulletin of Magnetic Resonance Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr Chang-Shin Lee and Chin Yu* Department of Chemistry, National Tsing Hua University
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationBIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total)
BIMS 503 Exam I September 24, 2007 _ /email: Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) Questions 1-6 refer to this situation: You are able to partially purify an enzyme activity
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Enhanced Recognition of Transmembrane Protein Domains with Prediction-based Structural Profiles Baoqiang Cao, Aleksey Porollo, Rafal Adamczak, Mark Jarrell and Jaroslaw Meller Contact:
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationOrientational degeneracy in the presence of one alignment tensor.
Orientational degeneracy in the presence of one alignment tensor. Rotation about the x, y and z axes can be performed in the aligned mode of the program to examine the four degenerate orientations of two
More informationCks1 CDK1 CDK1 CDK1 CKS1. are ice- lobe. conserved. conserved
Cks1 d CKS1 Supplementary Figure 1 The -Cks1 crystal lattice. (a) Schematic of the - Cks1 crystal lattice. -Cks1 crystallizes in a lattice that contains c 4 copies of the t - Cks1 dimer in the crystallographic
More informationLecture Notes Chem 51A S. King
Lecture Notes hem 51A S. King hapter 14 Nuclear Magnetic Resonance Spectroscopy Nuclear Magnetic Resonance (NMR) spectroscopy uses energy in the radiowave portion of the electromagnetic spectrum. The nuclei
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationT 1, T 2, NOE (reminder)
T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationSupporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
More informationNMR BMB 173 Lecture 16, February
NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks
More informationStructure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex
Structure and RNA-binding properties of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex Varun Bhaskar 1, Vladimir Roudko 2,3, Jerome Basquin 1, Kundan Sharma 4, Henning Urlaub 4, Bertrand Seraphin
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationExamples of Protein Modeling. Protein Modeling. Primary Structure. Protein Structure Description. Protein Sequence Sources. Importing Sequences to MOE
Examples of Protein Modeling Protein Modeling Visualization Examination of an experimental structure to gain insight about a research question Dynamics To examine the dynamics of protein structures To
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More informationSupporting Information How does Darunavir prevent HIV-1 protease dimerization?
Supporting Information How does Darunavir prevent HIV- protease dimerization? Danzhi Huang and Amedeo Caflisch a Department of Biochemistry University of Zürich, Winterthurerstrasse 9 CH-7 Zürich, Switzerland
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11085 Supplementary Tables: Supplementary Table 1. Summary of crystallographic and structure refinement data Structure BRIL-NOP receptor Data collection Number of crystals 23 Space group
More informationIntegral membrane protein structure determination using pseudocontact shifts
J Biomol NMR (2015) 61:197 207 DOI 10.1007/s10858-015-9899-6 ARTICLE Integral membrane protein structure determination using pseudocontact shifts Duncan J. Crick Jue X. Wang Bim Graham James D. Swarbrick
More informationSyllabus of BIOINF 528 (2017 Fall, Bioinformatics Program)
Syllabus of BIOINF 528 (2017 Fall, Bioinformatics Program) Course Name: Structural Bioinformatics Course Description: Instructor: This course introduces fundamental concepts and methods for structural
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationSUPPLEMENTARY INFORMATION
Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are
More informationProtein-nucleotide interactions detected by solid-state NMR
190 Å Protein-nucleotide interactions detected by solid-state NMR Dr. Thomas Wiegand CCPN Meeting 2017, Stirling 15/07/2017 120 Å HpDnaB ATP or ATP-analogues + ssdna? Laboratory of Physical Chemistry Group
More information- Basic understandings: - Mapping interactions:
NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis
More information