NMR in Structural Biology

Size: px
Start display at page:

Download "NMR in Structural Biology"

Transcription

1 NMR in Structural Biology Exercise session 2 1. a. List 3 NMR observables that report on structure. b. Also indicate whether the information they give is short/medium or long-range, or perhaps all three? c. Also indicate whether the information they give determines the secondary or tertiary structure, or both. d. Also indicate their shortcomings/drawbacks. 2. a. List 2 NMR observables that report on dynamics. b. Which NMR parameter is related to the molecular weight and how? 3. Give two parameters that give information about the quality of an NMR structure and explain. c. After having assigned the full HNCACB spectrum of a certain protein, what can you than already tell about the protein structure? 8. Protein X is the second most important protein in the world. It interacts with protein Y, the third most important protein in the world, to form a quite essential protein complex. The two proteins and the complex are way too big to study by NMR, but luckily the interaction is between two smaller protein domains. How would you study this interaction by NMR? 9. a. Where does the abbreviation PRE stand for? b. What do you need to record PREs? c. What is the principle behind the PRE? d. How can it be used to get information about the protein structure? 10. Below are the strips out of a HNCACB experiment for 6 residues out of a hypothetical protein:... EFAGKD... Do the sequential assignment for this stretch and assign all the peaks in these strips 4. Give two types of information that you need besides the experimental data when calculating an NMR structure. 5. a. Why should we take care when using the RMSD to define the precision of an NMR structure? b. Can we use the RMSD to say something about the accuracy of an NMR structure ensemble? 6. What information can you use for predicting the structures of protein-ligand complexes? Give three examples 7. Consider the HNCACB experiment. a. Draw schematically the magnetization transfer for this experiment in the figure below. b. At which coordinates (i.e. frequencies) do you see a peak? 1 2

2 11. a. What information does the spectral density function provide? b. Why does only the R 2 relaxation rate depend on the spectral density function at zero frequency J(0)? c. Why is T1 relaxation more efficient (i.e. short T1) for small proteins (i.e.! c! 5 ns) than for large proteins (i.e.! c! 20 ns)? d. Explain why T2 relaxation depends linear on the correlation time, while this is not the case for T1 relaxation. 14. In the figure you see a solid-state NCO (left) and NCA (right) NMR spectrum of the following peptide sequence. 12. a. Why does conformational exchange broaden the NMR lines? b. How can we reduce the broadening by conformational exchange using a CPMG sequence? 13. a. Give two reasons why solid-state NMR (ssnmr) spectra have very broad lines when you do not apply Magic Angle Spinning (MAS). b. Why do ssnmr spectra have narrow line-widths when applying MAS? c. Why using ssnmr we prefer to observe heteronuclei (e.g. 15 N and 13 C) instead of protons 1 H? d. How can you under MAS enhance the resolution of your spectra? 3 4

3 Answers 1. - chemical shift short secondary only some atoms/angles - NOE intensity short-medium-long secondary-tertiary only distances < 5 Å not very precise (spin diffusion) - J-coupling short secondary only some angles, relation J-angle not unique - residual dipolar coupling short-medium-long secondary-tertiary (RDC) need special medium, protein might not like it. - PRE long tertiary need to mutate residues to attach spin-label, spin-label can be flexible 2. - T1 - linewidth /T2 -> big molecules tumble slow and have short T2 s and large linewidths. Small molecules tumble fast and have long T2 s and small linewidths ramachandran plot statistics - no. of violations (rms. of violations) - no. of atomic bumps - energy / target function value - local geometry 4. - amino acid sequence - geometrical constraints (bond lengths,angles, planarity etc.) - vanderwaals repulsion - electrostatic attraction 5. a. The RMSD could also reflect the lack of (long-range) restraints due to dynamics b. The RMSD gives information about the precision but not the accuracy. You could have calculated a very precise but wrong structure basically any atomic/residue level info - chemical shift perturbation (HSQC titration) - mutagenesis (when you mutate at the interface the interaction is gone) - H/D exchange (residues at interface with the ligand exchange slower) - also RDC s (global shape) c. You will know the H, N, CA and CB chemical shifts of all amino-acids. These chemical shift you can compare to random coil chemical shifts and this will give you information on the secondary structure of your protein. 8. express both domains, label one with 15N/13C, do HSQC titration => chemical shift perturbation, record intermolecular NOEs by isotope filtered exps, do H/D exchange with and without, do RDC w/o, structure calculcation/prediction. 9. PRE: paramagnetic relaxation enhancement. By attachment of a paramagnetic spinlabel (i.e. unpaired electron) to the protein (by site-directed spin-labeleling), the relaxation rates of the nuclei in close proximity to the spinlabel will have enhanced relaxation rates; this effect scales with 1/r 6. Signals will broaden and the intensity will drop. This intensity drop can be measured and used to calculate the distance to the spin-label 10. see next page. 11. a. J(") describes if a certain frequency can induce relaxation and whether it is efficient. b. R2 relaxation is dephasing of the transverse magnetization in the xy plane. No energy transitions are needed and fluctuations parallel to the magnetic field that have no associated frequency in the x/y plane (i.e. " = 0) can thus induce relaxation. c. T1 relaxation depends mainly on the J(" N) which is larger for a small protein than for a large protein. J(") " d. The T2 mainly depends on J(0) that linearly depends on! c. For T1 relaxation exchange of energy is needed so that transitions can take place to get back to Boltzmann equilibrium. Therefore you need fluctuations in the xy-plane of the local magnetic field with frequencies close to the Larmor frequency (i.e. 1/! c ~ " N). Fluctuations with lower or higher frequencies will thus be less efficient to cause relaxation. 7. a. HN -> N -> CA -> CB -> CA -> N -> HN (both to i and i-1) b. (F1, F2, F3) = (CA/CB, N, HN) => Ca-i, N-i, HN-i Cb-i, N-i, HN-i Ca-i-1, N-i, HN-i Cb-i-1, N-i, HN-i 5 6

4 12. a. Due to conformational exchange the chemical shift of a certain nucleus will vary in time. This enhances the dephasing of transverse magnetization and thus increases the R2 relaxation rate. The line-width is proportional to the R2 relaxation rate (line-width ~ R2 ~ 1/T2) so the lines will broaden. b. In a CPMG sequence you apply a train of 180 pulses while the magnetization is in the x/y plane to refocus the chemical shift. If you apply these pulses fast enough (i.e. faster than the exchange rate between the different conformations) you can still refocus (partially) the chemical shift, even if during the CPMG period the chemical shift has changed due to conformational exchange. 13. a. The chemical shift anisotropy (CSA) and the dipolar couplings can be large and cause that the solid-state NMR line-widths are large. b. By spinning fast enough you can average out the anisotropic interactions and obtain narrow line-widths (3-4 times the dipolar coupling). c. The density of protons in a protein is much higher than for heteronuclei, and thus each proton interacts with several other protons. These 1 H- 1 H dipolar couplings are very large and we cannot spin fast enough using MAS to obtain narrow 1 H NMR line-widths. d. By applying efficient decoupling schemes. 7 8

5 14. 9

Introduction solution NMR

Introduction solution NMR 2 NMR journey Introduction solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, IHEP, Beijing April 28 - May 5, 20 3 Topics

More information

T 1, T 2, NOE (reminder)

T 1, T 2, NOE (reminder) T 1, T 2, NOE (reminder) T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations of the system following perturbation

More information

Protein dynamics from NMR Relaxation data

Protein dynamics from NMR Relaxation data Protein dynamics from NMR Relaxation data Clubb 3/15/17 (S f2 ) ( e ) Nitrogen-15 relaxation ZZ-exchange R 1 = 1/T 1 Longitudinal relaxation (decay back to z-axis) R 2 = 1/T 2 Spin-spin relaxation (dephasing

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Spin Relaxation and NOEs BCMB/CHEM 8190

Spin Relaxation and NOEs BCMB/CHEM 8190 Spin Relaxation and NOEs BCMB/CHEM 8190 T 1, T 2 (reminder), NOE T 1 is the time constant for longitudinal relaxation - the process of re-establishing the Boltzmann distribution of the energy level populations

More information

Biophysical Chemistry: NMR Spectroscopy

Biophysical Chemistry: NMR Spectroscopy Relaxation & Multidimensional Spectrocopy Vrije Universiteit Brussel 9th December 2011 Outline 1 Relaxation 2 Principles 3 Outline 1 Relaxation 2 Principles 3 Establishment of Thermal Equilibrium As previously

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Summary of 1D Experiment time domain data Fourier Transform (FT) frequency domain data or Transverse Relaxation Ensemble of Nuclear

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research

NMR journey. Introduction to solution NMR. Alexandre Bonvin. Topics. Why use NMR...? Bijvoet Center for Biomolecular Research 2 NMR journey Introduction to solution NMR Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben EMBO Global Exchange course, CCMB, Hyderabad, India November 29th

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

Slow symmetric exchange

Slow symmetric exchange Slow symmetric exchange ϕ A k k B t A B There are three things you should notice compared with the Figure on the previous slide: 1) The lines are broader, 2) the intensities are reduced and 3) the peaks

More information

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of

More information

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice

More information

Introduction to Relaxation Theory James Keeler

Introduction to Relaxation Theory James Keeler EUROMAR Zürich, 24 Introduction to Relaxation Theory James Keeler University of Cambridge Department of Chemistry What is relaxation? Why might it be interesting? relaxation is the process which drives

More information

NMR Spectroscopy: A Quantum Phenomena

NMR Spectroscopy: A Quantum Phenomena NMR Spectroscopy: A Quantum Phenomena Pascale Legault Département de Biochimie Université de Montréal Outline 1) Energy Diagrams and Vector Diagrams 2) Simple 1D Spectra 3) Beyond Simple 1D Spectra 4)

More information

Triple Resonance Experiments For Proteins

Triple Resonance Experiments For Proteins Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased

More information

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10

Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Name: BCMB/CHEM 8190, BIOMOLECULAR NMR FINAL EXAM-5/5/10 Instructions: This is an open book, limited time, exam. You may use notes you have from class and any text book you find useful. You may also use

More information

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research

Introduction to solution NMR. Alexandre Bonvin. The NMR research group. Bijvoet Center for Biomolecular Research Introduction to solution NMR 1 Alexandre Bonvin Bijvoet Center for Biomolecular Research with thanks to Dr. Klaartje Houben Bente%Vestergaard% The NMR research group Prof. Marc Baldus Prof. Rolf Boelens

More information

NMR Assay of Purity and Folding

NMR Assay of Purity and Folding NMR Assay of Purity and Folding Don t Need Resonance Assignments or Labeling 1D requires only 10-50 µm protein concentration 2D Provides A More Detailed Assay 15 N- 1 H HSQC 1 H COSY 13 C HSQC also! Analyze

More information

Experimental Techniques in Protein Structure Determination

Experimental Techniques in Protein Structure Determination Experimental Techniques in Protein Structure Determination Homayoun Valafar Department of Computer Science and Engineering, USC Two Main Experimental Methods X-Ray crystallography Nuclear Magnetic Resonance

More information

Cross Polarization 53 53

Cross Polarization 53 53 Cross Polarization 53 Why don t we normally detect protons in the solid-state BPTI Strong couplings between protons ( >20kHz) Homogeneous interaction Not readily averaged at moderate spinning speeds Rhodopsin

More information

Effects of Chemical Exchange on NMR Spectra

Effects of Chemical Exchange on NMR Spectra Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

NMR-spectroscopy of proteins in solution. Peter Schmieder

NMR-spectroscopy of proteins in solution. Peter Schmieder NMR-spectroscopy of proteins in solution Basic aspects of NMR-Spektroskopie Basic aspects of NMR-spectroscopy 3/84 Prerequisite for NMR-spectroscopy is a nuclear spin that can be thought of as a mixture

More information

PROTEIN NMR SPECTROSCOPY

PROTEIN NMR SPECTROSCOPY List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear

More information

Spin Dynamics Basics of Nuclear Magnetic Resonance. Malcolm H. Levitt

Spin Dynamics Basics of Nuclear Magnetic Resonance. Malcolm H. Levitt Spin Dynamics Basics of Nuclear Magnetic Resonance Second edition Malcolm H. Levitt The University of Southampton, UK John Wiley &. Sons, Ltd Preface xxi Preface to the First Edition xxiii Introduction

More information

Labelling strategies in the NMR structure determination of larger proteins

Labelling strategies in the NMR structure determination of larger proteins Labelling strategies in the NMR structure determination of larger proteins - Difficulties of studying larger proteins - The effect of deuteration on spectral complexity and relaxation rates - NMR expts

More information

Molecular Modeling lecture 2

Molecular Modeling lecture 2 Molecular Modeling 2018 -- lecture 2 Topics 1. Secondary structure 3. Sequence similarity and homology 2. Secondary structure prediction 4. Where do protein structures come from? X-ray crystallography

More information

Structurele Biologie NMR

Structurele Biologie NMR MR journey Structurele Biologie MR 5 /3C 3 /65 MR & Structural biology course setup lectures - Sprangers R & Kay LE ature (27) basics of MR (Klaartje ouben: k.houben@uu.nl; 4/2) from peaks to data (ans

More information

Quantification of Dynamics in the Solid-State

Quantification of Dynamics in the Solid-State Bernd Reif Quantification of Dynamics in the Solid-State Technische Universität München Helmholtz-Zentrum München Biomolecular Solid-State NMR Winter School Stowe, VT January 0-5, 206 Motivation. Solid

More information

K ex. Conformational equilibrium. equilibrium K B

K ex. Conformational equilibrium. equilibrium K B Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any yprocess in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

NMR-spectroscopy in solution - an introduction. Peter Schmieder

NMR-spectroscopy in solution - an introduction. Peter Schmieder NMR-spectroscopy in solution - an introduction 2/92 Advanced Bioanalytics NMR-Spectroscopy Introductory session (11:00 12:30) Basic aspects of NMR-spectroscopy NMR parameter Multidimensional NMR-spectroscopy

More information

Concepts on protein triple resonance experiments

Concepts on protein triple resonance experiments 2005 NMR User Training Course National Program for Genomic Medicine igh-field NMR Core Facility, The Genomic Research Center, Academia Sinica 03/30/2005 Course andout Concepts on protein triple resonance

More information

Effects of Chemical Exchange on NMR Spectra

Effects of Chemical Exchange on NMR Spectra Effects of Chemical Exchange on NMR Spectra Chemical exchange refers to any process in which a nucleus exchanges between two or more environments in which its NMR parameters (e.g. chemical shift, scalar

More information

Introduction to biomolecular NMR spectroscopy

Introduction to biomolecular NMR spectroscopy Oct 2002 Introduction to biomolecular NMR spectroscopy Michael Sattler, Structural & Computational Biology EMBL Heidelberg Contents Introduction...2 History... 3 Methodological developments for structure

More information

Polarised Nucleon Targets for Europe, 2nd meeting, Bochum 2005

Polarised Nucleon Targets for Europe, 2nd meeting, Bochum 2005 Polarised Nucleon Targets for Europe, nd meeting, Bochum Temperature dependence of nuclear spin-lattice relaxations in liquid ethanol with dissolved TEMPO radicals H. Štěpánková, J. Englich, J. Kohout,

More information

THE NUCLEAR OVERHAUSER EFFECT IN STRUCTURAL AND CONFORMATIONAL ANALYSIS

THE NUCLEAR OVERHAUSER EFFECT IN STRUCTURAL AND CONFORMATIONAL ANALYSIS THE NUCLEAR OVERHAUSER EFFECT IN STRUCTURAL AND CONFORMATIONAL ANALYSIS David Neuhaus and Michael P. Williamson VCH CONTENTS Preface v Acknowledgments vii Symbols, Abbreviations, and Units xvii Introduction

More information

Protein-protein interactions (PPIs) via NMR. Paola Turano

Protein-protein interactions (PPIs) via NMR. Paola Turano Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction

More information

NMR BMB 173 Lecture 16, February

NMR BMB 173 Lecture 16, February NMR The Structural Biology Continuum Today s lecture: NMR Lots of slides adapted from Levitt, Spin Dynamics; Creighton, Proteins; And Andy Rawlinson There are three types of particles in the universe Quarks

More information

Protein-protein interactions (PPIs) via NMR. Paola Turano

Protein-protein interactions (PPIs) via NMR. Paola Turano Protein-protein interactions (PPIs) via NMR Paola Turano turano@cerm.unifi.it The magnetic field at the The chemical shift nucleus (the effective field) is generally less than the applied field by a fraction

More information

Protein NMR. Part III. (let s start by reviewing some of the things we have learned already)

Protein NMR. Part III. (let s start by reviewing some of the things we have learned already) Protein NMR Part III (let s start by reviewing some of the things we have learned already) 1. Magnetization Transfer Magnetization transfer through space > NOE Magnetization transfer through bonds > J-coupling

More information

Spectroscopy of Polymers

Spectroscopy of Polymers Spectroscopy of Polymers Jack L. Koenig Case Western Reserve University WOMACS Professional Reference Book American Chemical Society, Washington, DC 1992 Contents Preface m xiii Theory of Polymer Characterization

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1

More information

PRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS

PRACTICAL ASPECTS OF NMR RELAXATION STUDIES OF BIOMOLECULAR DYNAMICS PRACTICAL ASPECTS OF MR RELAXATIO STUDIES OF BIOMOLECULAR DYAMICS Further reading: Can be downloaded from my web page Korzhnev D.E., Billeter M., Arseniev A.S., and Orekhov V. Y., MR Studies of Brownian

More information

Solid state and advanced NMR

Solid state and advanced NMR Solid state and advanced NMR Dr. Magnus Wolf-Watz Department of Chemistry Umeå University magnus.wolf-watz@chem.umu.se NMR is useful for many things!!! Chemistry Structure of small molecules, chemical

More information

Deuteration: Structural Studies of Larger Proteins

Deuteration: Structural Studies of Larger Proteins Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated

More information

Ferdowsi University of Mashhad

Ferdowsi University of Mashhad Spectroscopy in Inorganic Chemistry Nuclear Magnetic Resonance Spectroscopy spin deuterium 2 helium 3 The neutron has 2 quarks with a -e/3 charge and one quark with a +2e/3 charge resulting in a total

More information

Relaxation, Multi pulse Experiments and 2D NMR

Relaxation, Multi pulse Experiments and 2D NMR Relaxation, Multi pulse Experiments and 2D NMR To Do s Read Chapter 6 Complete the end of chapter problems; 6 1, 6 2, 6 3, 6 5, 6 9 and 6 10. Read Chapter 15 and do as many problems as you can. Relaxation

More information

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A

Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A Magnetic Resonance Lectures for Chem 341 James Aramini, PhD. CABM 014A jma@cabm.rutgers.edu " J.A. 12/11/13 Dec. 4 Dec. 9 Dec. 11" " Outline" " 1. Introduction / Spectroscopy Overview 2. NMR Spectroscopy

More information

Lecture #6 (The NOE)

Lecture #6 (The NOE) Lecture #6 (The OE) 2/18/15 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distance

More information

Magnetic Resonance Spectroscopy

Magnetic Resonance Spectroscopy INTRODUCTION TO Magnetic Resonance Spectroscopy ESR, NMR, NQR D. N. SATHYANARAYANA Formerly, Chairman Department of Inorganic and Physical Chemistry Indian Institute of Science, Bangalore % I.K. International

More information

Lecture #6 (The NOE)

Lecture #6 (The NOE) Lecture #6 (The OE) 2/24/17 Clubb Determining Protein tructures by MR: Measure thousands of shorter inter-hydrogen atom distances. Use these to restrain the structure of protein computationally. Distances

More information

Filtered/edited NOESY spectra

Filtered/edited NOESY spectra Filtered/edited NOESY spectra NMR Seminar HS 207 Nina Ripin 22..7 Overview NMR of biomolecular complexes Problems and Solutions Filtered/edited nomenclature Experimental elements NOESY vs filtered pulse

More information

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum,

Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, Solid-state NMR and proteins : basic concepts (a pictorial introduction) Barth van Rossum, 16.02.2009 Solid-state and solution NMR spectroscopy have many things in common Several concepts have been/will

More information

It is possible to choose the temperature for each experiment by setting a temperature under the Temp pane (under the Standard panel).

It is possible to choose the temperature for each experiment by setting a temperature under the Temp pane (under the Standard panel). 1 2 The study queue gives a lot of flexibility for lining up experiments: they can be run at different temperatures or at different times. You must respect the instrument limits: do not submit experiments

More information

Protein dynamics from nuclear magnetic relaxation

Protein dynamics from nuclear magnetic relaxation Protein dynamics from nuclear magnetic relaxation Journal: Manuscript ID CS-TRV-11--000832.R1 Article Type: Tutorial Review Date Submitted by the Author: -Feb-16 Complete List of Authors: Charlier, Cyril;

More information

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic

More information

CONTENTS. 2 CLASSICAL DESCRIPTION 2.1 The resonance phenomenon 2.2 The vector picture for pulse EPR experiments 2.3 Relaxation and the Bloch equations

CONTENTS. 2 CLASSICAL DESCRIPTION 2.1 The resonance phenomenon 2.2 The vector picture for pulse EPR experiments 2.3 Relaxation and the Bloch equations CONTENTS Preface Acknowledgements Symbols Abbreviations 1 INTRODUCTION 1.1 Scope of pulse EPR 1.2 A short history of pulse EPR 1.3 Examples of Applications 2 CLASSICAL DESCRIPTION 2.1 The resonance phenomenon

More information

1. 3-hour Open book exam. No discussion among yourselves.

1. 3-hour Open book exam. No discussion among yourselves. Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear

More information

Supporting Information

Supporting Information Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

More information

HSQC spectra for three proteins

HSQC spectra for three proteins HSQC spectra for three proteins SH3 domain from Abp1p Kinase domain from EphB2 apo Calmodulin What do the spectra tell you about the three proteins? HSQC spectra for three proteins Small protein Big protein

More information

NMR Relaxation and Molecular Dynamics

NMR Relaxation and Molecular Dynamics Ecole RMN Cargese Mars 2008 NMR Relaxation and Molecular Dynamics Martin Blackledge IBS Grenoble Carine van Heijenoort ICSN, CNRS Gif-sur-Yvette Solution NMR Timescales for Biomolecular Motion ps ns µs

More information

VIII Chemical Exchange

VIII Chemical Exchange VIII Chemical Exchange Lecture notes by Assaf Tal Chemical exchange has surprising ties with relaxation as we shall see. Understanding exchange lets us understand phenomena, some of which at first glance

More information

- Basic understandings: - Mapping interactions:

- Basic understandings: - Mapping interactions: NMR-lecture April 6th, 2009, FMP Berlin Outline: Christian Freund - Basic understandings: Relaxation Chemical exchange - Mapping interactions: -Chemical shift mapping (fast exchange) Linewidth analysis

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/1/eaau413/dc1 Supplementary Materials for Structure and dynamics conspire in the evolution of affinity between intrinsically disordered proteins Per Jemth*, Elin

More information

Supplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus

Supplemental Information for. Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Supplemental Information for Quaternary dynamics of B crystallin as a direct consequence of localised tertiary fluctuations in the C terminus Andrew J. Baldwin 1, Gillian R. Hilton 2, Hadi Lioe 2, Claire

More information

Biophysical Chemistry: NMR Spectroscopy

Biophysical Chemistry: NMR Spectroscopy Spin Dynamics & Vrije Universiteit Brussel 25th November 2011 Outline 1 Pulse/Fourier Transform NMR Thermal Equilibrium Effect of RF Pulses The Fourier Transform 2 Symmetric Exchange Between Two Sites

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Principios Básicos de RMN en sólidos destinado a usuarios. Gustavo Monti. Fa.M.A.F. Universidad Nacional de Córdoba Argentina

Principios Básicos de RMN en sólidos destinado a usuarios. Gustavo Monti. Fa.M.A.F. Universidad Nacional de Córdoba Argentina Principios Básicos de RMN en sólidos destinado a usuarios Gustavo Monti Fa.M.A.F. Universidad Nacional de Córdoba Argentina CONTENIDOS MODULO 2: Alta resolución en sólidos para espines 1/2 Introducción

More information

8.2 The Nuclear Overhauser Effect

8.2 The Nuclear Overhauser Effect 8.2 The Nuclear Overhauser Effect Copyright Hans J. Reich 2016 All Rights Reserved University of Wisconsin An important consequence of DD relaxation is the Nuclear Overhauser Effect, which can be used

More information

UNIVERSITY OF CINCINNATI

UNIVERSITY OF CINCINNATI UNIVERSITY OF CINCINNATI Date: I,, hereby submit this work as part of the requirements for the degree of: in: It is entitled: This work and its defense approved by: Chair: Nuclear Magnetic Resonance Studies

More information

Chemical Exchange and Ligand Binding

Chemical Exchange and Ligand Binding Chemical Exchange and Ligand Binding NMR time scale Fast exchange for binding constants Slow exchange for tight binding Single vs. multiple binding mode Calcium binding process of calcium binding proteins

More information

Chapter 7. Nuclear Magnetic Resonance Spectroscopy

Chapter 7. Nuclear Magnetic Resonance Spectroscopy Chapter 7 Nuclear Magnetic Resonance Spectroscopy I. Introduction 1924, W. Pauli proposed that certain atomic nuclei have spin and magnetic moment and exposure to magnetic field would lead to energy level

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban

More information

Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations

Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Introduction to 1D and 2D NMR Spectroscopy (4) Vector Model and Relaxations Lecturer: Weiguo Hu 7-1428 weiguoh@polysci.umass.edu October 2009 1 Approximate Description 1: Energy level model Magnetic field

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1299 Protein fold determined by paramagnetic magic-angle spinning solid-state NMR spectroscopy Ishita Sengupta 1, Philippe S. Nadaud 1, Jonathan J. Helmus 1, Charles D. Schwieters 2

More information

Lecture #6 Chemical Exchange

Lecture #6 Chemical Exchange Lecture #6 Chemical Exchange Topics Introduction Effects on longitudinal magnetization Effects on transverse magnetization Examples Handouts and Reading assignments Kowalewski, Chapter 13 Levitt, sections

More information

NMR of large protein systems: Solid state and dynamic nuclear polarization. Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP)

NMR of large protein systems: Solid state and dynamic nuclear polarization. Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP) NMR of large protein systems: Solid state and dynamic nuclear polarization Sascha Lange, Leibniz-Institut für Molekulare Pharmakologie (FMP) The Aim of the Game solution NMR other methods solid state NMR

More information

Presenter: She Zhang

Presenter: She Zhang Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native

More information

Lecture #7 In Vivo Water

Lecture #7 In Vivo Water Lecture #7 In Vivo Water Topics Hydration layers Tissue relaxation times Magic angle effects Magnetization Transfer Contrast (MTC) CEST Handouts and Reading assignments Mathur-De Vre, R., The NMR studies

More information

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Linear and nonlinear spectroscopy

Linear and nonlinear spectroscopy Linear and nonlinear spectroscopy We ve seen that we can determine molecular frequencies and dephasing rates (for electronic, vibrational, or spin degrees of freedom) from frequency-domain or timedomain

More information

Scalar (contact) vs dipolar (pseudocontact) contributions to isotropic shifts.

Scalar (contact) vs dipolar (pseudocontact) contributions to isotropic shifts. Scalar (contact) vs dipolar (pseudocontact) contributions to isotropic shifts. Types of paramagnetic species: organic radicals, and complexes of transition metals, lanthanides, and actinides. Simplest

More information

Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017

Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017 Midterm Exam: CHEM/BCMB 8190 (148 points) Friday, 3 March, 2017 INSTRUCTIONS: You will have 50 minute to work on this exam. You can use any notes or books that you bring with you to assist you in answering

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,

More information

10.4 Continuous Wave NMR Instrumentation

10.4 Continuous Wave NMR Instrumentation 10.4 Continuous Wave NMR Instrumentation coherent detection bulk magnetization the rotating frame, and effective magnetic field generating a rotating frame, and precession in the laboratory frame spin-lattice

More information

Introduction to MRI. Spin & Magnetic Moments. Relaxation (T1, T2) Spin Echoes. 2DFT Imaging. K-space & Spatial Resolution.

Introduction to MRI. Spin & Magnetic Moments. Relaxation (T1, T2) Spin Echoes. 2DFT Imaging. K-space & Spatial Resolution. Introduction to MRI Spin & Magnetic Moments Relaxation (T1, T2) Spin Echoes 2DFT Imaging Selective excitation, phase & frequency encoding K-space & Spatial Resolution Contrast (T1, T2) Acknowledgement:

More information

Polarization transfer

Polarization transfer Polarization transfer So far we have dealt vectors (magnetizations) that are proportional to the sensitivit of the nuclei we are studing. In multiple pulse eperiments, were we are doing man things to a

More information

Center for Sustainable Environmental Technologies, Iowa State University

Center for Sustainable Environmental Technologies, Iowa State University NMR Characterization of Biochars By Catherine Brewer Center for Sustainable Environmental Technologies, Iowa State University Introduction Nuclear magnetic resonance spectroscopy (NMR) uses a very strong

More information

Principles of Nuclear Magnetic Resonance Microscopy

Principles of Nuclear Magnetic Resonance Microscopy Principles of Nuclear Magnetic Resonance Microscopy Paul T. Callaghan Department of Physics and Biophysics Massey University New Zealand CLARENDON PRESS OXFORD CONTENTS 1 PRINCIPLES OF IMAGING 1 1.1 Introduction

More information

NMR-spectroscopy. I: basics. Peter Schmieder

NMR-spectroscopy. I: basics. Peter Schmieder NMR-spectroscopy I: basics Why spectroscopy? 2/102 Why spectroscopy It is well established that all biological relevant processes take place via interactions of molecules, either small ones (metall ions,

More information

Practical Manual. General outline to use the structural information obtained from molecular alignment

Practical Manual. General outline to use the structural information obtained from molecular alignment Practical Manual General outline to use the structural information obtained from molecular alignment 1. In order to use the information one needs to know the direction and the size of the tensor (susceptibility,

More information

NMR Spectroscopy. Guangjin Hou

NMR Spectroscopy. Guangjin Hou NMR Spectroscopy Guangjin Hou 22-04-2009 NMR History 1 H NMR spectra of water H NMR spectra of water (First NMR Spectra on Water, 1946) 1 H NMR spectra ethanol (First bservation of the Chemical Shift,

More information

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07 NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each

More information

Determining Protein Structure BIBC 100

Determining Protein Structure BIBC 100 Determining Protein Structure BIBC 100 Determining Protein Structure X-Ray Diffraction Interactions of x-rays with electrons in molecules in a crystal NMR- Nuclear Magnetic Resonance Interactions of magnetic

More information

Magic-Angle Spinning (MAS) drive bearing

Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) magic-angle spinning is done pneumatically spinning frequency can be stabilized within a few Hz Magic-Angle Spinning (MAS) drive bearing Magic-Angle Spinning (MAS) Maximum spinning

More information

Inverse Detection in Multinuclear NMR

Inverse Detection in Multinuclear NMR Inverse Detection in Multinuclear NMR The HETCOR experiment is an example of a directly-detected heteronuclear experiment. The timing diagram for the most basic form of the HETCOR pulse sequence is shown

More information