NMR in Structural Biology
|
|
- Dustin Kelley
- 5 years ago
- Views:
Transcription
1 NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three? c. Also indicate whether the information they give determines the secondary or tertiary structure, or both. d. Also indicate their shortcomings/drawbacks. 2. a. List 2 NMR observables that report on dynamics. b. Which NMR parameter is related to the molecular weight and how? 3. Give two parameters that give information about the quality of an NMR structure and explain. c. After having assigned the full HNCACB spectrum of a certain protein, what can you than already tell about the protein structure? 8. Protein X is the second most important protein in the world. It interacts with protein Y, the third most important protein in the world, to form a quite essential protein complex. The two proteins and the complex are way too big to study by NMR, but luckily the interaction is between two smaller protein domains. How would you study this interaction by NMR? 9. a. Where does the abbreviation PRE stand for? b. What do you need to record PREs? c. What is the principle behind the PRE? d. How can it be used to get information about the protein structure? 10. Below are the strips out of a HNCACB experiment for 6 residues out of a hypothetical protein:... EFAGKD... Do the sequential assignment for this stretch and assign all the peaks in these strips 4. Give two types of information that you need besides the experimental data when calculating an NMR structure. 5. a. Why should we take care when using the RMSD to define the precision of an NMR structure? b. Can we use the RMSD to say something about the accuracy of an NMR structure ensemble? 6. What information can you use for predicting the structures of protein-ligand complexes? Give three examples 7. Consider the HNCACB experiment. a. Draw schematically the magnetization transfer for this experiment in the figure below. b. At which coordinates (i.e. frequencies) do you see a peak? 1 2
2 11. a. What information does the spectral density function provide? b. Why does only the R 2 relaxation rate depend on the spectral density function at zero frequency J(0)? c. Why is T1 relaxation more efficient (i.e. short T1) for small proteins (i.e.! c! 5 ns) than for large proteins (i.e.! c! 20 ns)? d. Explain why T2 relaxation depends linear on the correlation time, while this is not the case for T1 relaxation. 14. In the figure you see a solid-state NCO (left) and NCA (right) NMR spectrum of the following peptide sequence. 12. a. Why does conformational exchange broaden the NMR lines? b. How can we reduce the broadening by conformational exchange using a CPMG sequence? 13. a. Give two reasons why solid-state NMR (ssnmr) spectra have very broad lines when you do not apply Magic Angle Spinning (MAS). b. Why do ssnmr spectra have narrow line-widths when applying MAS? c. Why using ssnmr we prefer to observe heteronuclei (e.g. 15 N and 13 C) instead of protons 1 H? d. How can you under MAS enhance the resolution of your spectra? 3 4
3 Answers 1. - chemical shift short secondary only some atoms/angles - NOE intensity short-medium-long secondary-tertiary only distances < 5 Å not very precise (spin diffusion) - J-coupling short secondary only some angles, relation J-angle not unique - residual dipolar coupling short-medium-long secondary-tertiary (RDC) need special medium, protein might not like it. - PRE long tertiary need to mutate residues to attach spin-label, spin-label can be flexible 2. - T1 - linewidth /T2 -> big molecules tumble slow and have short T2 s and large linewidths. Small molecules tumble fast and have long T2 s and small linewidths ramachandran plot statistics - no. of violations (rms. of violations) - no. of atomic bumps - energy / target function value - local geometry 4. - amino acid sequence - geometrical constraints (bond lengths,angles, planarity etc.) - vanderwaals repulsion - electrostatic attraction 5. a. The RMSD could also reflect the lack of (long-range) restraints due to dynamics b. The RMSD gives information about the precision but not the accuracy. You could have calculated a very precise but wrong structure basically any atomic/residue level info - chemical shift perturbation (HSQC titration) - mutagenesis (when you mutate at the interface the interaction is gone) - H/D exchange (residues at interface with the ligand exchange slower) - also RDC s (global shape) c. You will know the H, N, CA and CB chemical shifts of all amino-acids. These chemical shift you can compare to random coil chemical shifts and this will give you information on the secondary structure of your protein. 8. express both domains, label one with 15N/13C, do HSQC titration => chemical shift perturbation, record intermolecular NOEs by isotope filtered exps, do H/D exchange with and without, do RDC w/o, structure calculcation/prediction. 9. PRE: paramagnetic relaxation enhancement. By attachment of a paramagnetic spinlabel (i.e. unpaired electron) to the protein (by site-directed spin-labeleling), the relaxation rates of the nuclei in close proximity to the spinlabel will have enhanced relaxation rates; this effect scales with 1/r 6. Signals will broaden and the intensity will drop. This intensity drop can be measured and used to calculate the distance to the spin-label 10. see next page. 11. a. J(") describes if a certain frequency can induce relaxation and whether it is efficient. b. R2 relaxation is dephasing of the transverse magnetization in the xy plane. No energy transitions are needed and fluctuations parallel to the magnetic field that have no associated frequency in the x/y plane (i.e. " = 0) can thus induce relaxation. c. T1 relaxation depends mainly on the J(" N) which is larger for a small protein than for a large protein. J(") " d. The T2 mainly depends on J(0) that linearly depends on! c. For T1 relaxation exchange of energy is needed so that transitions can take place to get back to Boltzmann equilibrium. Therefore you need fluctuations in the xy-plane of the local magnetic field with frequencies close to the Larmor frequency (i.e. 1/! c ~ " N). Fluctuations with lower or higher frequencies will thus be less efficient to cause relaxation. 7. a. HN -> N -> CA -> CB -> CA -> N -> HN (both to i and i-1) b. (F1, F2, F3) = (CA/CB, N, HN) => Ca-i, N-i, HN-i Cb-i, N-i, HN-i Ca-i-1, N-i, HN-i Cb-i-1, N-i, HN-i 5 6
4 12. a. Due to conformational exchange the chemical shift of a certain nucleus will vary in time. This enhances the dephasing of transverse magnetization and thus increases the R2 relaxation rate. The line-width is proportional to the R2 relaxation rate (line-width ~ R2 ~ 1/T2) so the lines will broaden. b. In a CPMG sequence you apply a train of 180 pulses while the magnetization is in the x/y plane to refocus the chemical shift. If you apply these pulses fast enough (i.e. faster than the exchange rate between the different conformations) you can still refocus (partially) the chemical shift, even if during the CPMG period the chemical shift has changed due to conformational exchange. 13. a. The chemical shift anisotropy (CSA) and the dipolar couplings can be large and cause that the solid-state NMR line-widths are large. b. By spinning fast enough you can average out the anisotropic interactions and obtain narrow line-widths (3-4 times the dipolar coupling). c. The density of protons in a protein is much higher than for heteronuclei, and thus each proton interacts with several other protons. These 1 H- 1 H dipolar couplings are very large and we cannot spin fast enough using MAS to obtain narrow 1 H NMR line-widths. d. By applying efficient decoupling schemes. 7 8
5 14. 9
Introduction solution NMR
2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics
More informationT 1, T 2, NOE (reminder)
T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation
More informationProtein dynamics from NMR Relaxation data
Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationSpin Relaxation and NOEs BCMB/CHEM 8190
Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations
More informationBiophysical Chemistry: NMR Spectroscopy
Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear
More informationTimescales of Protein Dynamics
Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationNMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research
2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationInterpreting and evaluating biological NMR in the literature. Worksheet 1
Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively
More informationSlow symmetric exchange
Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks
More informationTheory and Applications of Residual Dipolar Couplings in Biomolecular NMR
Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationIntroduction to Relaxation Theory James Keeler
EUROMAR Zürich, 24 Introduction to Relaxation Theory James Keeler University of Cambridge Department of Chemistry What is relaxation? Why might it be interesting? relaxation is the process which drives
More informationNMR Spectroscopy: A Quantum Phenomena
NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)
More informationTriple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More informationName: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10
Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use
More informationIntroduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research
Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens
More informationNMR Assay of Purity and Folding
NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze
More informationExperimental Techniques in Protein Structure Determination
Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance
More informationCross Polarization 53 53
Cross Polarization 53 Why don t we normally detect protons in the solid-state BPTI Strong couplings between protons ( >20kHz) Homogeneous interaction Not readily averaged at moderate spinning speeds Rhodopsin
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationNMR-spectroscopy of proteins in solution. Peter Schmieder
NMR-spectroscopy of proteins in solution Basic aspects of NMR-Spektroskopie Basic aspects of NMR-spectroscopy 3/84 Prerequisite for NMR-spectroscopy is a nuclear spin that can be thought of as a mixture
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationSpin Dynamics Basics of Nuclear Magnetic Resonance. Malcolm H. Levitt
Spin Dynamics Basics of Nuclear Magnetic Resonance Second edition Malcolm H. Levitt The University of Southampton, UK John Wiley &. Sons, Ltd Preface xxi Preface to the First Edition xxiii Introduction
More informationLabelling strategies in the NMR structure determination of larger proteins
Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts
More informationMolecular Modeling lecture 2
Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography
More informationStructurele Biologie NMR
MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans
More informationQuantification of Dynamics in the Solid-State
Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid
More informationK ex. Conformational equilibrium. equilibrium K B
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any yprocess in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationNMR-spectroscopy in solution - an introduction. Peter Schmieder
NMR-spectroscopy in solution - an introduction 2/92 Advanced Bioanalytics NMR-Spectroscopy Introductory session (11:00 12:30) Basic aspects of NMR-spectroscopy NMR parameter Multidimensional NMR-spectroscopy
More informationConcepts on protein triple resonance experiments
2005 NMR User Training Course National Program for Genomic Medicine igh-field NMR Core Facility, The Genomic Research Center, Academia Sinica 03/30/2005 Course andout Concepts on protein triple resonance
More informationEffects of Chemical Exchange on NMR Spectra
Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar
More informationIntroduction to biomolecular NMR spectroscopy
Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure
More informationPolarised Nucleon Targets for Europe, 2nd meeting, Bochum 2005
Polarised Nucleon Targets for Europe, nd meeting, Bochum Temperature dependence of nuclear spin-lattice relaxations in liquid ethanol with dissolved TEMPO radicals H. Štěpánková, J. Englich, J. Kohout,
More informationTHE NUCLEAR OVERHAUSER EFFECT IN STRUCTURAL AND CONFORMATIONAL ANALYSIS
THE NUCLEAR OVERHAUSER EFFECT IN STRUCTURAL AND CONFORMATIONAL ANALYSIS David Neuhaus and Michael P. Williamson VCH CONTENTS Preface v Acknowledgments vii Symbols, Abbreviations, and Units xvii Introduction
More informationProtein-protein interactions (PPIs) via NMR. Paola Turano
Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction
More informationNMR BMB 173 Lecture 16, February
NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks
More informationProtein-protein interactions (PPIs) via NMR. Paola Turano
Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction
More informationProtein NMR. Part III. (let s start by reviewing some of the things we have learned already)
Protein NMR Part III (let s start by reviewing some of the things we have learned already) 1. Magnetization Transfer Magnetization transfer through space > NOE Magnetization transfer through bonds > J-coupling
More informationSpectroscopy of Polymers
Spectroscopy of Polymers Jack L. Koenig Case Western Reserve University WOMACS Professional Reference Book American Chemical Society, Washington, DC 1992 Contents Preface m xiii Theory of Polymer Characterization
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationPrinciples of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationPRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS
PRACTICAL ASPECTS OF MR RELAXATIO STUDIES OF BIOMOLECULAR DYAMICS Further reading: Can be downloaded from my web page Korzhnev D.E., Billeter M., Arseniev A.S., and Orekhov V. Y., MR Studies of Brownian
More informationSolid state and advanced NMR
Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationFerdowsi University of Mashhad
Spectroscopy in Inorganic Chemistry Nuclear Magnetic Resonance Spectroscopy spin deuterium 2 helium 3 The neutron has 2 quarks with a -e/3 charge and one quark with a +2e/3 charge resulting in a total
More informationRelaxation, Multi pulse Experiments and 2D NMR
Relaxation, Multi pulse Experiments and 2D NMR To Do s Read Chapter 6 Complete the end of chapter problems; 6 1, 6 2, 6 3, 6 5, 6 9 and 6 10. Read Chapter 15 and do as many problems as you can. Relaxation
More informationMagnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A
Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy
More informationLecture #6 (The NOE)
Lecture #6 (The OE) 2/18/15 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distance
More informationMagnetic Resonance Spectroscopy
INTRODUCTION TO Magnetic Resonance Spectroscopy ESR, NMR, NQR D. N. SATHYANARAYANA Formerly, Chairman Department of Inorganic and Physical Chemistry Indian Institute of Science, Bangalore % I.K. International
More informationLecture #6 (The NOE)
Lecture #6 (The OE) 2/24/17 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distances
More informationFiltered/edited NOESY spectra
Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse
More informationSolid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,
Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will
More informationIt is possible to choose the temperature for each experiment by setting a temperature under the Temp pane (under the Standard panel).
1 2 The study queue gives a lot of flexibility for lining up experiments: they can be run at different temperatures or at different times. You must respect the instrument limits: do not submit experiments
More informationProtein dynamics from nuclear magnetic relaxation
Protein dynamics from nuclear magnetic relaxation Journal: Manuscript ID CS-TRV-11--000832.R1 Article Type: Tutorial Review Date Submitted by the Author: -Feb-16 Complete List of Authors: Charlier, Cyril;
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationCONTENTS. 2 CLASSICAL DESCRIPTION 2.1 The resonance phenomenon 2.2 The vector picture for pulse EPR experiments 2.3 Relaxation and the Bloch equations
CONTENTS Preface Acknowledgements Symbols Abbreviations 1 INTRODUCTION 1.1 Scope of pulse EPR 1.2 A short history of pulse EPR 1.3 Examples of Applications 2 CLASSICAL DESCRIPTION 2.1 The resonance phenomenon
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationHSQC spectra for three proteins
HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein
More informationNMR Relaxation and Molecular Dynamics
Ecole RMN Cargese Mars 2008 NMR Relaxation and Molecular Dynamics Martin Blackledge IBS Grenoble Carine van Heijenoort ICSN, CNRS Gif-sur-Yvette Solution NMR Timescales for Biomolecular Motion ps ns µs
More informationVIII Chemical Exchange
VIII Chemical Exchange Lecture notes by Assaf Tal Chemical exchange has surprising ties with relaxation as we shall see. Understanding exchange lets us understand phenomena, some of which at first glance
More information- Basic understandings: - Mapping interactions:
NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin
More informationSupplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus
Supplemental Information for Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Andrew J. Baldwin 1, Gillian R. Hilton 2, Hadi Lioe 2, Claire
More informationBiophysical Chemistry: NMR Spectroscopy
Spin Dynamics & Vrije Universiteit Brussel 25th November 2011 Outline 1 Pulse/Fourier Transform NMR Thermal Equilibrium Effect of RF Pulses The Fourier Transform 2 Symmetric Exchange Between Two Sites
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationPrincipios Básicos de RMN en sólidos destinado a usuarios. Gustavo Monti. Fa.M.A.F. Universidad Nacional de Córdoba Argentina
Principios Básicos de RMN en sólidos destinado a usuarios Gustavo Monti Fa.M.A.F. Universidad Nacional de Córdoba Argentina CONTENIDOS MODULO 2: Alta resolución en sólidos para espines 1/2 Introducción
More information8.2 The Nuclear Overhauser Effect
8.2 The Nuclear Overhauser Effect Copyright Hans J. Reich 2016 All Rights Reserved University of Wisconsin An important consequence of DD relaxation is the Nuclear Overhauser Effect, which can be used
More informationUNIVERSITY OF CINCINNATI
UNIVERSITY OF CINCINNATI Date: I,, hereby submit this work as part of the requirements for the degree of: in: It is entitled: This work and its defense approved by: Chair: Nuclear Magnetic Resonance Studies
More informationChemical Exchange and Ligand Binding
Chemical Exchange and Ligand Binding NMR time scale Fast exchange for binding constants Slow exchange for tight binding Single vs. multiple binding mode Calcium binding process of calcium binding proteins
More informationChapter 7. Nuclear Magnetic Resonance Spectroscopy
Chapter 7 Nuclear Magnetic Resonance Spectroscopy I. Introduction 1924, W. Pauli proposed that certain atomic nuclei have spin and magnetic moment and exposure to magnetic field would lead to energy level
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationIntroduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations
Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Lecturer: Weiguo Hu 7-1428 weiguoh@polysci.umass.edu October 2009 1 Approximate Description 1: Energy level model Magnetic field
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2
More informationLecture #6 Chemical Exchange
Lecture #6 Chemical Exchange Topics Introduction Effects on longitudinal magnetization Effects on transverse magnetization Examples Handouts and Reading assignments Kowalewski, Chapter 13 Levitt, sections
More informationNMR of large protein systems: Solid state and dynamic nuclear polarization. Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP)
NMR of large protein systems: Solid state and dynamic nuclear polarization Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP) The Aim of the Game solution NMR other methods solid state NMR
More informationPresenter: She Zhang
Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native
More informationLecture #7 In Vivo Water
Lecture #7 In Vivo Water Topics Hydration layers Tissue relaxation times Magic angle effects Magnetization Transfer Contrast (MTC) CEST Handouts and Reading assignments Mathur-De Vre, R., The NMR studies
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationLinear and nonlinear spectroscopy
Linear and nonlinear spectroscopy We ve seen that we can determine molecular frequencies and dephasing rates (for electronic, vibrational, or spin degrees of freedom) from frequency-domain or timedomain
More informationScalar (contact) vs dipolar (pseudocontact) contributions to isotropic shifts.
Scalar (contact) vs dipolar (pseudocontact) contributions to isotropic shifts. Types of paramagnetic species: organic radicals, and complexes of transition metals, lanthanides, and actinides. Simplest
More informationMidterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017
Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017 INSTRUCTIONS: You will have 50 minute to work on this exam. You can use any notes or books that you bring with you to assist you in answering
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More information10.4 Continuous Wave NMR Instrumentation
10.4 Continuous Wave NMR Instrumentation coherent detection bulk magnetization the rotating frame, and effective magnetic field generating a rotating frame, and precession in the laboratory frame spin-lattice
More informationIntroduction to MRI. Spin & Magnetic Moments. Relaxation (T1, T2) Spin Echoes. 2DFT Imaging. K-space & Spatial Resolution.
Introduction to MRI Spin & Magnetic Moments Relaxation (T1, T2) Spin Echoes 2DFT Imaging Selective excitation, phase & frequency encoding K-space & Spatial Resolution Contrast (T1, T2) Acknowledgement:
More informationPolarization transfer
Polarization transfer So far we have dealt vectors (magnetizations) that are proportional to the sensitivit of the nuclei we are studing. In multiple pulse eperiments, were we are doing man things to a
More informationCenter for Sustainable Environmental Technologies, Iowa State University
NMR Characterization of Biochars By Catherine Brewer Center for Sustainable Environmental Technologies, Iowa State University Introduction Nuclear magnetic resonance spectroscopy (NMR) uses a very strong
More informationPrinciples of Nuclear Magnetic Resonance Microscopy
Principles of Nuclear Magnetic Resonance Microscopy Paul T. Callaghan Department of Physics and Biophysics Massey University New Zealand CLARENDON PRESS OXFORD CONTENTS 1 PRINCIPLES OF IMAGING 1 1.1 Introduction
More informationNMR-spectroscopy. I: basics. Peter Schmieder
NMR-spectroscopy I: basics Why spectroscopy? 2/102 Why spectroscopy It is well established that all biological relevant processes take place via interactions of molecules, either small ones (metall ions,
More informationPractical Manual. General outline to use the structural information obtained from molecular alignment
Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,
More informationNMR Spectroscopy. Guangjin Hou
NMR Spectroscopy Guangjin Hou 22-04-2009 NMR History 1 H NMR spectra of water H NMR spectra of water (First NMR Spectra on Water, 1946) 1 H NMR spectra ethanol (First bservation of the Chemical Shift,
More informationJeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07
NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each
More informationDetermining Protein Structure BIBC 100
Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic
More informationMagic-Angle Spinning (MAS) drive bearing
Magic-Angle Spinning (MAS) magic-angle spinning is done pneumatically spinning frequency can be stabilized within a few Hz Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) Maximum spinning
More informationInverse Detection in Multinuclear NMR
Inverse Detection in Multinuclear NMR The HETCOR experiment is an example of a directly-detected heteronuclear experiment. The timing diagram for the most basic form of the HETCOR pulse sequence is shown
More information