Resonance Assignment of the RGS Domain of Human RGS10
|
|
- Jewel Hodge
- 5 years ago
- Views:
Transcription
1 Resonance Assignment of the RGS Domain of Human RGS10 Oleg Y. Fedorov 2, Victoria A. Higman 1, Peter Schmieder 1, Martina Leidert 1, Annette Diehl 1, Jonathan Elkins 2, Meera Soundararajan 2, Hartmut Oschkinat 1 and Linda J. Ball 2 1 Leibniz-Institut für Molekulare Pharmakologie (FMP), Robert-Rössle Str. 10, Berlin. Germany. 2 Structural Genomics Consortium, University of Oxford, Botnar Research Centre, Oxford OX3 7LD. UK. RGS10 is a member of the D/R12 subfamily of Regulators of G-protein Signalling (RGS) proteins and acts as a GTPase-activating protein (GAP) via modulation of Gαi and Gαz signalling but does not interact with the structurally distinct Gαs subunit (Hunt et al., 1996). Unlike other subfamilies of RGS proteins, RGS10 lacks the N-terminal ampipathic helix that localizes these proteins to the membrane. Instead, membrane localization is regulated by palmitoylation of a conserved cysteine within the GTPase-activating RGS domain (Tu et al., 1999). 1 H, 15 N and 13 C resonance assignments of a construct containing the RGS domain from human RGS10 were obtained from 2D and 3D heteronuclear NMR spectra. The backbone assignment was completed with the exception of the first and last two residues and a highly overlapped stretch of five Glu residues ( of our construct). Sidechain assignment was 89% complete including 92 % of observable aromatics. The assignments were deposited with accession code BMRB References: Hunt T. W., et al. (1996) Nature 383: ; Tu Y. P., et al. (1999) J. Biol. Chem. 274: Character Count: 1487 (1500 max.)
2 K102 M59 Q60 N109 S7 Q54 W11 L126 S115 S122 7S I91 V81 E61 Y67 L124 Q78 Q84 R130 K112 K90 E132 Q58 K32 K62 N40 H96 K127 L89 D105 K64 M111 F28 V79 Q106 K74 K6 I107V25 F43 Q3 H128 C47 D114 E94 F36 F25 D49 E30 S14 R27 R118 K10 M53 G83 L19 T8 E35 L9 T69 T131 S85 S76 T57 Q101 L45 M68 E39 E16 F70 S72 K51 A12 L71 N17 L92 K52 V41 K34 S73 L89 D Q104 D21 L18 D123 N80 F L120 L32 A63 K121 E93 E20 R29 F100 Y Y113 S37 I103 M99 E65 F31 D55 W44 L110 A13 R86 F50 L42 I87 S117 G24 15N E23 S4 I66 A46 E38 L15 E82 E48 A9 A75 L5 F K56 W11e W44e H
3 Letter to the Editor: Backbone and Sidechain 1 H, 13 C and 15 N Resonance Assignment of the RGS Domain of Human RGS10 Oleg Y. Fedorov 2, Victoria A. Higman 1, Peter Schmieder 1, Martina Leidert 1, Annette Diehl 1, Jonathan Elkins 2, Meera Soundararajan 2, Hartmut Oschkinat 1 and Linda J. Ball 2. 1 Leibniz-Institut für Molekulare Pharmakologie (F.M.P.), Robert-Roessle Str., 10, D Berlin. Germany. 2 Structural Genomics Consortium (S.G.C), University of Oxford, Botnar Research Centre, Oxford OX3 7LD. UK. Corresponding author: Dr. L. J. Ball Structural Genomics Consortium (S.G.C), University of Oxford, Botnar Research Centre, Oxford OX3 7LD. UK. Tel: ; Fax: linda.ball@sgc.ox.ac.uk Keywords: chemical shift, G-protein signalling, NMR, RGS domain Abbreviations: RGS10: regulator of G-protein signalling; NaPi: sodium phosphate buffer; IPTG: isopropyl-beta-d-thiogalactopyranoside
4 Biological context Regulators of G-protein signalling (RGS) proteins share a conserved ~120 amino acid sequence termed the RGS domain, which is involved in the termination of signals from G- protein coupled receptors (GPCRs). When a GPCR binds a specific ligand, a signal is generated that is transmitted to the G-proteins, which consist of Gα and Gβγ subunits. In the inactive state, these exist in complex with the Gα GTPase in its inactive GDP-bound form. Following activation, GDP is replaced with GTP, which induces dissociation of the Gα-Gβγ complex, releasing active Gα and Gβγ proteins. Although Gα has an intrinsic GTPase activity, this is greatly enhanced by association with an RGS domain. In this way, RGS proteins act as GTPase-activating proteins (GAPs). Following GTP hydrolysis, the resultant GDP-Gα complex can recombine with Gβγ to terminate the signal RGS10 is a member of the D/R12 subfamily of RGS proteins. It acts as a GTPase-activating protein (GAP) via modulation of Gαi and Gαz signalling but does not interact with the structurally and functionally distinct Gαs subunit (Hunt et al., 1996). Activity on Gαz is inhibited by palmitoylation of the G-protein (Tu et al., 1997). Unlike the R4 subfamilies of RGS proteins, RGS10 lacks the N-terminal ampipathic helix that localizes these proteins to the membrane (Bernstein et al., 2000;Chen et al., 1999). Instead, membrane localization of RGS10 is regulated by palmitoylation of a conserved cysteine residue within its RGS domain (Castro-Fernandez et al., 2002;Tu et al., 1999). Methods and experiments Cloning, expression and purification of human RGS10 The RGS domain of human RGS10 (residues Q16-L151 of RGS10_human, (Genbank gi: ; Swissprot O43665) plus two additional N-terminal residues (SM) from the vector was cloned into a homemade vector plic-sgc1, which adds a TEV-cleavable hexahistidine tag to the N-terminus. Uniformly 15 N- and 15 N, 13 C-labelled His-TEV-SM-RGS10 RGS 2
5 domains were prepared from E. coli BL21(DE3)-Rosetta cells (Novagen) containing this plasmid, grown in M9 minimal medium supplemented with 60 µg/ml carbenicillin, 30µg/ml chloramphenicol, and containing 0.5 g/l 15 NH 4 Cl and either 2 g/l (w/v) 12 C 6 -glucose or 13 C 6 - glucose, as the sole nitrogen and carbon sources, respectively. Expression was induced with 1 mm IPTG and cells grown at 22 C overnight. Cells were resuspended in 20 mm Tris HCl ph 8.0, 300 mm NaCl, 5 mm imidazole, 1 mm ß-mercaptoethanol, Complete EDTA-free protease inhibitor cocktail (Roche) and 10 units Benzonase/ml (> 90% pure; Novagene) and broken by French Press. The soluble fraction was applied to an 8 ml MC-Poros column. Fractions containing eluted fusion protein were pooled, dialysed against 20 mm Tris ph 8.0, 300 mm NaCl, 1 mm ß-mercaptoethanol and simultaneously cleaved with TEV-protease at 15 C. Removal of uncleaved protein and free His-tag was carried out by re-running the protein over the MC-Poros column under cleaving conditions. The flow-through containing the RGS domain was concentrated in NMR buffer comprising 20 mm NaPi ph 6.0, 50 mm NaCl and 1 mm ddtt. Typically, 14 mg of RGS domain were purified from 1 L of culture. Protein molecular weights were confirmed by mass spectrometry. NMR spectroscopy NMR spectra were acquired at 297 K, on Bruker DRX 600 and DMX 750 spectrometers in standard configuration with triple resonance probes equipped with self-shielded triple axis gradient coils. Spectra were recorded essentially as described in the original references. A 1.9 mm 15 N-labelled protein sample in 90% H 2 O/10% D 2 O (NMR buffer; ph 6.0), was used for 3D 15 N-separated NOESY-HSQC, 15 N T 1 and 15 N T 2 relaxation, and heteronuclear 15 N- 1 H NOE experiments. A 1 mm 13 C, 15 N-labelled sample in 90% H 2 O/10% D 2 O (NMR buffer; ph 6.0) was used for all H N -detected triple resonance experiments, 3D CBCA(CO)NNH, CBCANNH, CC(CO)NNH, H(CCCO)NNH, HBHA(CBCACO)NNH, HNCO, HN(CA)CO, and for 3D 13 C-separated, aliphatic-centred and aromatic-centred NOESY-HSQC spectra. This sample was freeze-dried and redissolved in 100% D 2 O for acquisition of 3D 13 C- separated HMQC-NOESY, HCCH-COSY, HCCH-TOCSY and 2D NOESY, 2D TOCSY 3
6 spectra. Data were processed using the program XWIN-NMR (version 2.6) of Bruker BioSpin GmbH (Rheinstetten, Germany). Assignment of 13 C, 15 N and 1 H resonances was carried out using standard assignment procedures on a Linux workstation (Intel Dual Xeon 3GHz PC), with the interactive program CCPNMR Analysis version (Vranken et al., 2005). Extent of Assignment and data deposition Figure 1 shows the assigned 15 N HSQC spectrum of the RGS domain from human RGS10. All backbone 1 H, 13 C and 15 N resonances (including carbonyl carbons) were assigned with the exception of the first and last two residues and a sequence segment of five Glu residues (residues ; numbering relative to our construct) where peaks were obscured due to spectral overlap. A high degree of overlap for the Phe sidechains also meant that two Hδ, three Hε and five Hζ resonances could not be assigned unambiguously. The Asn and Gln sidechain NH 2 sidechains were all assigned with the exception of Gln104. Almost all remaining sidechain 13 C and 1 H resonances were assigned, including Trp11 and Trp44 indole Nε1 and Hε1 atoms. No Arg sidechain Nε, Hε atom assignments were possible. The assignments were deposited in the BioMagResBank ( under accession code BMRB Acknowledgements The Structural Genomics Consortium is a registered charity (number ) funded by the Wellcome Trust, GlaxoSmithKline, Genome Canada, the Canadian Institutes of Health Research, the Ontario Innovation Trust, the Ontario Research and Development Challenge Fund and the Canadian Foundation for Innovation. We thank Dr. Peter Schmieder and Dr. Christoph Brockmann for help with the NMR spectroscopy. Figure Legend Figure 1: Assigned 1 H- 15 N-HSQC spectrum of the RGS domain from human RGS10 recorded at 297 K and 750 MHz. 4
7 References Hunt T. W., et al. (1996) Nature 383: Tu Y. P., et al. (1997) Science 278: Bernstein L. S., et al. (2000) Journal of Biological Chemistry 275: Chen C. H., et al. (1999) Journal of Biological Chemistry 274: Castro-Fernandez C., et al. (2002) Endocrinology 143: Tu Y. P., et al. (1999) Journal of Biological Chemistry 274: Vranken W. F., et al. (2005) Proteins: Structure Function and Bioinformatics 59:
Principles of NMR Protein Spectroscopy. 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination
1) Protein preparation (>50 aa) 2) Assignment of chemical shifts in a protein ( 1 H, 13 C, 15 N) 3) Three dimensional structure determination Protein Expression overexpression in E. coli - BL21(DE3) 1
More informationProtein NMR. Bin Huang
Protein NMR Bin Huang Introduction NMR and X-ray crystallography are the only two techniques for obtain three-dimentional structure information of protein in atomic level. NMR is the only technique for
More informationBasic principles of multidimensional NMR in solution
Basic principles of multidimensional NMR in solution 19.03.2008 The program 2/93 General aspects Basic principles Parameters in NMR spectroscopy Multidimensional NMR-spectroscopy Protein structures NMR-spectra
More informationFull-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
Supplementary Methods Protein expression and purification Full-length GlpG sequence was generated by PCR from E. coli genomic DNA (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),
More informationTriple Resonance Experiments For Proteins
Triple Resonance Experiments For Proteins Limitations of homonuclear ( 1 H) experiments for proteins -the utility of homonuclear methods drops quickly with mass (~10 kda) -severe spectral degeneracy -decreased
More informationSensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets
Supporting information Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets Wan-Na Chen, Christoph Nitsche, Kala Bharath Pilla, Bim Graham, Thomas
More informationPROTEIN NMR SPECTROSCOPY
List of Figures List of Tables xvii xxvi 1. NMR SPECTROSCOPY 1 1.1 Introduction to NMR Spectroscopy 2 1.2 One Dimensional NMR Spectroscopy 3 1.2.1 Classical Description of NMR Spectroscopy 3 1.2.2 Nuclear
More informationActa Crystallographica Section D
Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural basis of the heterodimerization of the MST and RASSF SARAH domains in the Hippo signalling
More informationSequential resonance assignments in (small) proteins: homonuclear method 2º structure determination
Lecture 9 M230 Feigon Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination Reading resources v Roberts NMR of Macromolecules, Chap 4 by Christina Redfield
More informationResonance assignments in proteins. Christina Redfield
Resonance assignments in proteins Christina Redfield 1. Introduction The assignment of resonances in the complex NMR spectrum of a protein is the first step in any study of protein structure, function
More informationProtein Structure Determination using NMR Spectroscopy. Cesar Trinidad
Protein Structure Determination using NMR Spectroscopy Cesar Trinidad Introduction Protein NMR Involves the analysis and calculation of data collected from multiple NMR techniques Utilizes Nuclear Magnetic
More informationNMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2009 NMR study of complexes between low molecular mass inhibitors and the West Nile
More informationSupplementary Information. Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate
Supplementary Information Cryo-EM Studies of Drp1 Reveal Cardiolipin Interactions that Activate the Helical Oligomer Christopher A. Francy 1, 2, 3, Ryan W. Clinton 1, 2, 3, Chris Fröhlich 4, 5, Colleen
More informationSupporting Information. Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets
Supporting Information Labeled Ligand Displacement: Extending NMR-based Screening of Protein Targets Steven L. Swann, Danying Song, Chaohong Sun, Philip J. Hajduk, and Andrew M. Petros Global Pharmaceutical
More informationChapter 6. The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR
The interaction of Src SH2 with the focal adhesion kinase catalytic domain studied by NMR 103 Abstract The interaction of the Src SH2 domain with the catalytic domain of FAK, including the Y397 SH2 domain
More informationSupporting Information
Protein-Observed Fluorine NMR is a Complementary Ligand Discovery Method to 1 H CPMG Ligand- Observed NMR. Andrew K. Urick, 1,2 Luis Pablo Calle, 3 Juan F. Espinosa, 3 Haitao Hu, 2 * William C. K. Pomerantz
More informationSUPPORTING INFORMATION. for. Investigations of dynamic amyloid-like structures of the Wnt signalling pathway by solid-state NMR
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 SUPPORTING INFORMATION for Investigations of dynamic amyloid-like structures of the Wnt signalling
More informationSupporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
More informationSupporting Information
Supporting Information Ellena et al. 10.1073/pnas.0908317106 SI Experimental Procedures Protein Expression and Sample Preparation. Syb(1 96) and Syb(1 116) from Rattus norvegicus were expressed in BL21(DE3)
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 Helical Hairpin Structure of a potent Antimicrobial Peptide MSI-594 in Lipopolysaccharide Micelles by NMR Anirban
More informationSUPPLEMENTARY INFORMATION
5 N 4 8 20 22 24 2 28 4 8 20 22 24 2 28 a b 0 9 8 7 H c (kda) 95 0 57 4 28 2 5.5 Precipitate before NMR expt. Supernatant before NMR expt. Precipitate after hrs NMR expt. Supernatant after hrs NMR expt.
More informationFinding Bonds, H-bonds
Finding Bonds, H-bonds A hydrogen bond (HB) allows chunks of peptide relatively far away from each other to come close together. They are all over the place in globular proteins, so if we could identify
More informationSupporting Information
Supporting Information Sigala et al. 10.1073/pnas.0900168106 SI Text Discussion of NMR Spectra of Glu46Gln and Tyr42Phe Mutants Glu46Gln. A single downfield peak at 15.2 ppm is observed in the Glu46Gln
More informationSequential Assignment Strategies in Proteins
Sequential Assignment Strategies in Proteins NMR assignments in order to determine a structure by traditional, NOE-based 1 H- 1 H distance-based methods, the chemical shifts of the individual 1 H nuclei
More informationOptimum levels of exchangeable protons in perdeuterated proteins for proton detection in MAS solid-state NMR spectroscopy
J Biomol NMR (2010) 46:67 73 DOI 10.1007/s10858-009-9369-0 PERSPECTIVE Optimum levels of exchangeable protons in perdeuterated proteins for proton detection in MAS solid-state NMR spectroscopy Ümit Akbey
More informationIdentification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr
188 Bulletin of Magnetic Resonance Identification of Two Antiparallel-sheet Structure of Cobrotoxin in Aqueous Solution by'hnmr Chang-Shin Lee and Chin Yu* Department of Chemistry, National Tsing Hua University
More informationSupporting information. Gadolinium tagging for high-precision measurements of 6 nm distances in protein assemblies by EPR
Supporting information Gadolinium tagging for high-precision measurements of 6 nm distances in protein assemblies by EPR Hiromasa Yagi, 1 Debamalya Banerjee, 2 Bim Graham, 3 Thomas Huber, 1 Daniella Goldfarb,
More informationSecondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure
Bioch/BIMS 503 Lecture 2 Structure and Function of Proteins August 28, 2008 Robert Nakamoto rkn3c@virginia.edu 2-0279 Secondary Structure Φ Ψ angles determine protein structure Φ Ψ angles are restricted
More informationEncarna Pucheta-Martinez+, Nicola D Amelio+, Moreno Lelli, Jorge L. Martinez-Torrecuadrada, Marius Sudol, Giorgio Saladino* and Francesco L.
Supplementary Information for: Changes in the folding landscape of the WW domain provide a molecular mechanism for an inherited genetic syndrome Encarna Pucheta-Martinez+, Nicola D Amelio+, Moreno Lelli,
More informationVOL. 55 NO. 8, AUG THE JOURNAL OF ANTIBIOTICS pp LARISSA VOLLBRECHT, HEINRICH STEINMETZ and GERHARD HOFLE*
VOL. 55 NO. 8, AUG. 2002 THE JOURNAL OF ANTIBIOTICS pp. 715-721 LARISSA VOLLBRECHT, HEINRICH STEINMETZ and GERHARD HOFLE* GBF, Gesellschaft fur Biotechnologische Forschung mbh, Abteilung Naturstoffchemie,
More informationProtein-protein interactions and NMR: G protein/effector complexes
Protein-protein interactions and NMR: G protein/effector complexes Helen Mott 5th CCPN Annual Conference, August 2005 Department of Biochemistry University of Cambridge Fast k on,off >> (ν free - ν bound
More informationSupplemental Data. Structure of the Rb C-Terminal Domain. Bound to E2F1-DP1: A Mechanism. for Phosphorylation-Induced E2F Release
Supplemental Data Structure of the Rb C-Terminal Domain Bound to E2F1-DP1: A Mechanism for Phosphorylation-Induced E2F Release Seth M. Rubin, Anne-Laure Gall, Ning Zheng, and Nikola P. Pavletich Section
More informationBiophysical Journal, Volume 96. Supporting Material
Biophysical Journal, Volume 96 Supporting Material NMR dynamics of PSE-4 β-lactamase: an interplay of ps-ns order and μs-ms motions in the active site Sébastien Morin and Stéphane M. Gagné NMR dynamics
More informationSupramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei
Supporting Information Supramolecular stabilization of the acid tolerant L-arabinose isomerase from the food-grade Lactobacillus sakei Said Jebors a, Yannick Tauran a, Nushin Aghajari b, Samira Boudebbouze
More informationSupporting information for. Towards automatic protein backbone assignment using proton-detected 4D solid-state NMR data
Supporting information for Towards automatic protein backbone assignment using proton-detected 4D solid-state NMR data Shengqi Xiang 1, Veniamin Chevelkov 1,2, Stefan Becker 1, Adam Lange 1,2,3 * 1 Max
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4-5pm and SFL 229, Monday 3/5 4-5:30pm. 1. NMR
More informationInterleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts
202 Bulletin of Magnetic Resonance Interleukin-1 Receptor Antagonist Protein: Solution Secondary Structure from NOE's and 1H«and 13C«Chemical Shifts Brian J. Stockman, Terrence A. Scahill, Annica Euvrard,
More informationSUPPLEMENTARY INFORMATION
S1 Correcting the helical register in 3 to allow for heme incorporation enables native-like structure in holo-proteins. (A) A database analysis of helical heme binding sites identifies the t73 rotamer
More informationNMR-spectroscopic investigation. of proteins in solution
Practical course Molekulare und zelluläre Signaltransduktion M-spectroscopic investigation of proteins in solution Monika Beerbaum, Peter Schmieder AG M-Spektroskopie Leibniz-Institut für molekulare Pharmakologie
More informationJeff Grinstead SB 2006/2007. NMR Spectroscopy. NMR Spectroscopy JG/1 07
NMR Spectroscopy Jeff Grinstead NMR Spectroscopy NMR for structural biology Challenges for determining protein structures using NMR Proteins have thousands of signals Assign the specific signal for each
More informationUsing cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments
Spectroscopy 17 (2003) 161 167 161 IOS Press Using cryoprobes to decrease acquisition times of triple-resonance experiments used for protein resonance assignments Michael J. Goger a,, James M. McDonnell
More informationSupporting Information
Supporting Information Boehr et al. 10.1073/pnas.0914163107 SI Text Materials and Methods. R 2 relaxation dispersion experiments. 15 NR 2 relaxation dispersion data measured at 1 H Larmor frequencies of
More informationMössbauer spectroscopy of the chloroplast-targeted DnaJ-like proteins CDJ3 and CDJ4
Hyperfine Interact (2017) 238:86 https://doi.org/10.1007/s10751-017-1458-y Mössbauer spectroscopy of the chloroplast-targeted DnaJ-like proteins and H. Auerbach 1 V. Kalienkova 2 M. Schroda 2 V. Schünemann
More informationElectronic Supplementary Information
Electronic Supplementary Information A new chemo-enzymatic route to chiral 2-hydroxy-4-phenylbutyrates by combining lactonase-mediated resolution with hydrogenation over Pd/C Bing Chen, a Hai-Feng Yin,
More informationHeterotrimeric G proteins and the role of lipids in signaling. John Sondek, Ph.D. Depts. of Pharmacology and Biochemistry & Biophyscis
Heterotrimeric G proteins and the role of lipids in signaling John Sondek, Ph.D. Depts. of Pharmacology and Biochemistry & Biophyscis The GTPase cycle molecular switch A GTPases is NOT a kinase Two major
More informationBahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction
Name page 1 of 6 Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Part I. The ion Ca 2+ can function as a 2 nd messenger. Pick a specific signal transduction pathway
More informationSerine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition
Supplementary Information to Serine-7 but not serine-5 phosphorylation primes RNA polymerase II CTD for P-TEFb recognition Nadine Czudnochowski 1,2, *, Christian A. Bösken 1, * & Matthias Geyer 1 1 Max-Planck-Institut
More informationBiochemistry Quiz Review 1I. 1. Of the 20 standard amino acids, only is not optically active. The reason is that its side chain.
Biochemistry Quiz Review 1I A general note: Short answer questions are just that, short. Writing a paragraph filled with every term you can remember from class won t improve your answer just answer clearly,
More informationAnion recognition in water by a rotaxane containing a secondary rim functionalised cyclodextrin stoppered axle
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information: Anion recognition in water by a rotaxane containing a secondary rim
More informationBIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
More informationproteins Structural origins of ph-dependent chemical shifts in the B1 domain of protein G
proteins STRUCTURE O FUNCTION O BIOINFORMATICS Structural origins of ph-dependent chemical shifts in the B1 domain of protein G Jennifer H. Tomlinson, Victoria L. Green, Patrick J. Baker, and Mike P. Williamson*
More informationProduction of Recombinant Annexin V from plasmid pet12a-papi
Tait Research Laboratory Page 1 of 5 Principle Production of Recombinant Annexin V from plasmid pet12a-papi Annexin V is expressed cytoplasmically in BL21(DE3) E. coli (Novagen) with the pet vector system
More informationThiamine Diphosphate Activation in. 1-deoxy-D-xylulose 5-Phosphate Synthase: Insights. into the Mechanism and Underlying Intermolecular.
Thiamine Diphosphate Activation in 1-deoxy-D-xylulose 5-Phosphate Synthase: Insights into the Mechanism and Underlying Intermolecular Interactions Justin K. White,, Sumit Handa,,, Sai Lakshmana Vankayala,,
More informationEXPERIMENTAL PROCEDURES
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 36, pp. 24372 24383, September 4, 2009 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Ca 2 -dependent
More informationProtein-protein interactions by NMR
Protein-protein interactions by NMR Fast k on,off >> (ν free - ν bound ) A + B k on k off AB k on,off ~ (ν free - ν bound ) Slow k on,off
More information1. 3-hour Open book exam. No discussion among yourselves.
Lecture 13 Review 1. 3-hour Open book exam. No discussion among yourselves. 2. Simple calculations. 3. Terminologies. 4. Decriptive questions. 5. Analyze a pulse program using density matrix approach (omonuclear
More informationml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS
a UV28 absorption (mau) 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS β 2 AR-Gs complex dissociated complex excess nucleotides b 9 8 7 5 3 β 2 AR-Gs complex β 2 AR-Gs complex
More informationSupporting Information
Supporting Information Structural Analysis of the Binding of Type I, I 1/2, and II Inhibitors to Eph Tyrosine Kinases Jing Dong, *1 Hongtao Zhao, 1 Ting Zhou, 1 Dimitrios Spiliotopoulos, 1 Chitra Rajendran,
More informationExam I Answer Key: Summer 2006, Semester C
1. Which of the following tripeptides would migrate most rapidly towards the negative electrode if electrophoresis is carried out at ph 3.0? a. gly-gly-gly b. glu-glu-asp c. lys-glu-lys d. val-asn-lys
More informationUsing NMR to study Macromolecular Interactions. John Gross, BP204A UCSF. Nov 27, 2017
Using NMR to study Macromolecular Interactions John Gross, BP204A UCSF Nov 27, 2017 Outline Review of basic NMR experiment Multidimensional NMR Monitoring ligand binding Structure Determination Review:
More informationA novel fluorescent probe for paraquat and cyanide in water based on pillar[5]arene/10-methylacridinium iodide molecular recognition
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 A novel fluorescent probe for paraquat and cyanide in water based on pillar[5]arene/10-methylacridinium
More informationBMB/Bi/Ch 173 Winter 2018
BMB/Bi/Ch 173 Winter 2018 Homework Set 8.1 (100 Points) Assigned 2-27-18, due 3-6-18 by 10:30 a.m. TA: Rachael Kuintzle. Office hours: SFL 220, Friday 3/2 4:00-5:00pm and SFL 229, Monday 3/5 4:00-5:30pm.
More informationSupplementary Information
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2017 Supplementary Information Probing the excited-state chemical shifts and exchange
More informationNMR parameters intensity chemical shift coupling constants 1D 1 H spectra of nucleic acids and proteins
Lecture #2 M230 NMR parameters intensity chemical shift coupling constants Juli Feigon 1D 1 H spectra of nucleic acids and proteins NMR Parameters A. Intensity (area) 1D NMR spectrum: integrated intensity
More informationSupporting Information
Supporting Information Synthesis of a new class of ribose functionalized dinucleotide cap analogues for biophysical studies on interaction of cap-binding proteins with the 5 end of mrna. Karolina Piecyk,
More informationSupporting Information
Supporting Information Li et al. 10.1073/pnas.1314303110 SI Text Preparation of NMR Samples. Mutagenesis, protein expression, and purification were performed as previously described (1), except that the
More informationConcentration measurements by PULCON using X-filtered or 2D NMR spectra
MAGNETIC RESONANCE IN CHEMISTRY Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/mrc.1838 Concentration measurements by PULCON using X-filtered or 2D NMR spectra Lars Dreier
More informationOutline. Introduction to membrane fusion Experimental methods Results Discussion and conclusion
Three-dimensional Structure of the rsly1 N-terminal Domain Reveals a Conformational Change Induced by Binding to Syntaxin 5 Demet Arac, Irina Dulubova, Jimin Pei, Iryna Huryeva, Nick V. Grishin and Josep
More informationSupporting Information
Supporting Information Arai et al. 10.1073/pnas.15179911 SI Text Protein Expression and Purification. Myb3 (mouse, residues 84 315) was expressed in Escherichia coli as a fusion with the B1 domain of protein
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice David Baker Autumn Quarter 2014 Slides Courtesy of Gabriele Varani Recommended NMR Textbooks Derome, A. E. (1987) Modern NMR Techniques for Chemistry Research,
More informationSupporting Information
Supporting Information Micelle-Triggered b-hairpin to a-helix Transition in a 14-Residue Peptide from a Choline-Binding Repeat of the Pneumococcal Autolysin LytA HØctor Zamora-Carreras, [a] Beatriz Maestro,
More informationSupplemental Methods. Protein expression and purification
Supplemental Methods Protein expression and purification The isolated collagen-binding domain of hlair-1, amino acid 22-122, was cloned into pet3xa using introduced BamHI and NotI sites at the 5 and 3
More informationSupplemental data for
Supplemental data for A Real-Time Guanine Nucleotide Exchange Assay using NMR: Activation of RhoA by PDZ- RhoGEF. Geneviève M.C. Gasmi-Seabrook 1,3, Christopher B. Marshall 1,3, Melissa Cheung 1,3, Bryan
More informationRedox-Responsive Complexation between a. Pillar[5]arene with Mono ethylene oxide Substituents. and Paraquat
Redox-Responsive Complexation between a Pillar[5]arene with Mono ethylene oxide Substituents and Paraquat Xiaodong Chi, Min Xue, Yong Yao and Feihe Huang* MOE Key Laboratory of Macromolecular Synthesis
More informationisotope.com Biomolecular NMR
Biomolecular NMR tel: +1.978.749.8000 fax: +1.978.749.2768 1.800.322.1174 (North America) cilsales@ 37 Cambridge Isotope Laboratories, Inc. Deuterated Detergents and Phospholipids for Membrane Proteins
More informationDifferential Scanning Fluorimetry: Detection of ligands and conditions that promote protein stability and crystallization
Differential Scanning Fluorimetry: Detection of ligands and conditions that promote protein stability and crystallization Frank Niesen PX school 2008, Como, Italy Method introduction Topics Applications
More informationChristopher Pavlik Bioanalytical Chemistry March 2, 2011
Nuclear Magnetic Resonance of Proteins Christopher Pavlik Bioanalytical Chemistry March 2, 2011 Nuclear Magnetic Resonance NMR Application of a magnetic field causes absorption of EM energy that induces
More informationBiochemistry 530 NMR Theory and Practice
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationBIMS 503 Exam I. Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total)
BIMS 503 Exam I September 24, 2007 _ /email: Sign Pledge Here: Questions from Robert Nakamoto (40 pts. Total) Questions 1-6 refer to this situation: You are able to partially purify an enzyme activity
More informationTHE UNIVERSITY OF MANITOBA. PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS
PAPER NO: 409 LOCATION: Fr. Kennedy Gold Gym PAGE NO: 1 of 6 DEPARTMENT & COURSE NO: CHEM 4630 TIME: 3 HOURS EXAMINATION: Biochemistry of Proteins EXAMINER: J. O'Neil Section 1: You must answer all of
More informationBasic One- and Two-Dimensional NMR Spectroscopy
Horst Friebolin Basic One- and Two-Dimensional NMR Spectroscopy Third Revised Edition Translated by Jack K. Becconsall WILEY-VCH Weinheim New York Chichester Brisbane Singapore Toronto Contents XV 1 The
More informationSupplementary Information. Synthesis and biological activity of a CXCR4-targeting bis(cyclam) lipid
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supplementary Information Synthesis and biological activity of a CXCR4-targeting
More informationSupporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS
Supporting Protocol This protocol describes the construction and the force-field parameters of the non-standard residue for the Ag + -site using CNS CNS input file generatemetal.inp: remarks file generate/generatemetal.inp
More informationElectronic Supplemental Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 1 Electronic Supplemental Information Coexisting Order and Disorder Within a Common 40-Residue
More informationFigure S1. Interaction of PcTS with αsyn. (a) 1 H- 15 N HSQC NMR spectra of 100 µm αsyn in the absence (0:1, black) and increasing equivalent
Figure S1. Interaction of PcTS with αsyn. (a) 1 H- 15 N HSQC NMR spectra of 100 µm αsyn in the absence (0:1, black) and increasing equivalent concentrations of PcTS (100 µm, blue; 500 µm, green; 1.5 mm,
More informationProtein Structure Determination from Pseudocontact Shifts Using ROSETTA
Supporting Information Protein Structure Determination from Pseudocontact Shifts Using ROSETTA Christophe Schmitz, Robert Vernon, Gottfried Otting, David Baker and Thomas Huber Table S0. Biological Magnetic
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supplementary Material Rational Design of Aziridine containing Cysteine Protease Inhibitors with improved Potency
More informationLecture 8 (9/29/17) Lecture 8 (9/29/17)
Reading: Ch3; 97-102 Lecture 8 (9/29/17) Problems: Ch3 (text); 18, 19, 20, 23 Ch3 (Study guide); 9 Ch4 (Study guide); 3 NEXT Reading: Ch4; 119-122, 125-126, 131-133 Ch4; 123-124, 130-131, 133, 137-138
More informationBiochemistry 530 NMR Theory and Practice. Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington
Biochemistry 530 NMR Theory and Practice Gabriele Varani Department of Biochemistry and Department of Chemistry University of Washington 1D spectra contain structural information.. but is hard to extract:
More informationNMR in Medicine and Biology
NMR in Medicine and Biology http://en.wikipedia.org/wiki/nmr_spectroscopy MRI- Magnetic Resonance Imaging (water) In-vivo spectroscopy (metabolites) Solid-state t NMR (large structures) t Solution NMR
More informationEnantioselective desymmetrisation of citric acid catalysed by the substratetolerant petrobactin biosynthetic enzyme AsbA
This journal is The Royal Society of Chemistry 9 Supporting information Enantioselective desymmetrisation of citric acid catalysed by the substratetolerant petrobactin biosynthetic enzyme AsbA Daniel Oves-Costales,
More informationI690/B680 Structural Bioinformatics Spring Protein Structure Determination by NMR Spectroscopy
I690/B680 Structural Bioinformatics Spring 2006 Protein Structure Determination by NMR Spectroscopy Suggested Reading (1) Van Holde, Johnson, Ho. Principles of Physical Biochemistry, 2 nd Ed., Prentice
More informationHigh-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE
High-Resolutio n NMR Techniques i n Organic Chemistry TIMOTHY D W CLARIDGE Foreword Preface Acknowledgements V VI I X Chapter 1. Introduction 1.1. The development of high-resolution NMR 1 1.2. Modern
More informationInverse Detection in Multinuclear NMR
Inverse Detection in Multinuclear NMR The HETCOR experiment is an example of a directly-detected heteronuclear experiment. The timing diagram for the most basic form of the HETCOR pulse sequence is shown
More informationDeuteration: Structural Studies of Larger Proteins
Deuteration: Structural Studies of Larger Proteins Problems with larger proteins Impact of deuteration on relaxation rates Approaches to structure determination Practical aspects of producing deuterated
More informationAmino acid type-selective backbone 1 H- 15 N-correlations for Arg and Lys
Journal of Biomolecular NMR, 20: 379 384, 2001. KLUWER/ESCOM 2001 Kluwer Academic Publishers. Printed in the Netherlands. 379 Amino acid type-selective backbone 1 H- 15 N-correlations for Arg and Lys Mario
More informationA prevalent intraresidue hydrogen bond stabilizes proteins
Supplementary Information A prevalent intraresidue hydrogen bond stabilizes proteins Robert W. Newberry 1 & Ronald T. Raines 1,2 * 1 Department of Chemistry and 2 Department of Biochemistry, University
More informationEasy, Robust and Accurate NMR Analysis of Biomolecules using BioPack
Easy, Robust and Accurate NMR Analysis of Biomolecules using BioPack Technical Overview Author George Gray Agilent Technologies Santa Rosa, CA USA Introduction In the last fi fteen years, scientists have
More informationTHE UNIVERSITY OF MANITOBA. PAPER NO: _1_ LOCATION: 173 Robert Schultz Theatre PAGE NO: 1 of 5 DEPARTMENT & COURSE NO: CHEM / MBIO 2770 TIME: 1 HOUR
THE UNIVERSITY OF MANITOBA 1 November 1, 2016 Mid-Term EXAMINATION PAPER NO: _1_ LOCATION: 173 Robert Schultz Theatre PAGE NO: 1 of 5 DEPARTMENT & COURSE NO: CHEM / MBIO 2770 TIME: 1 HOUR EXAMINATION:
More information