Resonance Assignment of the RGS Domain of Human RGS10

Size: px
Start display at page:

Download "Resonance Assignment of the RGS Domain of Human RGS10"

Transcription

1 Resonance Assignment of the RGS Domain of Human RGS10 Oleg Y. Fedorov 2, Victoria A. Higman 1, Peter Schmieder 1, Martina Leidert 1, Annette Diehl 1, Jonathan Elkins 2, Meera Soundararajan 2, Hartmut Oschkinat 1 and Linda J. Ball 2 1 Leibniz-Institut für Molekulare Pharmakologie (FMP), Robert-Rössle Str. 10, Berlin. Germany. 2 Structural Genomics Consortium, University of Oxford, Botnar Research Centre, Oxford OX3 7LD. UK. RGS10 is a member of the D/R12 subfamily of Regulators of G-protein Signalling (RGS) proteins and acts as a GTPase-activating protein (GAP) via modulation of Gαi and Gαz signalling but does not interact with the structurally distinct Gαs subunit (Hunt et al., 1996). Unlike other subfamilies of RGS proteins, RGS10 lacks the N-terminal ampipathic helix that localizes these proteins to the membrane. Instead, membrane localization is regulated by palmitoylation of a conserved cysteine within the GTPase-activating RGS domain (Tu et al., 1999). 1 H, 15 N and 13 C resonance assignments of a construct containing the RGS domain from human RGS10 were obtained from 2D and 3D heteronuclear NMR spectra. The backbone assignment was completed with the exception of the first and last two residues and a highly overlapped stretch of five Glu residues ( of our construct). Sidechain assignment was 89% complete including 92 % of observable aromatics. The assignments were deposited with accession code BMRB References: Hunt T. W., et al. (1996) Nature 383: ; Tu Y. P., et al. (1999) J. Biol. Chem. 274: Character Count: 1487 (1500 max.)

2 K102 M59 Q60 N109 S7 Q54 W11 L126 S115 S122 7S I91 V81 E61 Y67 L124 Q78 Q84 R130 K112 K90 E132 Q58 K32 K62 N40 H96 K127 L89 D105 K64 M111 F28 V79 Q106 K74 K6 I107V25 F43 Q3 H128 C47 D114 E94 F36 F25 D49 E30 S14 R27 R118 K10 M53 G83 L19 T8 E35 L9 T69 T131 S85 S76 T57 Q101 L45 M68 E39 E16 F70 S72 K51 A12 L71 N17 L92 K52 V41 K34 S73 L89 D Q104 D21 L18 D123 N80 F L120 L32 A63 K121 E93 E20 R29 F100 Y Y113 S37 I103 M99 E65 F31 D55 W44 L110 A13 R86 F50 L42 I87 S117 G24 15N E23 S4 I66 A46 E38 L15 E82 E48 A9 A75 L5 F K56 W11e W44e H

3 Letter to the Editor: Backbone and Sidechain 1 H, 13 C and 15 N Resonance Assignment of the RGS Domain of Human RGS10 Oleg Y. Fedorov 2, Victoria A. Higman 1, Peter Schmieder 1, Martina Leidert 1, Annette Diehl 1, Jonathan Elkins 2, Meera Soundararajan 2, Hartmut Oschkinat 1 and Linda J. Ball 2. 1 Leibniz-Institut für Molekulare Pharmakologie (F.M.P.), Robert-Roessle Str., 10, D Berlin. Germany. 2 Structural Genomics Consortium (S.G.C), University of Oxford, Botnar Research Centre, Oxford OX3 7LD. UK. Corresponding author: Dr. L. J. Ball Structural Genomics Consortium (S.G.C), University of Oxford, Botnar Research Centre, Oxford OX3 7LD. UK. Tel: ; Fax: linda.ball@sgc.ox.ac.uk Keywords: chemical shift, G-protein signalling, NMR, RGS domain Abbreviations: RGS10: regulator of G-protein signalling; NaPi: sodium phosphate buffer; IPTG: isopropyl-beta-d-thiogalactopyranoside

4 Biological context Regulators of G-protein signalling (RGS) proteins share a conserved ~120 amino acid sequence termed the RGS domain, which is involved in the termination of signals from G- protein coupled receptors (GPCRs). When a GPCR binds a specific ligand, a signal is generated that is transmitted to the G-proteins, which consist of Gα and Gβγ subunits. In the inactive state, these exist in complex with the Gα GTPase in its inactive GDP-bound form. Following activation, GDP is replaced with GTP, which induces dissociation of the Gα-Gβγ complex, releasing active Gα and Gβγ proteins. Although Gα has an intrinsic GTPase activity, this is greatly enhanced by association with an RGS domain. In this way, RGS proteins act as GTPase-activating proteins (GAPs). Following GTP hydrolysis, the resultant GDP-Gα complex can recombine with Gβγ to terminate the signal RGS10 is a member of the D/R12 subfamily of RGS proteins. It acts as a GTPase-activating protein (GAP) via modulation of Gαi and Gαz signalling but does not interact with the structurally and functionally distinct Gαs subunit (Hunt et al., 1996). Activity on Gαz is inhibited by palmitoylation of the G-protein (Tu et al., 1997). Unlike the R4 subfamilies of RGS proteins, RGS10 lacks the N-terminal ampipathic helix that localizes these proteins to the membrane (Bernstein et al., 2000;Chen et al., 1999). Instead, membrane localization of RGS10 is regulated by palmitoylation of a conserved cysteine residue within its RGS domain (Castro-Fernandez et al., 2002;Tu et al., 1999). Methods and experiments Cloning, expression and purification of human RGS10 The RGS domain of human RGS10 (residues Q16-L151 of RGS10_human, (Genbank gi: ; Swissprot O43665) plus two additional N-terminal residues (SM) from the vector was cloned into a homemade vector plic-sgc1, which adds a TEV-cleavable hexahistidine tag to the N-terminus. Uniformly 15 N- and 15 N, 13 C-labelled His-TEV-SM-RGS10 RGS 2

5 domains were prepared from E. coli BL21(DE3)-Rosetta cells (Novagen) containing this plasmid, grown in M9 minimal medium supplemented with 60 µg/ml carbenicillin, 30µg/ml chloramphenicol, and containing 0.5 g/l 15 NH 4 Cl and either 2 g/l (w/v) 12 C 6 -glucose or 13 C 6 - glucose, as the sole nitrogen and carbon sources, respectively. Expression was induced with 1 mm IPTG and cells grown at 22 C overnight. Cells were resuspended in 20 mm Tris HCl ph 8.0, 300 mm NaCl, 5 mm imidazole, 1 mm ß-mercaptoethanol, Complete EDTA-free protease inhibitor cocktail (Roche) and 10 units Benzonase/ml (> 90% pure; Novagene) and broken by French Press. The soluble fraction was applied to an 8 ml MC-Poros column. Fractions containing eluted fusion protein were pooled, dialysed against 20 mm Tris ph 8.0, 300 mm NaCl, 1 mm ß-mercaptoethanol and simultaneously cleaved with TEV-protease at 15 C. Removal of uncleaved protein and free His-tag was carried out by re-running the protein over the MC-Poros column under cleaving conditions. The flow-through containing the RGS domain was concentrated in NMR buffer comprising 20 mm NaPi ph 6.0, 50 mm NaCl and 1 mm ddtt. Typically, 14 mg of RGS domain were purified from 1 L of culture. Protein molecular weights were confirmed by mass spectrometry. NMR spectroscopy NMR spectra were acquired at 297 K, on Bruker DRX 600 and DMX 750 spectrometers in standard configuration with triple resonance probes equipped with self-shielded triple axis gradient coils. Spectra were recorded essentially as described in the original references. A 1.9 mm 15 N-labelled protein sample in 90% H 2 O/10% D 2 O (NMR buffer; ph 6.0), was used for 3D 15 N-separated NOESY-HSQC, 15 N T 1 and 15 N T 2 relaxation, and heteronuclear 15 N- 1 H NOE experiments. A 1 mm 13 C, 15 N-labelled sample in 90% H 2 O/10% D 2 O (NMR buffer; ph 6.0) was used for all H N -detected triple resonance experiments, 3D CBCA(CO)NNH, CBCANNH, CC(CO)NNH, H(CCCO)NNH, HBHA(CBCACO)NNH, HNCO, HN(CA)CO, and for 3D 13 C-separated, aliphatic-centred and aromatic-centred NOESY-HSQC spectra. This sample was freeze-dried and redissolved in 100% D 2 O for acquisition of 3D 13 C- separated HMQC-NOESY, HCCH-COSY, HCCH-TOCSY and 2D NOESY, 2D TOCSY 3

6 spectra. Data were processed using the program XWIN-NMR (version 2.6) of Bruker BioSpin GmbH (Rheinstetten, Germany). Assignment of 13 C, 15 N and 1 H resonances was carried out using standard assignment procedures on a Linux workstation (Intel Dual Xeon 3GHz PC), with the interactive program CCPNMR Analysis version (Vranken et al., 2005). Extent of Assignment and data deposition Figure 1 shows the assigned 15 N HSQC spectrum of the RGS domain from human RGS10. All backbone 1 H, 13 C and 15 N resonances (including carbonyl carbons) were assigned with the exception of the first and last two residues and a sequence segment of five Glu residues (residues ; numbering relative to our construct) where peaks were obscured due to spectral overlap. A high degree of overlap for the Phe sidechains also meant that two Hδ, three Hε and five Hζ resonances could not be assigned unambiguously. The Asn and Gln sidechain NH 2 sidechains were all assigned with the exception of Gln104. Almost all remaining sidechain 13 C and 1 H resonances were assigned, including Trp11 and Trp44 indole Nε1 and Hε1 atoms. No Arg sidechain Nε, Hε atom assignments were possible. The assignments were deposited in the BioMagResBank ( under accession code BMRB Acknowledgements The Structural Genomics Consortium is a registered charity (number ) funded by the Wellcome Trust, GlaxoSmithKline, Genome Canada, the Canadian Institutes of Health Research, the Ontario Innovation Trust, the Ontario Research and Development Challenge Fund and the Canadian Foundation for Innovation. We thank Dr. Peter Schmieder and Dr. Christoph Brockmann for help with the NMR spectroscopy. Figure Legend Figure 1: Assigned 1 H- 15 N-HSQC spectrum of the RGS domain from human RGS10 recorded at 297 K and 750 MHz. 4

7 References Hunt T. W., et al. (1996) Nature 383: Tu Y. P., et al. (1997) Science 278: Bernstein L. S., et al. (2000) Journal of Biological Chemistry 275: Chen C. H., et al. (1999) Journal of Biological Chemistry 274: Castro-Fernandez C., et al. (2002) Endocrinology 143: Tu Y. P., et al. (1999) Journal of Biological Chemistry 274: Vranken W. F., et al. (2005) Proteins: Structure Function and Bioinformatics 59:

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination

Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination 1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1

More information

Protein NMR. Bin Huang

Protein NMR. Bin Huang Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for

More information

Basic principles of multidimensional NMR in solution

Basic principles of multidimensional NMR in solution Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra

More information

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166), Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

More information

Triple Resonance Experiments For Proteins

Triple Resonance Experiments For Proteins Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased

More information

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas

More information

PROTEIN NMR SPECTROSCOPY

PROTEIN NMR SPECTROSCOPY List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling

More information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield

More information

Resonance assignments in proteins. Christina Redfield

Resonance assignments in proteins. Christina Redfield Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function

More information

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad

Protein Structure Determination using NMR Spectroscopy. Cesar Trinidad Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic

More information

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile

More information

Supplementary Information. Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate

Supplementary Information. Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate Supplementary Information Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate the Helical Oligomer Christopher A. Francy 1, 2, 3, Ryan W. Clinton 1, 2, 3, Chris Fröhlich 4, 5, Colleen

More information

Supporting Information. Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets

Supporting Information. Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets Supporting Information Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets Steven L. Swann, Danying Song, Chaohong Sun, Philip J. Hajduk, and Andrew M. Petros Global Pharmaceutical

More information

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR

Chapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain

More information

Supporting Information

Supporting Information Protein-Observed Fluorine NMR is a Complementary Ligand Discovery Method to 1 H CPMG Ligand- Observed NMR. Andrew K. Urick, 1,2 Luis Pablo Calle, 3 Juan F. Espinosa, 3 Haitao Hu, 2 * William C. K. Pomerantz

More information

SUPPORTING INFORMATION. for. Investigations of dynamic amyloid-like structures of the Wnt signalling pathway by solid-state NMR

SUPPORTING INFORMATION. for. Investigations of dynamic amyloid-like structures of the Wnt signalling pathway by solid-state NMR Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 SUPPORTING INFORMATION for Investigations of dynamic amyloid-like structures of the Wnt signalling

More information

Supporting online material

Supporting online material Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins

More information

Supporting Information

Supporting Information Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.

More information

Finding Bonds, H-bonds

Finding Bonds, H-bonds Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify

More information

Supporting Information

Supporting Information Supporting Information Sigala et al. 10.1073/pnas.0900168106 SI Text Discussion of NMR Spectra of Glu46Gln and Tyr42Phe Mutants Glu46Gln. A single downfield peak at 15.2 ppm is observed in the Glu46Gln

More information

Sequential Assignment Strategies in Proteins

Sequential Assignment Strategies in Proteins Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei

More information

Optimum levels of exchangeable protons in perdeuterated proteins for proton detection in MAS solid-state NMR spectroscopy

Optimum levels of exchangeable protons in perdeuterated proteins for proton detection in MAS solid-state NMR spectroscopy J Biomol NMR (2010) 46:67 73 DOI 10.1007/s10858-009-9369-0 PERSPECTIVE Optimum levels of exchangeable protons in perdeuterated proteins for proton detection in MAS solid-state NMR spectroscopy Ümit Akbey

More information

Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr

Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr 188 Bulletin of Magnetic Resonance Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr Chang-Shin Lee and Chin Yu* Department of Chemistry, National Tsing Hua University

More information

Supporting information. Gadolinium tagging for high-precision measurements of 6 nm distances in protein assemblies by EPR

Supporting information. Gadolinium tagging for high-precision measurements of 6 nm distances in protein assemblies by EPR Supporting information Gadolinium tagging for high-precision measurements of 6 nm distances in protein assemblies by EPR Hiromasa Yagi, 1 Debamalya Banerjee, 2 Bim Graham, 3 Thomas Huber, 1 Daniella Goldfarb,

More information

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted

More information

Encarna Pucheta-Martinez+, Nicola D Amelio+, Moreno Lelli, Jorge L. Martinez-Torrecuadrada, Marius Sudol, Giorgio Saladino* and Francesco L.

Encarna Pucheta-Martinez+, Nicola D Amelio+, Moreno Lelli, Jorge L. Martinez-Torrecuadrada, Marius Sudol, Giorgio Saladino* and Francesco L. Supplementary Information for: Changes in the folding landscape of the WW domain provide a molecular mechanism for an inherited genetic syndrome Encarna Pucheta-Martinez+, Nicola D Amelio+, Moreno Lelli,

More information

VOL. 55 NO. 8, AUG THE JOURNAL OF ANTIBIOTICS pp LARISSA VOLLBRECHT, HEINRICH STEINMETZ and GERHARD HOFLE*

VOL. 55 NO. 8, AUG THE JOURNAL OF ANTIBIOTICS pp LARISSA VOLLBRECHT, HEINRICH STEINMETZ and GERHARD HOFLE* VOL. 55 NO. 8, AUG. 2002 THE JOURNAL OF ANTIBIOTICS pp. 715-721 LARISSA VOLLBRECHT, HEINRICH STEINMETZ and GERHARD HOFLE* GBF, Gesellschaft fur Biotechnologische Forschung mbh, Abteilung Naturstoffchemie,

More information

Protein-protein interactions and NMR: G protein/effector complexes

Protein-protein interactions and NMR: G protein/effector complexes Protein-protein interactions and NMR: G protein/effector complexes Helen Mott 5th CCPN Annual Conference, August 2005 Department of Biochemistry University of Cambridge Fast k on,off >> (ν free - ν bound

More information

Supplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release

Supplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release Supplemental Data Structure of the Rb C-Terminal Domain Bound to E2F1-DP1: A Mechanism for Phosphorylation-Induced E2F Release Seth M. Rubin, Anne-Laure Gall, Ning Zheng, and Nikola P. Pavletich Section

More information

Biophysical Journal, Volume 96. Supporting Material

Biophysical Journal, Volume 96. Supporting Material Biophysical Journal, Volume 96 Supporting Material NMR dynamics of PSE-4 β-lactamase: an interplay of ps-ns order and μs-ms motions in the active site Sébastien Morin and Stéphane M. Gagné NMR dynamics

More information

Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei

Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei Supporting Information Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei Said Jebors a, Yannick Tauran a, Nushin Aghajari b, Samira Boudebbouze

More information

Supporting information for. Towards automatic protein backbone assignment using proton-detected 4D solid-state NMR data

Supporting information for. Towards automatic protein backbone assignment using proton-detected 4D solid-state NMR data Supporting information for Towards automatic protein backbone assignment using proton-detected 4D solid-state NMR data Shengqi Xiang 1, Veniamin Chevelkov 1,2, Stefan Becker 1, Adam Lange 1,2,3 * 1 Max

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR

More information

Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts

Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts 202 Bulletin of Magnetic Resonance Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts Brian J. Stockman, Terrence A. Scahill, Annica Euvrard,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION S1 Correcting the helical register in 3 to allow for heme incorporation enables native-like structure in holo-proteins. (A) A database analysis of helical heme binding sites identifies the t73 rotamer

More information

NMR-spectroscopic investigation. of proteins in solution

NMR-spectroscopic investigation. of proteins in solution Practical course Molekulare und zelluläre Signaltransduktion M-spectroscopic investigation of proteins in solution Monika Beerbaum, Peter Schmieder AG M-Spektroskopie Leibniz-Institut für molekulare Pharmakologie

More information

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07

Jeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07 NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each

More information

Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments

Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments Spectroscopy 17 (2003) 161 167 161 IOS Press Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments Michael J. Goger a,, James M. McDonnell

More information

Supporting Information

Supporting Information Supporting Information Boehr et al. 10.1073/pnas.0914163107 SI Text Materials and Methods. R 2 relaxation dispersion experiments. 15 NR 2 relaxation dispersion data measured at 1 H Larmor frequencies of

More information

Mössbauer spectroscopy of the chloroplast-targeted DnaJ-like proteins CDJ3 and CDJ4

Mössbauer spectroscopy of the chloroplast-targeted DnaJ-like proteins CDJ3 and CDJ4 Hyperfine Interact (2017) 238:86 https://doi.org/10.1007/s10751-017-1458-y Mössbauer spectroscopy of the chloroplast-targeted DnaJ-like proteins and H. Auerbach 1 V. Kalienkova 2 M. Schroda 2 V. Schünemann

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information A new chemo-enzymatic route to chiral 2-hydroxy-4-phenylbutyrates by combining lactonase-mediated resolution with hydrogenation over Pd/C Bing Chen, a Hai-Feng Yin,

More information

Heterotrimeric G proteins and the role of lipids in signaling. John Sondek, Ph.D. Depts. of Pharmacology and Biochemistry & Biophyscis

Heterotrimeric G proteins and the role of lipids in signaling. John Sondek, Ph.D. Depts. of Pharmacology and Biochemistry & Biophyscis Heterotrimeric G proteins and the role of lipids in signaling John Sondek, Ph.D. Depts. of Pharmacology and Biochemistry & Biophyscis The GTPase cycle molecular switch A GTPases is NOT a kinase Two major

More information

Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction

Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Name page 1 of 6 Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Part I. The ion Ca 2+ can function as a 2 nd messenger. Pick a specific signal transduction pathway

More information

Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition

Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut

More information

Biochemistry Quiz Review 1I. 1. Of the 20 standard amino acids, only is not optically active. The reason is that its side chain.

Biochemistry Quiz Review 1I. 1. Of the 20 standard amino acids, only is not optically active. The reason is that its side chain. Biochemistry Quiz Review 1I A general note: Short answer questions are just that, short. Writing a paragraph filled with every term you can remember from class won t improve your answer just answer clearly,

More information

Anion recognition in water by a rotaxane containing a secondary rim functionalised cyclodextrin stoppered axle

Anion recognition in water by a rotaxane containing a secondary rim functionalised cyclodextrin stoppered axle Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information: Anion recognition in water by a rotaxane containing a secondary rim

More information

BIRKBECK COLLEGE (University of London)

BIRKBECK COLLEGE (University of London) BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology

More information

proteins Structural origins of ph-dependent chemical shifts in the B1 domain of protein G

proteins Structural origins of ph-dependent chemical shifts in the B1 domain of protein G proteins STRUCTURE O FUNCTION O BIOINFORMATICS Structural origins of ph-dependent chemical shifts in the B1 domain of protein G Jennifer H. Tomlinson, Victoria L. Green, Patrick J. Baker, and Mike P. Williamson*

More information

Production of Recombinant Annexin V from plasmid pet12a-papi

Production of Recombinant Annexin V from plasmid pet12a-papi Tait Research Laboratory Page 1 of 5 Principle Production of Recombinant Annexin V from plasmid pet12a-papi Annexin V is expressed cytoplasmically in BL21(DE3) E. coli (Novagen) with the pet vector system

More information

Thiamine Diphosphate Activation in. 1-deoxy-D-xylulose 5-Phosphate Synthase: Insights. into the Mechanism and Underlying Intermolecular.

Thiamine Diphosphate Activation in. 1-deoxy-D-xylulose 5-Phosphate Synthase: Insights. into the Mechanism and Underlying Intermolecular. Thiamine Diphosphate Activation in 1-deoxy-D-xylulose 5-Phosphate Synthase: Insights into the Mechanism and Underlying Intermolecular Interactions Justin K. White,, Sumit Handa,,, Sai Lakshmana Vankayala,,

More information

EXPERIMENTAL PROCEDURES

EXPERIMENTAL PROCEDURES THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 36, pp. 24372 24383, September 4, 2009 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Ca 2 -dependent

More information

Protein-protein interactions by NMR

Protein-protein interactions by NMR Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off

More information

1. 3-hour Open book exam. No discussion among yourselves.

1. 3-hour Open book exam. No discussion among yourselves. Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear

More information

ml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS

ml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS a UV28 absorption (mau) 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS β 2 AR-Gs complex dissociated complex excess nucleotides b 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex

More information

Supporting Information

Supporting Information Supporting Information Structural Analysis of the Binding of Type I, I 1/2, and II Inhibitors to Eph Tyrosine Kinases Jing Dong, *1 Hongtao Zhao, 1 Ting Zhou, 1 Dimitrios Spiliotopoulos, 1 Chitra Rajendran,

More information

Exam I Answer Key: Summer 2006, Semester C

Exam I Answer Key: Summer 2006, Semester C 1. Which of the following tripeptides would migrate most rapidly towards the negative electrode if electrophoresis is carried out at ph 3.0? a. gly-gly-gly b. glu-glu-asp c. lys-glu-lys d. val-asn-lys

More information

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017

Using NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017 Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:

More information

A novel fluorescent probe for paraquat and cyanide in water based on pillar[5]arene/10-methylacridinium iodide molecular recognition

A novel fluorescent probe for paraquat and cyanide in water based on pillar[5]arene/10-methylacridinium iodide molecular recognition Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A novel fluorescent probe for paraquat and cyanide in water based on pillar[5]arene/10-methylacridinium

More information

BMB/Bi/Ch 173 Winter 2018

BMB/Bi/Ch 173 Winter 2018 BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2017 Supplementary Information Probing the excited-state chemical shifts and exchange

More information

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins

NMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity

More information

Supporting Information

Supporting Information Supporting Information Synthesis of a new class of ribose functionalized dinucleotide cap analogues for biophysical studies on interaction of cap-binding proteins with the 5 end of mrna. Karolina Piecyk,

More information

Supporting Information

Supporting Information Supporting Information Li et al. 10.1073/pnas.1314303110 SI Text Preparation of NMR Samples. Mutagenesis, protein expression, and purification were performed as previously described (1), except that the

More information

Concentration measurements by PULCON using X-filtered or 2D NMR spectra

Concentration measurements by PULCON using X-filtered or 2D NMR spectra MAGNETIC RESONANCE IN CHEMISTRY Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/mrc.1838 Concentration measurements by PULCON using X-filtered or 2D NMR spectra Lars Dreier

More information

Outline. Introduction to membrane fusion Experimental methods Results Discussion and conclusion

Outline. Introduction to membrane fusion Experimental methods Results Discussion and conclusion Three-dimensional Structure of the rsly1 N-terminal Domain Reveals a Conformational Change Induced by Binding to Syntaxin 5 Demet Arac, Irina Dulubova, Jimin Pei, Iryna Huryeva, Nick V. Grishin and Josep

More information

Supporting Information

Supporting Information Supporting Information Arai et al. 10.1073/pnas.15179911 SI Text Protein Expression and Purification. Myb3 (mouse, residues 84 315) was expressed in Escherichia coli as a fusion with the B1 domain of protein

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,

More information

Supporting Information

Supporting Information Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,

More information

Supplemental Methods. Protein expression and purification

Supplemental Methods. Protein expression and purification Supplemental Methods Protein expression and purification The isolated collagen-binding domain of hlair-1, amino acid 22-122, was cloned into pet3xa using introduced BamHI and NotI sites at the 5 and 3

More information

Supplemental data for

Supplemental data for Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan

More information

Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat

Redox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat Redox-Responsive Complexation between a Pillar[5]arene with Mono ethylene oxide Substituents and Paraquat Xiaodong Chi, Min Xue, Yong Yao and Feihe Huang* MOE Key Laboratory of Macromolecular Synthesis

More information

isotope.com Biomolecular NMR

isotope.com Biomolecular NMR Biomolecular NMR tel: +1.978.749.8000 fax: +1.978.749.2768 1.800.322.1174 (North America) cilsales@ 37 Cambridge Isotope Laboratories, Inc. Deuterated Detergents and Phospholipids for Membrane Proteins

More information

Differential Scanning Fluorimetry: Detection of ligands and conditions that promote protein stability and crystallization

Differential Scanning Fluorimetry: Detection of ligands and conditions that promote protein stability and crystallization Differential Scanning Fluorimetry: Detection of ligands and conditions that promote protein stability and crystallization Frank Niesen PX school 2008, Como, Italy Method introduction Topics Applications

More information

Christopher Pavlik Bioanalytical Chemistry March 2, 2011

Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance of Proteins Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance NMR Application of a magnetic field causes absorption of EM energy that induces

More information

Biochemistry 530 NMR Theory and Practice

Biochemistry 530 NMR Theory and Practice Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

BIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total)

BIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) BIMS 503 Exam I September 24, 2007 _ /email: Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) Questions 1-6 refer to this situation: You are able to partially purify an enzyme activity

More information

THE UNIVERSITY OF MANITOBA. PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS

THE UNIVERSITY OF MANITOBA. PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS EXAMINATION: Biochemistry of Proteins EXAMINER: J. O'Neil Section 1: You must answer all of

More information

Basic One- and Two-Dimensional NMR Spectroscopy

Basic One- and Two-Dimensional NMR Spectroscopy Horst Friebolin Basic One- and Two-Dimensional NMR Spectroscopy Third Revised Edition Translated by Jack K. Becconsall WILEY-VCH Weinheim New York Chichester Brisbane Singapore Toronto Contents XV 1 The

More information

Supplementary Information. Synthesis and biological activity of a CXCR4-targeting bis(cyclam) lipid

Supplementary Information. Synthesis and biological activity of a CXCR4-targeting bis(cyclam) lipid Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supplementary Information Synthesis and biological activity of a CXCR4-targeting

More information

Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS

Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp

More information

Electronic Supplemental Information

Electronic Supplemental Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 1 Electronic Supplemental Information Coexisting Order and Disorder Within a Common 40-Residue

More information

Figure S1. Interaction of PcTS with αsyn. (a) 1 H- 15 N HSQC NMR spectra of 100 µm αsyn in the absence (0:1, black) and increasing equivalent

Figure S1. Interaction of PcTS with αsyn. (a) 1 H- 15 N HSQC NMR spectra of 100 µm αsyn in the absence (0:1, black) and increasing equivalent Figure S1. Interaction of PcTS with αsyn. (a) 1 H- 15 N HSQC NMR spectra of 100 µm αsyn in the absence (0:1, black) and increasing equivalent concentrations of PcTS (100 µm, blue; 500 µm, green; 1.5 mm,

More information

Protein Structure Determination from Pseudocontact Shifts Using ROSETTA

Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Supporting Information Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Christophe Schmitz, Robert Vernon, Gottfried Otting, David Baker and Thomas Huber Table S0. Biological Magnetic

More information

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006 Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supplementary Material Rational Design of Aziridine containing Cysteine Protease Inhibitors with improved Potency

More information

Lecture 8 (9/29/17) Lecture 8 (9/29/17)

Lecture 8 (9/29/17) Lecture 8 (9/29/17) Reading: Ch3; 97-102 Lecture 8 (9/29/17) Problems: Ch3 (text); 18, 19, 20, 23 Ch3 (Study guide); 9 Ch4 (Study guide); 3 NEXT Reading: Ch4; 119-122, 125-126, 131-133 Ch4; 123-124, 130-131, 133, 137-138

More information

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington

Biochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:

More information

NMR in Medicine and Biology

NMR in Medicine and Biology NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR

More information

Enantioselective desymmetrisation of citric acid catalysed by the substratetolerant petrobactin biosynthetic enzyme AsbA

Enantioselective desymmetrisation of citric acid catalysed by the substratetolerant petrobactin biosynthetic enzyme AsbA This journal is The Royal Society of Chemistry 9 Supporting information Enantioselective desymmetrisation of citric acid catalysed by the substratetolerant petrobactin biosynthetic enzyme AsbA Daniel Oves-Costales,

More information

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy

I690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice

More information

High-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE

High-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE High-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE Foreword Preface Acknowledgements V VI I X Chapter 1. Introduction 1.1. The development of high-resolution NMR 1 1.2. Modern

More information

Inverse Detection in Multinuclear NMR

Inverse Detection in Multinuclear NMR Inverse Detection in Multinuclear NMR The HETCOR experiment is an example of a directly-detected heteronuclear experiment. The timing diagram for the most basic form of the HETCOR pulse sequence is shown

More information

Deuteration: Structural Studies of Larger Proteins

Deuteration: Structural Studies of Larger Proteins Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated

More information

Amino acid type-selective backbone 1 H- 15 N-correlations for Arg and Lys

Amino acid type-selective backbone 1 H- 15 N-correlations for Arg and Lys Journal of Biomolecular NMR, 20: 379 384, 2001. KLUWER/ESCOM 2001 Kluwer Academic Publishers. Printed in the Netherlands. 379 Amino acid type-selective backbone 1 H- 15 N-correlations for Arg and Lys Mario

More information

A prevalent intraresidue hydrogen bond stabilizes proteins

A prevalent intraresidue hydrogen bond stabilizes proteins Supplementary Information A prevalent intraresidue hydrogen bond stabilizes proteins Robert W. Newberry 1 & Ronald T. Raines 1,2 * 1 Department of Chemistry and 2 Department of Biochemistry, University

More information

Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack

Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Technical Overview Author George Gray Agilent Technologies Santa Rosa, CA USA Introduction In the last fi fteen years, scientists have

More information

THE UNIVERSITY OF MANITOBA. PAPER NO: _1_ LOCATION: 173 Robert Schultz Theatre PAGE NO: 1 of 5 DEPARTMENT & COURSE NO: CHEM / MBIO 2770 TIME: 1 HOUR

THE UNIVERSITY OF MANITOBA. PAPER NO: _1_ LOCATION: 173 Robert Schultz Theatre PAGE NO: 1 of 5 DEPARTMENT & COURSE NO: CHEM / MBIO 2770 TIME: 1 HOUR THE UNIVERSITY OF MANITOBA 1 November 1, 2016 Mid-Term EXAMINATION PAPER NO: _1_ LOCATION: 173 Robert Schultz Theatre PAGE NO: 1 of 5 DEPARTMENT & COURSE NO: CHEM / MBIO 2770 TIME: 1 HOUR EXAMINATION:

More information