Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
|
|
- Gwen Arnold
- 5 years ago
- Views:
Transcription
1 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
2 Protein Expression overexpression in E. coli - BL21(DE3) 1 H only (unlabelled) - LB or other rich source 15 N-specific label - 15 N aa, auxotroph E. coli strain 1 H, 13 C, 15 N (labelled) - M9 minimal 13 C-glucose - carbon source 15 N-NH 4 Cl - nitrogen source 2 H, 13 C, 15 N (labelled) - deuterated proteins 2 H, 13 C-glucose, 2 H 2 O
3 Protein Expression - other variations Gardner & Kay (1998) Ann. Rev. Biophys. Biomol. Str. 27, Goto & Kay (2000) Curr. Opin. Str. Biol. 10,
4 Sample Preparation mm protein (10 mg for 20 kda protein) ml buffer (CH 3 COONa, NaH 2 PO 4, HEPES etc) mm NaCl, KCl or other ph 2-8 H 2 O or H 2 O/D 2 O 5 C - 60 C
5 How do we Assign a Protein ie. determine all 1 H, 15 N and 13 C chemical shifts 1-5 aa - use 1D NMR - based on chemical shift tables aa - use 2D NMR - correlate 2 chemical shifts 1 H- 1 H, 1 H- 15 N, 1 H- 13 C >100 aa - use 3D NMR - correlate 3 chemical shifts 1 H- 1 H- 13 C, 1 H- 1 H- 15 N, 1 H- 13 C- 15 N
6 Protein is 13 C, 15 N labelled correlate 15 N shifts with attached 1 H (or 13 C- 1 H) D-R-E-V-I-L-I-S-H-I-P 1 H spectrum 15 N spectrum ppm ppm
7 Chemical Shift Assignment 1 H- 15 N Shift Correlation (HMQC or HSQC) D-R-E-V-I-L-I-S-H-I-P ppm H N O N H O ppm a fingerprint spectrum of the protein
8 1 H- 15 N Shift Correlation (HMQC) 1 H 1/2J 1/2J 15 N t 1 Decouple HN J=93 Hz HC J=143 Hz 5.37 msec 3.50 msec
9 Protein Expression - other variations Gardner & Kay (1998) Ann. Rev. Biophys. Biomol. Str. 27,
10 Chemical Shift Assignment. But how do we get the assignments D-R-E-V-I-L-I-S-H-I-P.. correlate three nuclei from different residues HNCACB - correlates HN with N and Cα, Cβ shifts (i, i-1) CBCA(CO)NH - correlates HN with N and i-1 Cα, Cβ shifts E V I L H N O N H O H N O N H O
11 Chemical Shift Assignment HNCACB, CBCA(CO)NH are 3D NMR methods ppm ppm C ppm 1 H ppm 15 N
12 CBCA(CO)NH, HNCACB Strategy HNCACB Strips Kanelis et al (2001)
13 Chemical Shift Assignment HNCA HN(CO)CA HNCO H(CCO)NH C(CO)NH HCCH-TOCSY
14 Table of chemical shift assignments Retrieve
15 Table of chemical shift assignments - BMRB other information
16 Structure Determination by NMR Spectroscopy 1) Sequence of protein 2) Table of chemical shift assignments 3) Secondary structure - Chemical Shift Index 4) Three Dimensional Structure -we need info about how structure is folded -use 1 H- 1 H distances -will use existing NMR assignments and simply give correlations between 1 Hs close in space
17 Chemical Shift Index Recall ν s = γb 0 2π σ γb 0 2π (Hz) σ = shielding constant φ,ψ affect this also α-helix β-sheet φ ~ -60, ψ ~ 40 φ ~ -140, ψ ~ 140 Chemical shifts of backbone atoms should depend on α-helix or β-sheet structure
18 Chemical Shift Index Wishart et. al. (1992) Biochemistry 31, α-helix β-sheet Ηα δ < average ± range δ > average ± range Cβ δ < average ± range δ > average ± range C δ > average ± range δ < average ± range Cα δ > average ± range δ < average ± range ppm 1 0 ppm
19 Chemical Shift Index _Residue_label _Atom_name _Atom_type _All_chem_shift_value _Coil_chem_shift_value _Beta_strand_chem_shift_value _Helix_chem_shift_value _CSI_chem_shift_value _CSI_chem_shift_range ALA H H ALA HA H ALA C C ALA CA C ALA CB C ALA N N
20 Chemical Shift Index Value Hα, Cβ δ < average ± range -1.0 (helix) δ > average ± range 1.0 (sheet) Cα, C δ > average ± range -1.0 (helix) δ < average ± range 1.0 (sheet) Examine Values for each residue (max. 4) > 2/3 or 3/4 for each, define residue as 1 or -1 4 or more -1s α-helix 3 or more 1s β-sheet
21 Chemical Shift Index - calculate from chemical shift tables β-sheet α-helix β-sheet α-helix α-helix - provides 2 structure - use 1 H- 1 H distances to determine entire structure
22 Structure Determination Nuclear Overhauser Effect (noe) H i r ij H j noe η ij = γ 4 h 2 (τ app - 6τ app ) 10r ij ωτ app
23 Structure Determination Nuclear Overhauser Effect (noe) H i r ij H j noe (η ij ) - change in intensity of an NMR resonance when the transitions of another are perturbed η ij = (Ι Ι 0 ) I 0 η Ηα = Κ r Ηα 6 N H Hε Hδ Hα Hζ Hβ Hβ O Hε Hδ 2.46 Å η δε = Κ r δε 6 η Ηα = η δε r δε 6 r Hα 6
24 13 C or 15 N NOESY Kanelis et al (2001)
25 Structure Determination 1) Sequence of protein 2) Table of chemical shift assignments 3) Secondary structure - CSI 4) Distance information from noe Calculate Structure
26 Structure Determination What information do we have 1) Polypeptide chain - sequence, atoms, bonds 2) Distances between 1 H- 1 H pairs 3) φ,ψ angles from CSI (TALOS) using chemical shifts INPUT computer algorithm that attempts to satisfy all Xplor, CNS, DIANA, GROMOS Repeat x - look for similar fold unique structure
27 Structure Determination NMR Data Random Structure Bonding Info Distance / Torsional Restraints Folding E noe = k(r c -r u ) 2 E dih = k(φ c -φ u ) 2 Global Fold Refinement H-bonds RDC Final Structures
28 Structure Determination What to look for. 1) Many noes > 10 / residue, 200aa >2000 distances 2) Representative family of structures ~ 20 well structured bb rms ~ 0.5 ± 0.1 Å 3) Ramachandran Plot - > 85% most favoured 4) Poorly defined areas - higher rms may be flexible or lack of noes 5) Inconsistancies in distances r obs r calc no violations > 0.3 Å 6) Structures deposited + NMR data
Triple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More information3D NMR 3D NMR 3D NMR. Visualising 3D NMR spectra. strip plots. preparation mixing mixing t1 t2 t3 I S T I
3D NMR 3D NMR Chris Waudby c.waudby@ucl.ac.uk 3D NMR Visualising 3D NMR spectra preparation mixing mixing t1 t2 t3 I S T I 2 indirect dimensions, independently incremented evolution times Much longer acquisition
More informationIntroduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationProtein NMR. Bin Huang
Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationLabelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More informationJeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07
NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each
More informationProtein-protein interactions and NMR: G protein/effector complexes
Protein-protein interactions and NMR: G protein/effector complexes Helen Mott 5th CCPN Annual Conference, August 2005 Department of Biochemistry University of Cambridge Fast k on,off >> (ν free - ν bound
More informationUseful background reading
Overview of lecture * General comment on peptide bond * Discussion of backbone dihedral angles * Discussion of Ramachandran plots * Description of helix types. * Description of structures * NMR patterns
More informationFinding Bonds, H-bonds
Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationProtein NMR. Part III. (let s start by reviewing some of the things we have learned already)
Protein NMR Part III (let s start by reviewing some of the things we have learned already) 1. Magnetization Transfer Magnetization transfer through space > NOE Magnetization transfer through bonds > J-coupling
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationSupporting Information
Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)
More informationBasic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationResidual Dipolar Couplings BCMB/CHEM 8190
Residual Dipolar Couplings BCMB/CHEM 8190 Recent Reviews Prestegard, A-Hashimi & Tolman, Quart. Reviews Biophys. 33, 371-424 (2000). Bax, Kontaxis & Tjandra, Methods in Enzymology, 339, 127-174 (2001)
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationNMR in Structural Biology
NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three?
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
More informationProtein-protein interactions by NMR
Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off
More informationPhotochemical and Structural Studies on Cyclic Peptide Models
Article Photochemical and Structural Studies on Cyclic Peptide Models Tamás Milán Nagy 1, Krisztina Knapp 2, Eszter Illyés 3, István Timári 1, Gitta Schlosser 4, Gabriella Csík 5, Attila Borics 6, *, Zsuzsa
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationAccurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings
Accurate Characterisation of Weak Protein- Protein Interactions by Titration of NMR Residual Dipolar Couplings Jose Luis Ortega-Roldan, Malene Ringkjøbing Jensen*, Bernhard Brutscher, Ana I. Azuaga, Martin
More informationEvaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example
Biochemistry 2000, 39, 13365-13375 13365 Evaluation of the Utility of NMR Structures Determined from Minimal NOE-Based Restraints for Structure-Based Drug Design, Using MMP-1 as an Example Xuemei Huang,
More information1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )
Uses of NMR: 1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI ) 3) NMR is used as a method for determining of protein, DNA,
More informationPROTEIN'STRUCTURE'DETERMINATION'
PROTEIN'STRUCTURE'DETERMINATION' USING'NMR'RESTRAINTS' BCMB/CHEM'8190' Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationJulia Audrey Barette. Copyright by Julia Audrey Barette, 2011
Cross Validation of the Structure of a Transiently Formed and Low Populated FF Domain Folding Intermediate Determined by Relaxation Dispersion NMR and CS- Rosetta by Julia Audrey Barette A thesis submitted
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brünger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationNMR Spectroscopy: A Quantum Phenomena
NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)
More informationSupplementary Figure 1.
a b c d e f g 1 Supplementary Figure 1. Identification of unfolded regions in the Chz1-H2A.Z-H2B complex and structure and dynamics of Chz.core-sH2B_H2A.Z. (a) 1 H- 15 N HSQC spectrum of Chz1. All backbone
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationChemical Shift Restraints Tools and Methods. Andrea Cavalli
Chemical Shift Restraints Tools and Methods Andrea Cavalli Overview Methods Overview Methods Details Overview Methods Details Results/Discussion Overview Methods Methods Cheshire base solid-state Methods
More informationInterleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts
202 Bulletin of Magnetic Resonance Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts Brian J. Stockman, Terrence A. Scahill, Annica Euvrard,
More informationA topology-constrained distance network algorithm for protein structure determination from NOESY data
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Robert Powers Publications Published Research - Department of Chemistry February 2006 A topology-constrained distance network
More informationGuided Prediction with Sparse NMR Data
Guided Prediction with Sparse NMR Data Gaetano T. Montelione, Natalia Dennisova, G.V.T. Swapna, and Janet Y. Huang, Rutgers University Antonio Rosato CERM, University of Florance Homay Valafar Univ of
More informationBasics of NMR Spectroscopy. Mark Maciejewski Nov 29, 2016
Basics of NMR Spectroscopy Mark Maciejewski markm@uchc.edu Nov 29, 2016 What is Spectroscopy? Spectroscopy is the study of the interaction of electromagnetic radiation (light) with matter. NMR uses electromagnetic
More informationMacromolecular X-ray Crystallography
Protein Structural Models for CHEM 641 Fall 07 Brian Bahnson Department of Chemistry & Biochemistry University of Delaware Macromolecular X-ray Crystallography Purified Protein X-ray Diffraction Data collection
More informationStructure determination
Structure determination NMR Structural Constraints 1. Internuclear distances (Nuclear Overhauser Effect) NOE R -6 2. Dihedral angles (J-coupling): 3 J NHα = 6.4 cos 2 (Φ -60) 1.4cos(Φ -60) + 1.9 3. C hem
More informationStructure determination through NMR
Structure determination through NMR Protein Sample NMR data acquisition Sequential resonance assignment Collection of conformational constraints 3D structure calculations Structure refinement and Analysis
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationResonance Assignment of the RGS Domain of Human RGS10
Resonance Assignment of the RGS Domain of Human RGS10 Oleg Y. Fedorov 2, Victoria A. Higman 1, Peter Schmieder 1, Martina Leidert 1, Annette Diehl 1, Jonathan Elkins 2, Meera Soundararajan 2, Hartmut Oschkinat
More informationProtein Structure Determination Using NMR Restraints BCMB/CHEM 8190
Protein Structure Determination Using NMR Restraints BCMB/CHEM 8190 Programs for NMR Based Structure Determination CNS - Brunger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros, P.; Grosse-Kunstleve,
More informationSecondary and sidechain structures
Lecture 2 Secondary and sidechain structures James Chou BCMP201 Spring 2008 Images from Petsko & Ringe, Protein Structure and Function. Branden & Tooze, Introduction to Protein Structure. Richardson, J.
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More informationIntroduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions. John Gross, Ph.D.
Introduction to NMR for measuring structure and dynamics + = UCSF Macromolecular Interactions John Gross, Ph.D. Nuclear Spins: Microscopic Bar Magnets H µ S N N + Protein Fragment Magnetic Moment Bar Magnet
More informationSolving the three-dimensional solution structures of larger
Accurate and rapid docking of protein protein complexes on the basis of intermolecular nuclear Overhauser enhancement data and dipolar couplings by rigid body minimization G. Marius Clore* Laboratory of
More informationNMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research
2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th
More informationAlgorithms for analysis of NMR projections: Design, implementation and applications
Thesis for the degree of doctor of Philosophy Algorithms for analysis of NMR projections: Design, implementation and applications Jonas Fredriksson Department of Chemistry University of Gothenburg Sweden
More informationOrigin of Chemical Shifts BCMB/CHEM 8190
Origin of Chemical Shifts BCMB/CHEM 8190 Empirical Properties of Chemical Shift υ i (Hz) = γb 0 (1-σ i ) /2π The Larmor frequencies of nuclei depend on the electronic structure of the molecule and the
More informationTROSY-type Triple-Resonance Experiments for Sequential NMR Assignments of Large Proteins
844 J. Am. Chem. Soc. 999, 2, 844-848 TOSY-type Triple-esonance Experiments for Sequential NM Assignments of Large Proteins Michael Salzmann,, Gerhard Wider, Konstantin Pervushin, Hans Senn, and Kurt Wuthrich*,
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationUsing cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments
Spectroscopy 17 (2003) 161 167 161 IOS Press Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments Michael J. Goger a,, James M. McDonnell
More informationConnecting NMR data to biomolecular structure and dynamics
Connecting NMR data to biomolecular structure and dynamics David A. Case Chem 538, Spring, 2014 Basics of NMR All nuclei are characterized by a spin quantum number I, which can be 0, 1/2, 1, 3/2, 2...
More informationOutline. Introduction to membrane fusion Experimental methods Results Discussion and conclusion
Three-dimensional Structure of the rsly1 N-terminal Domain Reveals a Conformational Change Induced by Binding to Syntaxin 5 Demet Arac, Irina Dulubova, Jimin Pei, Iryna Huryeva, Nick V. Grishin and Josep
More informationStructurele Biologie NMR
MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationEasy, Robust and Accurate NMR Analysis of Biomolecules using BioPack
Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Technical Overview Author George Gray Agilent Technologies Santa Rosa, CA USA Introduction In the last fi fteen years, scientists have
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationPractical Manual. General outline to use the structural information obtained from molecular alignment
Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,
More informationSolution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain,
026 Biochemistry 2003, 42, 026-039 Solution Structure and Backbone Dynamics of the TGFβ Type II Receptor Extracellular Domain, Shashank Deep, Kerfoot P. Walker, III, Zhanyong Shu, and Andrew P. Hinck*,
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationNMR, X-ray Diffraction, Protein Structure, and RasMol
NMR, X-ray Diffraction, Protein Structure, and RasMol Introduction So far we have been mostly concerned with the proteins themselves. The techniques (NMR or X-ray diffraction) used to determine a structure
More informationIntroduction to" Protein Structure
Introduction to" Protein Structure Function, evolution & experimental methods Thomas Blicher, Center for Biological Sequence Analysis Learning Objectives Outline the basic levels of protein structure.
More informationIntroduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research
Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens
More informationEnhanced Chemical Shift Analysis for Secondary Structure prediction of protein
Journal of the Korean Magnetic Resonance Society 2014, 18, 36-40 DOI 10.6564/JKMRS.2014.18.1.036 Enhanced Chemical Shift Analysis for Secondary Structure prediction of protein Won-Je Kim 2ǂ, Jin-Kyu Rhee
More informationSuperposition of chemical shifts in NMR spectra can be overcome to determine automatically the structure of a protein
Spectroscopy 17 (2003) 559 568 559 IOS Press Superposition of chemical shifts in NMR spectra can be overcome to determine automatically the structure of a protein D. Auguin a, V. Catherinot a, T.E. Malliavin
More informationNMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins
Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity
More informationNuclear Magnetic Resonance (NMR)
Nuclear Magnetic Resonance (NMR) E E increases with increasing magnetic field strength Boltzmann distribution at thermal equilibrium: N (m=-1/2) /N (m=+1/2) = e ( E/kT) with E = γ(h/2π)b o NMR Physical
More informationMillisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR. Dmitry M. Korzhnev
Millisecond Time-scale Protein Dynamics by Relaxation Dispersion NMR Dmitry M. Korzhnev Department of Molecular, Microbial and Structural Biology University of Connecticut Health Center 263 Farmington
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationProtein-protein interactions (PPIs) via NMR. Paola Turano
Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction
More information3D Picture of the Syk-Vav1 Protein complex Student Author
3D Picture of the Syk-Vav1 Protein complex Student Author Dan Piraner is a senior majoring in biology (with a specialization in biochemistry) and chemistry. He began his undergraduate research as a freshman
More informationStructural and kinetic characterization of the simplified SH3 domain FP1
Structural and kinetic characterization of the simplified SH3 domain FP1 QIAN YI, 1 PONNI RAJAGOPAL, 1 RACHEL E. KLEVIT, 1 AND DAVID BAKER 1,2 1 Department of Biochemistry and 2 Howard Hughes Medical Institute,
More informationThe wonderful world of NUCLEIC ACID NMR!
Lecture 12 M230 Feigon Sequential resonance assignments in DNA (and RNA): homonuclear method 2 structure determination Reading resources Evans Chap 9 The wonderful world of NUCLEIC ACID NMR! Catalytically
More informationAbout one-third of the genes in living organisms are assumed
Transverse relaxation-optimized NMR spectroscopy with the outer membrane protein OmpX in dihexanoyl phosphatidylcholine micelles César Fernández, Koba Adeishvili*, and Kurt Wüthrich Institut für Molekularbiologie
More informationReceived 29 November 1999; accepted 29 February 2000
Toward Direct Determination of Conformations of Protein Building Units from Multidimensional NMR Experiments I. A Theoretical Case Study of For-Gly-NH 2 and For-L-Ala-NH 2 ANDRÁS PERCZEL, 1 ATTILA G. CSÁSZÁR
More informationParamagnetic Effects BCMB/CHEM
Paramagneti Effets BCMB/CHEM 890 0 Referenes Expanding the utility of NMR restraints with paramagneti ompounds: Bakground and pratial aspets, Koehler J and Meiler J, Prog. NMR Spet. 59: 360-389 0 Paramagneti
More informationNature Structural & Molecular Biology: doi: /nsmb.3194
Supplementary Figure 1 Mass spectrometry and solution NMR data for -syn samples used in this study. (a) Matrix-assisted laser-desorption and ionization time-of-flight (MALDI-TOF) mass spectrum of uniformly-
More informationModel-Free Approach to Internal Motions in Proteins
Model-Free Approach to Internal Motions in Proteins Lipari & Szabo, JACS 104, 4546 (1982) Palmer AG. Ann. Rev. Biophys. Biomol. Struc., 30, 129-155 (2001) Palmer AG, Kroenke CD, Loria JP, Meth. Enzymol.
More informationChristopher Pavlik Bioanalytical Chemistry March 2, 2011
Nuclear Magnetic Resonance of Proteins Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance NMR Application of a magnetic field causes absorption of EM energy that induces
More information