Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

Size: px
Start display at page:

Download "Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination"

Transcription

1 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

2 Protein Expression overexpression in E. coli - BL21(DE3) 1 H only (unlabelled) - LB or other rich source 15 N-specific label - 15 N aa, auxotroph E. coli strain 1 H, 13 C, 15 N (labelled) - M9 minimal 13 C-glucose - carbon source 15 N-NH 4 Cl - nitrogen source 2 H, 13 C, 15 N (labelled) - deuterated proteins 2 H, 13 C-glucose, 2 H 2 O

3 Protein Expression - other variations Gardner & Kay (1998) Ann. Rev. Biophys. Biomol. Str. 27, Goto & Kay (2000) Curr. Opin. Str. Biol. 10,

4 Sample Preparation mm protein (10 mg for 20 kda protein) ml buffer (CH 3 COONa, NaH 2 PO 4, HEPES etc) mm NaCl, KCl or other ph 2-8 H 2 O or H 2 O/D 2 O 5 C - 60 C

5 How do we Assign a Protein ie. determine all 1 H, 15 N and 13 C chemical shifts 1-5 aa - use 1D NMR - based on chemical shift tables aa - use 2D NMR - correlate 2 chemical shifts 1 H- 1 H, 1 H- 15 N, 1 H- 13 C >100 aa - use 3D NMR - correlate 3 chemical shifts 1 H- 1 H- 13 C, 1 H- 1 H- 15 N, 1 H- 13 C- 15 N

6 Protein is 13 C, 15 N labelled correlate 15 N shifts with attached 1 H (or 13 C- 1 H) D-R-E-V-I-L-I-S-H-I-P 1 H spectrum 15 N spectrum ppm ppm

7 Chemical Shift Assignment 1 H- 15 N Shift Correlation (HMQC or HSQC) D-R-E-V-I-L-I-S-H-I-P ppm H N O N H O ppm a fingerprint spectrum of the protein

8 1 H- 15 N Shift Correlation (HMQC) 1 H 1/2J 1/2J 15 N t 1 Decouple HN J=93 Hz HC J=143 Hz 5.37 msec 3.50 msec

9 Protein Expression - other variations Gardner & Kay (1998) Ann. Rev. Biophys. Biomol. Str. 27,

10 Chemical Shift Assignment. But how do we get the assignments D-R-E-V-I-L-I-S-H-I-P.. correlate three nuclei from different residues HNCACB - correlates HN with N and Cα, Cβ shifts (i, i-1) CBCA(CO)NH - correlates HN with N and i-1 Cα, Cβ shifts E V I L H N O N H O H N O N H O

11 Chemical Shift Assignment HNCACB, CBCA(CO)NH are 3D NMR methods ppm ppm C ppm 1 H ppm 15 N

12 CBCA(CO)NH, HNCACB Strategy HNCACB Strips Kanelis et al (2001)

13 Chemical Shift Assignment HNCA HN(CO)CA HNCO H(CCO)NH C(CO)NH HCCH-TOCSY

14 Table of chemical shift assignments Retrieve

15 Table of chemical shift assignments - BMRB other information

16 Structure Determination by NMR Spectroscopy 1) Sequence of protein 2) Table of chemical shift assignments 3) Secondary structure - Chemical Shift Index 4) Three Dimensional Structure -we need info about how structure is folded -use 1 H- 1 H distances -will use existing NMR assignments and simply give correlations between 1 Hs close in space

17 Chemical Shift Index Recall ν s = γb 0 2π σ γb 0 2π (Hz) σ = shielding constant φ,ψ affect this also α-helix β-sheet φ ~ -60, ψ ~ 40 φ ~ -140, ψ ~ 140 Chemical shifts of backbone atoms should depend on α-helix or β-sheet structure

18 Chemical Shift Index Wishart et. al. (1992) Biochemistry 31, α-helix β-sheet Ηα δ < average ± range δ > average ± range Cβ δ < average ± range δ > average ± range C δ > average ± range δ < average ± range Cα δ > average ± range δ < average ± range ppm 1 0 ppm

19 Chemical Shift Index _Residue_label _Atom_name _Atom_type _All_chem_shift_value _Coil_chem_shift_value _Beta_strand_chem_shift_value _Helix_chem_shift_value _CSI_chem_shift_value _CSI_chem_shift_range ALA H H ALA HA H ALA C C ALA CA C ALA CB C ALA N N

20 Chemical Shift Index Value Hα, Cβ δ < average ± range -1.0 (helix) δ > average ± range 1.0 (sheet) Cα, C δ > average ± range -1.0 (helix) δ < average ± range 1.0 (sheet) Examine Values for each residue (max. 4) > 2/3 or 3/4 for each, define residue as 1 or -1 4 or more -1s α-helix 3 or more 1s β-sheet

21 Chemical Shift Index - calculate from chemical shift tables β-sheet α-helix β-sheet α-helix α-helix - provides 2 structure - use 1 H- 1 H distances to determine entire structure

22 Structure Determination Nuclear Overhauser Effect (noe) H i r ij H j noe η ij = γ 4 h 2 (τ app - 6τ app ) 10r ij ωτ app

23 Structure Determination Nuclear Overhauser Effect (noe) H i r ij H j noe (η ij ) - change in intensity of an NMR resonance when the transitions of another are perturbed η ij = (Ι Ι 0 ) I 0 η Ηα = Κ r Ηα 6 N H Hε Hδ Hα Hζ Hβ Hβ O Hε Hδ 2.46 Å η δε = Κ r δε 6 η Ηα = η δε r δε 6 r Hα 6

24 13 C or 15 N NOESY Kanelis et al (2001)

25 Structure Determination 1) Sequence of protein 2) Table of chemical shift assignments 3) Secondary structure - CSI 4) Distance information from noe Calculate Structure

26 Structure Determination What information do we have 1) Polypeptide chain - sequence, atoms, bonds 2) Distances between 1 H- 1 H pairs 3) φ,ψ angles from CSI (TALOS) using chemical shifts INPUT computer algorithm that attempts to satisfy all Xplor, CNS, DIANA, GROMOS Repeat x - look for similar fold unique structure

27 Structure Determination NMR Data Random Structure Bonding Info Distance / Torsional Restraints Folding E noe = k(r c -r u ) 2 E dih = k(φ c -φ u ) 2 Global Fold Refinement H-bonds RDC Final Structures

28 Structure Determination What to look for. 1) Many noes > 10 / residue, 200aa >2000 distances 2) Representative family of structures ~ 20 well structured bb rms ~ 0.5 ± 0.1 Å 3) Ramachandran Plot - > 85% most favoured 4) Poorly defined areas - higher rms may be flexible or lack of noes 5) Inconsistancies in distances r obs r calc no violations > 0.3 Å 6) Structures deposited + NMR data

Triple Resonance Experiments For Proteins

Triple Resonance Experiments For Proteins Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased

More information

Deuteration: Structural Studies of Larger Proteins

Deuteration: Structural Studies of Larger Proteins Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated

More information

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

3D NMR 3D NMR 3D NMR. Visualising 3D NMR spectra. strip plots. preparation mixing mixing t1 t2 t3 I S T I

3D NMR 3D NMR 3D NMR. Visualising 3D NMR spectra. strip plots. preparation mixing mixing t1 t2 t3 I S T I 3D NMR 3D NMR Chris Waudby c.waudby@ucl.ac.uk 3D NMR Visualising 3D NMR spectra preparation mixing mixing t1 t2 t3 I S T I 2 indirect dimensions, independently incremented evolution times Much longer acquisition

More information

Introduction solution NMR

Introduction solution NMR 2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics

More information

Sequential Assignment Strategies in Proteins

Sequential Assignment Strategies in Proteins Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

Protein NMR. Bin Huang

Protein NMR. Bin Huang Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear

More information

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.

More information

Labelling strategies in the NMR structure determination of larger proteins

Labelling strategies in the NMR structure determination of larger proteins Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts

More information

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07 NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each

More information

Protein-protein interactions and NMR: G protein/effector complexes

Protein-protein interactions and NMR: G protein/effector complexes Protein-protein interactions and NMR: G protein/effector complexes Helen Mott 5th CCPN Annual Conference, August 2005 Department of Biochemistry University of Cambridge Fast k on,off >> (ν free - ν bound

More information

Useful background reading

Useful background reading Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns

More information

Finding Bonds, H-bonds

Finding Bonds, H-bonds Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify

More information

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic

More information

Supporting Information

Supporting Information Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

More information

Protein NMR. Part III. (let s start by reviewing some of the things we have learned already)

Protein NMR. Part III. (let s start by reviewing some of the things we have learned already) Protein NMR Part III (let s start by reviewing some of the things we have learned already) 1. Magnetization Transfer Magnetization transfer through space > NOE Magnetization transfer through bonds > J-coupling

More information

HSQC spectra for three proteins

HSQC spectra for three proteins HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein

More information

Supporting Information

Supporting Information Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)

More information

Basic principles of multidimensional NMR in solution

Basic principles of multidimensional NMR in solution Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra

More information

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Residual Dipolar Couplings BCMB/CHEM 8190

Residual Dipolar Couplings BCMB/CHEM 8190 Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)

More information

1. 3-hour Open book exam. No discussion among yourselves.

1. 3-hour Open book exam. No discussion among yourselves. Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear

More information

NMR in Structural Biology

NMR in Structural Biology NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling

More information

Protein-protein interactions by NMR

Protein-protein interactions by NMR Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off

More information

Photochemical and Structural Studies on Cyclic Peptide Models

Photochemical and Structural Studies on Cyclic Peptide Models Article Photochemical and Structural Studies on Cyclic Peptide Models Tamás Milán Nagy 1, Krisztina Knapp 2, Eszter Illyés 3, István Timári 1, Gitta Schlosser 4, Gabriella Csík 5, Attila Borics 6, *, Zsuzsa

More information

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of

More information

Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings

Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings Jose Luis Ortega-Roldan, Malene Ringkjøbing Jensen*, Bernhard Brutscher, Ana I. Azuaga, Martin

More information

Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example

Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,

More information

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,

More information

PROTEIN'STRUCTURE'DETERMINATION'

PROTEIN'STRUCTURE'DETERMINATION' PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

NMR Assay of Purity and Folding

NMR Assay of Purity and Folding NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze

More information

Resonance assignments in proteins. Christina Redfield

Resonance assignments in proteins. Christina Redfield Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function

More information

Julia Audrey Barette. Copyright by Julia Audrey Barette, 2011

Julia Audrey Barette. Copyright by Julia Audrey Barette, 2011 Cross Validation of the Structure of a Transiently Formed and Low Populated FF Domain Folding Intermediate Determined by Relaxation Dispersion NMR and CS- Rosetta by Julia Audrey Barette A thesis submitted

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

NMR Spectroscopy: A Quantum Phenomena

NMR Spectroscopy: A Quantum Phenomena NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)

More information

Supplementary Figure 1.

Supplementary Figure 1. a b c d e f g 1 Supplementary Figure 1. Identification of unfolded regions in the Chz1-H2A.Z-H2B complex and structure and dynamics of Chz.core-sH2B_H2A.Z. (a) 1 H- 15 N HSQC spectrum of Chz1. All backbone

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,

More information

Chemical Shift Restraints Tools and Methods. Andrea Cavalli

Chemical Shift Restraints Tools and Methods. Andrea Cavalli Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods

More information

Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts

Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts 202 Bulletin of Magnetic Resonance Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts Brian J. Stockman, Terrence A. Scahill, Annica Euvrard,

More information

A topology-constrained distance network algorithm for protein structure determination from NOESY data

A topology-constrained distance network algorithm for protein structure determination from NOESY data University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network

More information

Guided Prediction with Sparse NMR Data

Guided Prediction with Sparse NMR Data Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of

More information

Basics of NMR Spectroscopy. Mark Maciejewski Nov 29, 2016

Basics of NMR Spectroscopy. Mark Maciejewski Nov 29, 2016 Basics of NMR Spectroscopy Mark Maciejewski markm@uchc.edu Nov 29, 2016 What is Spectroscopy? Spectroscopy is the study of the interaction of electromagnetic radiation (light) with matter. NMR uses electromagnetic

More information

Macromolecular X-ray Crystallography

Macromolecular X-ray Crystallography Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection

More information

Structure determination

Structure determination Structure determination NMR Structural Constraints 1. Internuclear distances (Nuclear Overhauser Effect) NOE R -6 2. Dihedral angles (J-coupling): 3 J NHα = 6.4 cos 2 (Φ -60) 1.4cos(Φ -60) + 1.9 3. C hem

More information

Structure determination through NMR

Structure determination through NMR Structure determination through NMR Protein Sample NMR data acquisition Sequential resonance assignment Collection of conformational constraints 3D structure calculations Structure refinement and Analysis

More information

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

More information

Resonance Assignment of the RGS Domain of Human RGS10

Resonance Assignment of the RGS Domain of Human RGS10 Resonance Assignment of the RGS Domain of Human RGS10 Oleg Y. Fedorov 2, Victoria A. Higman 1, Peter Schmieder 1, Martina Leidert 1, Annette Diehl 1, Jonathan Elkins 2, Meera Soundararajan 2, Hartmut Oschkinat

More information

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190

Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,

More information

Secondary and sidechain structures

Secondary and sidechain structures Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.

More information

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2

More information

Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions. John Gross, Ph.D.

Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions. John Gross, Ph.D. Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions John Gross, Ph.D. Nuclear Spins: Microscopic Bar Magnets H µ S N N + Protein Fragment Magnetic Moment Bar Magnet

More information

Solving the three-dimensional solution structures of larger

Solving the three-dimensional solution structures of larger Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of

More information

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research 2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th

More information

Algorithms for analysis of NMR projections: Design, implementation and applications

Algorithms for analysis of NMR projections: Design, implementation and applications Thesis for the degree of doctor of Philosophy Algorithms for analysis of NMR projections: Design, implementation and applications Jonas Fredriksson Department of Chemistry University of Gothenburg Sweden

More information

Origin of Chemical Shifts BCMB/CHEM 8190

Origin of Chemical Shifts BCMB/CHEM 8190 Origin of Chemical Shifts BCMB/CHEM 8190 Empirical Properties of Chemical Shift υ i (Hz) = γb 0 (1-σ i ) /2π The Larmor frequencies of nuclei depend on the electronic structure of the molecule and the

More information

TROSY-type Triple-Resonance Experiments for Sequential NMR Assignments of Large Proteins

TROSY-type Triple-Resonance Experiments for Sequential NMR Assignments of Large Proteins 844 J. Am. Chem. Soc. 999, 2, 844-848 TOSY-type Triple-esonance Experiments for Sequential NM Assignments of Large Proteins Michael Salzmann,, Gerhard Wider, Konstantin Pervushin, Hans Senn, and Kurt Wuthrich*,

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments

Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments Spectroscopy 17 (2003) 161 167 161 IOS Press Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments Michael J. Goger a,, James M. McDonnell

More information

Connecting NMR data to biomolecular structure and dynamics

Connecting NMR data to biomolecular structure and dynamics Connecting NMR data to biomolecular structure and dynamics David A. Case Chem 538, Spring, 2014 Basics of NMR All nuclei are characterized by a spin quantum number I, which can be 0, 1/2, 1, 3/2, 2...

More information

Outline. Introduction to membrane fusion Experimental methods Results Discussion and conclusion

Outline. Introduction to membrane fusion Experimental methods Results Discussion and conclusion Three-dimensional Structure of the rsly1 N-terminal Domain Reveals a Conformational Change Induced by Binding to Syntaxin 5 Demet Arac, Irina Dulubova, Jimin Pei, Iryna Huryeva, Nick V. Grishin and Josep

More information

Structurele Biologie NMR

Structurele Biologie NMR MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans

More information

Experimental Techniques in Protein Structure Determination

Experimental Techniques in Protein Structure Determination Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance

More information

PROTEIN NMR SPECTROSCOPY

PROTEIN NMR SPECTROSCOPY List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban

More information

Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack

Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Technical Overview Author George Gray Agilent Technologies Santa Rosa, CA USA Introduction In the last fi fteen years, scientists have

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR

More information

Practical Manual. General outline to use the structural information obtained from molecular alignment

Practical Manual. General outline to use the structural information obtained from molecular alignment Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,

More information

Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain,

Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, 026 Biochemistry 2003, 42, 026-039 Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, Shashank Deep, Kerfoot P. Walker, III, Zhanyong Shu, and Andrew P. Hinck*,

More information

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain

More information

NMR, X-ray Diffraction, Protein Structure, and RasMol

NMR, X-ray Diffraction, Protein Structure, and RasMol NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure

More information

Introduction to" Protein Structure

Introduction to Protein Structure Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.

More information

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens

More information

Enhanced Chemical Shift Analysis for Secondary Structure prediction of protein

Enhanced Chemical Shift Analysis for Secondary Structure prediction of protein Journal of the Korean Magnetic Resonance Society 2014, 18, 36-40 DOI 10.6564/JKMRS.2014.18.1.036 Enhanced Chemical Shift Analysis for Secondary Structure prediction of protein Won-Je Kim 2ǂ, Jin-Kyu Rhee

More information

Superposition of chemical shifts in NMR spectra can be overcome to determine automatically the structure of a protein

Superposition of chemical shifts in NMR spectra can be overcome to determine automatically the structure of a protein Spectroscopy 17 (2003) 559 568 559 IOS Press Superposition of chemical shifts in NMR spectra can be overcome to determine automatically the structure of a protein D. Auguin a, V. Catherinot a, T.E. Malliavin

More information

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity

More information

Nuclear Magnetic Resonance (NMR)

Nuclear Magnetic Resonance (NMR) Nuclear Magnetic Resonance (NMR) E E increases with increasing magnetic field strength Boltzmann distribution at thermal equilibrium: N (m=-1/2) /N (m=+1/2) = e ( E/kT) with E = γ(h/2π)b o NMR Physical

More information

Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev

Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR Dmitry M. Korzhnev Department of Molecular, Microbial and Structural Biology University of Connecticut Health Center 263 Farmington

More information

Determining Protein Structure BIBC 100

Determining Protein Structure BIBC 100 Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic

More information

Protein-protein interactions (PPIs) via NMR. Paola Turano

Protein-protein interactions (PPIs) via NMR. Paola Turano Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction

More information

3D Picture of the Syk-Vav1 Protein complex Student Author

3D Picture of the Syk-Vav1 Protein complex Student Author 3D Picture of the Syk-Vav1 Protein complex Student Author Dan Piraner is a senior majoring in biology (with a specialization in biochemistry) and chemistry. He began his undergraduate research as a freshman

More information

Structural and kinetic characterization of the simplified SH3 domain FP1

Structural and kinetic characterization of the simplified SH3 domain FP1 Structural and kinetic characterization of the simplified SH3 domain FP1 QIAN YI, 1 PONNI RAJAGOPAL, 1 RACHEL E. KLEVIT, 1 AND DAVID BAKER 1,2 1 Department of Biochemistry and 2 Howard Hughes Medical Institute,

More information

The wonderful world of NUCLEIC ACID NMR!

The wonderful world of NUCLEIC ACID NMR! Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically

More information

About one-third of the genes in living organisms are assumed

About one-third of the genes in living organisms are assumed Transverse relaxation-optimized NMR spectroscopy with the outer membrane protein OmpX in dihexanoyl phosphatidylcholine micelles César Fernández, Koba Adeishvili*, and Kurt Wüthrich Institut für Molekularbiologie

More information

Received 29 November 1999; accepted 29 February 2000

Received 29 November 1999; accepted 29 February 2000 Toward Direct Determination of Conformations of Protein Building Units from Multidimensional NMR Experiments I. A Theoretical Case Study of For-Gly-NH 2 and For-L-Ala-NH 2 ANDRÁS PERCZEL, 1 ATTILA G. CSÁSZÁR

More information

Paramagnetic Effects BCMB/CHEM

Paramagnetic Effects BCMB/CHEM Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti

More information

Nature Structural & Molecular Biology: doi: /nsmb.3194

Nature Structural & Molecular Biology: doi: /nsmb.3194 Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-

More information

Model-Free Approach to Internal Motions in Proteins

Model-Free Approach to Internal Motions in Proteins Model-Free Approach to Internal Motions in Proteins Lipari & Szabo, JACS 104, 4546 (1982) Palmer AG. Ann. Rev. Biophys. Biomol. Struc., 30, 129-155 (2001) Palmer AG, Kroenke CD, Loria JP, Meth. Enzymol.

More information

Christopher Pavlik Bioanalytical Chemistry March 2, 2011

Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance of Proteins Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance NMR Application of a magnetic field causes absorption of EM energy that induces

More information